ID: 960094693

View in Genome Browser
Species Human (GRCh38)
Location 3:113677925-113677947
Sequence GAGAGGTCTGGGTAGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960094688_960094693 -8 Left 960094688 3:113677910-113677932 CCAAACATGACAAATGAGAGGTC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 960094693 3:113677925-113677947 GAGAGGTCTGGGTAGGGCCCAGG 0: 1
1: 0
2: 6
3: 36
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960094693 Original CRISPR GAGAGGTCTGGGTAGGGCCC AGG Intronic
900089642 1:914306-914328 GAGTGGCCTGGGTGGGGCCCGGG - Intergenic
900627216 1:3613950-3613972 AAGAGTCCTGGGTAGGCCCCAGG + Intergenic
901185453 1:7369857-7369879 GAGAGGTCTGGGCTGTGCCCTGG - Intronic
902032655 1:13434208-13434230 GAGAGGTGTGGGTGGGAACCGGG - Intergenic
902262712 1:15238764-15238786 GAGAAGTCTGGTTAAGGCTCTGG + Intergenic
902301378 1:15505089-15505111 AGGAGGTCTGGGTGGGGCCCAGG - Intronic
902434926 1:16392326-16392348 GACTGCTCTGGGTAGGGTCCTGG + Intronic
902687736 1:18089773-18089795 GGGAGGTAGGGGTAGGGTCCAGG + Intergenic
903191979 1:21662057-21662079 GAGAGGTCTGTATGGGGCCAGGG - Intronic
903468359 1:23568111-23568133 GGGAGGGCCGGGTAGGGCCAGGG - Intergenic
903651193 1:24923350-24923372 GAGAGAGCTGGGCAGGGCCGGGG - Intronic
903775468 1:25790610-25790632 GAGAGGTCAGGGATGGCCCCTGG + Intergenic
904238671 1:29130100-29130122 GAGGCATCTGGATAGGGCCCAGG - Intergenic
904411252 1:30326195-30326217 GAAATGTCTGGGAAGGTCCCCGG - Intergenic
904479855 1:30786910-30786932 GGGAAGTCAGGGGAGGGCCCGGG + Intergenic
905171675 1:36113520-36113542 GCGAGGTCTGGGAAGGGACTTGG + Intronic
905364229 1:37440126-37440148 GAGGAGGCTGGGTAGGGGCCAGG + Intergenic
906206831 1:43991598-43991620 AAGAGGTGGGGCTAGGGCCCTGG + Exonic
906226879 1:44129797-44129819 GAGAGGCCAGGGTAAGGCACTGG - Exonic
906276871 1:44523305-44523327 GAAGGGTCTGGGCAGGCCCCAGG + Intronic
906685211 1:47758766-47758788 CAGAGGTCTGGGCAGGCTCCTGG + Intergenic
907108726 1:51907126-51907148 GAGAGGTGGGGGTAGGGAGCAGG + Intergenic
907279771 1:53339907-53339929 GAGAGGACAGAGTGGGGCCCAGG - Intergenic
907307706 1:53522537-53522559 GACAGGTCTGGGATGGACCCTGG + Intronic
908246067 1:62228574-62228596 GAGAGGTCTGGAAAGGGCTGCGG - Intergenic
910399940 1:86828386-86828408 GGGAGGTGTGGGGTGGGCCCTGG + Intergenic
911254445 1:95618083-95618105 GCCAGGTCAGGGAAGGGCCCTGG + Intergenic
911693479 1:100861873-100861895 GAGAGGGCTGGGCAGAGCCTGGG - Intergenic
915903576 1:159862767-159862789 GTGAGGGCTGGGTAATGCCCAGG - Intronic
916077323 1:161209408-161209430 GAGAGGTCTGGGCAGAGCCTGGG - Intronic
917265408 1:173215971-173215993 GATAGGTCTGGGGTGGGGCCTGG - Intergenic
917839892 1:178969346-178969368 GGGTGGTCAGGGAAGGGCCCTGG + Intergenic
917899295 1:179526169-179526191 GAGAGGTCTGGTGATGGGCCTGG - Intronic
920055057 1:203185392-203185414 GAGAAGTCTGGGATGGGGCCCGG + Intronic
920506396 1:206518301-206518323 GAGGGCTCCGGGGAGGGCCCTGG - Intronic
920640972 1:207751934-207751956 GAGAGGTCAGGGGGAGGCCCTGG - Intergenic
921340530 1:214129502-214129524 GAGGGGTCAAGGTAAGGCCCAGG - Intergenic
922734966 1:227973849-227973871 GAGAGGACGGAGTTGGGCCCGGG - Intergenic
923631274 1:235650339-235650361 GAGGGGTCTGGGGCGGGGCCGGG + Intronic
1062855040 10:775823-775845 TGGAGGCCTGGGTTGGGCCCAGG - Intergenic
1062874399 10:932420-932442 GGGAGTTCTGGGCAGGGCCGGGG - Intergenic
1062874418 10:932464-932486 GGGAGTTCTGGGCAGGGCCGGGG - Intergenic
1064409008 10:15089027-15089049 GAGAGGTCTCCGTAGGGCACAGG + Intergenic
1065979228 10:30875132-30875154 TTGAGCTCTGGGTAGGGCCAAGG + Intronic
1067064721 10:43097291-43097313 CAGAAGAGTGGGTAGGGCCCTGG - Intronic
1070827996 10:79402212-79402234 CAGAGGTCCAGGTTGGGCCCTGG + Intronic
1071475721 10:86023533-86023555 GAGGGGTCTGGACAGGGACCTGG - Intronic
1072747237 10:97949357-97949379 GAGAGTCCTGGGCAGGGCCAGGG + Intronic
1072799621 10:98384057-98384079 CAAAGGTCTGGGGAGGGGCCAGG + Intronic
1073147034 10:101287897-101287919 GAGAGGTCAGGGTGGTGCCCAGG - Intergenic
1076380640 10:130022638-130022660 CAGAGGACAGGGCAGGGCCCAGG - Intergenic
1076575619 10:131464867-131464889 GTGAGGCCAGGGGAGGGCCCTGG - Intergenic
1076856173 10:133116499-133116521 GAAGGGTTTGGGCAGGGCCCAGG - Intronic
1077123656 11:922752-922774 TTCAGGTCTGGGTAGGACCCAGG + Intergenic
1077181949 11:1220725-1220747 GAGGGGTCTGGCTGGGGCCTGGG + Intergenic
1077284247 11:1758802-1758824 GAGGGGTCTGGGAATGGGCCTGG - Intronic
1077530002 11:3090590-3090612 GAGAGCTCTGGGCAGGACTCAGG + Exonic
1077666619 11:4116132-4116154 GAGTGGTCAGGGTAGGGGCAGGG + Intronic
1077718008 11:4600616-4600638 GACAGGTCTGAGTGGGGCCTGGG - Exonic
1078066023 11:8080256-8080278 GAGAGGTCTGCGGAGGGGCACGG - Intronic
1081304213 11:41491789-41491811 GAGAGGTTTGGAAAGGGCCAAGG + Intergenic
1081693524 11:45094318-45094340 GAGGCTTCTGGGAAGGGCCCGGG + Intergenic
1082001519 11:47395754-47395776 GAGAGATCTGGGTACTGGCCAGG - Intergenic
1083195258 11:61082199-61082221 GTGAGGTCTGGGTAGGGTGTGGG - Intergenic
1083474958 11:62909616-62909638 GTGAGGCCTGAGCAGGGCCCTGG + Exonic
1083654004 11:64220331-64220353 GTGAGGGCTGGGCAGGGGCCAGG + Intronic
1083954117 11:65973619-65973641 GAGAGGTGTGGGGTGGGCCCCGG - Intronic
1084182319 11:67452985-67453007 GAAAAGTCTGGGTTGAGCCCTGG - Intronic
1084572080 11:69965971-69965993 GAGGGGCCTGGGGAGGGGCCTGG - Intergenic
1084729095 11:71061806-71061828 GAGAGCACTGGGCAGGTCCCTGG + Intronic
1084934345 11:72579076-72579098 GACCGCTCTGGGTTGGGCCCTGG - Intronic
1085500793 11:77021248-77021270 GAGAGGTCATGGTTGTGCCCAGG + Exonic
1085738626 11:79060948-79060970 GAGAGGTCTGGCTGGGGCCCAGG + Intronic
1085746066 11:79115301-79115323 GAGAGGGCTGGGGAGGACCTTGG + Intronic
1085746514 11:79119567-79119589 GAAAGGTCTGGGCAGGCGCCTGG - Intronic
1085953455 11:81362026-81362048 GAGATGTCTGCTCAGGGCCCTGG - Intergenic
1086910849 11:92470148-92470170 GAGAGGTCTGGGTTCTGCCTCGG - Intronic
1088596680 11:111446220-111446242 GTGAGGCCAGGGTAGAGCCCAGG - Intronic
1088707853 11:112479951-112479973 CAGTGGTCTGGGGAGGGACCTGG + Intergenic
1089203362 11:116739050-116739072 CTGAGGTCTGAGCAGGGCCCAGG - Intergenic
1089628171 11:119764935-119764957 GAGGGTTCTGGGTATGTCCCAGG + Intergenic
1089679065 11:120109447-120109469 CAGAGGTGTGGGTAGCCCCCTGG - Intergenic
1089681686 11:120122218-120122240 GGGAGGCCTGGGTAAGGCACAGG - Intronic
1089700979 11:120243591-120243613 GAGAGGTGTGGGGTGGGGCCAGG - Intronic
1090239127 11:125169772-125169794 GAGAGTTGTGGGGAAGGCCCTGG - Intronic
1090239704 11:125173482-125173504 GAGAGGACTAGGTAGAGCTCAGG - Intronic
1091439516 12:501749-501771 AGGAGGTCTGGGTAGAGTCCAGG + Intronic
1091762105 12:3094383-3094405 GAGAGGCATGGGGAGGTCCCTGG - Intronic
1092118979 12:6030576-6030598 AGTAGGTCTGGGTGGGGCCCAGG - Intronic
1092174085 12:6391017-6391039 CAGGGGCCTGAGTAGGGCCCGGG + Exonic
1092963961 12:13624019-13624041 GAGAGGTCTGAGAAGGGCCAAGG - Intronic
1093567625 12:20627349-20627371 GATAGGGTTGGGTAGGGCCAGGG - Intronic
1096069267 12:48765904-48765926 GAGAGGTCTGTGAGGGGCCAAGG + Intergenic
1096258607 12:50077440-50077462 GTGAGACCTGGGCAGGGCCCGGG + Intronic
1097282392 12:57852939-57852961 GAGAGGTGGGGGTGGGGCACAGG - Intergenic
1097891281 12:64780538-64780560 GAGCGCTCTGGGTAGAGGCCGGG + Intergenic
1101585201 12:106079635-106079657 GAGTGGTCAGGGAAGGCCCCTGG - Intronic
1102491619 12:113292897-113292919 GGCAGGTGTGGGAAGGGCCCGGG - Intronic
1102985027 12:117271141-117271163 CATAGGTCTGGGGTGGGCCCTGG - Intronic
1103558496 12:121779873-121779895 GAGAGGCCAGGGTGGGGGCCTGG - Exonic
1103875186 12:124121650-124121672 GAGAGATATGGGTTGGACCCTGG - Intronic
1104354173 12:128070787-128070809 GAGAGGCCTGGGCATGGGCCCGG - Intergenic
1104731666 12:131108673-131108695 GACAGCTCTGGGGTGGGCCCTGG - Intronic
1104903539 12:132201793-132201815 GAGACGCCTGGGCAGGGACCAGG - Intronic
1106172405 13:27299255-27299277 GAAAGTTCTGTGAAGGGCCCAGG - Intergenic
1107358251 13:39591693-39591715 GGAAGGTCTGGGTGGGGCCCAGG - Intronic
1108023221 13:46150744-46150766 GGCAGGTCTGTGTATGGCCCAGG + Intronic
1108818471 13:54317888-54317910 GAGAGGTGTGGGCAGGAGCCTGG + Intergenic
1110873673 13:80483034-80483056 AAGAGGGCTGGGTATGGCACAGG + Intergenic
1112161110 13:96868854-96868876 GAGAGGTCAGGGTAGTAGCCTGG + Intergenic
1112338873 13:98536742-98536764 GAGAGGTCAGGGCAGCTCCCGGG - Intronic
1113390611 13:109892934-109892956 GAGAGGTCTGTGCAGGGCACTGG + Intergenic
1113557671 13:111251495-111251517 GAGTGGTCTGGGTGGGGCAGAGG + Intronic
1113962206 13:114132380-114132402 GAGAGGACAGGGTCGGGCCGGGG + Intronic
1114221985 14:20704888-20704910 GTGTGGTCTGGGTAGGGAACAGG - Intergenic
1116356713 14:43939067-43939089 GAGAGGGCTGGGTGGGGCTAAGG + Intergenic
1118007215 14:61574254-61574276 GAGAGGGCTGGGAAAGGCCCAGG - Intronic
1119201038 14:72753197-72753219 GGGAGGACTGGGCTGGGCCCAGG - Intronic
1119787986 14:77327080-77327102 AGGAGGCCTGGGAAGGGCCCAGG + Intronic
1120478319 14:85017560-85017582 GAGAGGTATGGGAAGTGCCTAGG + Intergenic
1121407846 14:93729678-93729700 GAGAGGGCTGGGTTGGCCCCTGG + Intronic
1122186108 14:99997533-99997555 GAAAGGTATGGGGAGGGCCGTGG + Intronic
1122421378 14:101579587-101579609 GAGAGGTCTGGGCTGGGCATTGG + Intergenic
1125733872 15:41910119-41910141 GAGTGGTATGGGTGGGGCCTGGG + Intronic
1127366848 15:58299381-58299403 GAGAGGTCTGGGCTGAGCCCTGG - Intronic
1127832128 15:62760143-62760165 GAGAGGTGAGGGTAGGGTCAGGG + Intronic
1128497726 15:68207752-68207774 GAGAGGGCTGGGTGGGGCAGAGG - Exonic
1128632590 15:69281285-69281307 CAGAGGTCTCTGCAGGGCCCTGG - Intergenic
1129109352 15:73328684-73328706 GAGAAGCTGGGGTAGGGCCCAGG + Intronic
1129156509 15:73721618-73721640 CAGAGGCCTGGCTAGGGCCAGGG - Intergenic
1129185826 15:73905875-73905897 CAGAGGCCAGGGAAGGGCCCTGG - Intergenic
1129207926 15:74048245-74048267 GAGTGGTCAGGGTTGGGGCCAGG - Intergenic
1129255758 15:74333134-74333156 GAGAGGCCTGTGTAGGGTCCAGG - Intronic
1130267264 15:82418354-82418376 GAAAGGTGTGGGCAGAGCCCCGG + Intergenic
1130504757 15:84528496-84528518 GAAAGGTGTGGGCAGAGCCCCGG - Intergenic
1130537862 15:84799803-84799825 GAGAGGTCAGGTAAGTGCCCGGG - Intronic
1131055524 15:89372193-89372215 AAGGGGCCTGGGTAGGGGCCTGG + Intergenic
1131116960 15:89801714-89801736 GGGAGGCCTGGGAAGGGCACTGG + Intronic
1131516196 15:93078745-93078767 GCCAGGTTTGGGTAGAGCCCAGG + Intronic
1132501777 16:287739-287761 CCCAGGTCTGGGTGGGGCCCAGG - Exonic
1132666330 16:1082875-1082897 AAGATGTCTGGGGAGGTCCCAGG + Intergenic
1132939249 16:2498831-2498853 GGGAGCTCTGGGTTGGGCCTGGG + Intronic
1133042701 16:3068914-3068936 GAGAGGCCTGGGTGTGGCCAGGG + Intronic
1133148130 16:3806031-3806053 GGGAGGACTGGGTGAGGCCCAGG + Intronic
1133558410 16:6927169-6927191 GTTAGGTCTGGGTGGGGCTCAGG + Intronic
1133612978 16:7450614-7450636 GAGAGGTCTGGAAAGGAGCCTGG - Intronic
1133772601 16:8876138-8876160 CTGAAGTCTGGGTGGGGCCCCGG + Intergenic
1134682273 16:16134509-16134531 GTGGGGTCTGGGTGTGGCCCAGG + Intronic
1134888618 16:17818371-17818393 GAAAGGTTTGTGTGGGGCCCAGG + Intergenic
1135423233 16:22318409-22318431 GTGAGCCCTGGGCAGGGCCCAGG - Intronic
1135486309 16:22868616-22868638 AACAGTCCTGGGTAGGGCCCAGG - Intronic
1136032565 16:27514294-27514316 GAGAGGGCAGGGCAGGGGCCTGG - Intronic
1136060244 16:27721443-27721465 GAGAGGCCTGGTGAGGGCTCAGG - Intronic
1138474470 16:57262793-57262815 GAGAGTGCAGGGCAGGGCCCCGG - Intronic
1138651155 16:58462628-58462650 GAGAGGTCTGCGGAAGGGCCCGG + Intergenic
1140043684 16:71425859-71425881 GCGAGGGGTGAGTAGGGCCCTGG - Intergenic
1140207752 16:72947584-72947606 GAGAGGTCTGGGAGGGCCACCGG + Intronic
1141004362 16:80338174-80338196 GAGAGCTGTGGGTGGGGCTCTGG - Intergenic
1141462061 16:84183525-84183547 GAAAGGGCTGGGGAGGGCACAGG + Intronic
1142008994 16:87704314-87704336 GAGGCGCCTGGGGAGGGCCCTGG + Intronic
1142009057 16:87704511-87704533 GAGGCGCCTGGGGAGGGCCCTGG + Intronic
1142106243 16:88304432-88304454 GAGAGGTCTGGATGGAGGCCTGG - Intergenic
1142114364 16:88348647-88348669 CAGGGGTCTGGGCAGGGCCTGGG - Intergenic
1142147137 16:88497410-88497432 GAGGGGTCAGGGTGGGGCTCAGG + Intronic
1142147156 16:88497455-88497477 GAGGGGTCAGGGTGGGGCTCAGG + Intronic
1142147176 16:88497500-88497522 GAGGGGTCAGGGTGGGGCTCAGG + Intronic
1142874733 17:2844805-2844827 GAGAACTCTGGGTTGGGTCCAGG - Intronic
1143112609 17:4560648-4560670 AACAGGTCTGGGCAGGGCACGGG + Exonic
1144482556 17:15639790-15639812 GGGGGGCCTGGGTGGGGCCCAGG - Intronic
1144640035 17:16931930-16931952 GAGGGGGCTGGGTCAGGCCCGGG - Intronic
1144658229 17:17051671-17051693 GAGAGCTCTGGGTAGGGCATGGG - Intronic
1144872256 17:18378469-18378491 GAGAGCTCTGGGGAGGGCTCTGG - Intronic
1144916127 17:18725241-18725263 GGGGGGCCTGGGTGGGGCCCAGG + Intronic
1146810661 17:35900369-35900391 GTGAGAACTGGGTGGGGCCCAGG + Intergenic
1146915226 17:36673987-36674009 GAGGGGTCAGGGAAGGGCCAGGG + Intergenic
1146952764 17:36918333-36918355 GAGAGGTGTGGGTGGGGGGCAGG + Intergenic
1147339515 17:39745379-39745401 GAGAGGTCAGAACAGGGCCCAGG - Intronic
1147947147 17:44086635-44086657 GGGAGGACTGGGTACGGCCCAGG + Exonic
1148219207 17:45850226-45850248 GACAGGTCTGGGGTGGGACCAGG + Intergenic
1148362837 17:47027388-47027410 GAGAGGTATGGGTAGGGTTAGGG + Intronic
1148747737 17:49927836-49927858 GAGGGGTCTTGGCAGGGCCCTGG - Intergenic
1148834663 17:50459735-50459757 AACAGGTCTGGGTAGAGGCCTGG - Intronic
1148936353 17:51166795-51166817 GAGAGGTGCGGTCAGGGCCCGGG - Exonic
1149997678 17:61413212-61413234 GTGGGGACTGGGGAGGGCCCAGG + Exonic
1151321370 17:73354577-73354599 GAGGGGTCTGGCTAGGCCCAGGG - Intronic
1151384263 17:73745539-73745561 AGGAGGTGTGGGTGGGGCCCTGG + Intergenic
1151498091 17:74471727-74471749 GAGAGGTTTGGGTGGGACTCTGG + Intronic
1151701399 17:75744447-75744469 GAATGGTCTGGGCAGGTCCCTGG - Intronic
1151812677 17:76453457-76453479 GAGTGGTCGGGGTGGGGCACAGG + Exonic
1152556749 17:81057130-81057152 GAAAGGGCGGGGCAGGGCCCCGG - Intronic
1152705996 17:81843975-81843997 GAGGGGTCTCGGCAGCGCCCGGG + Exonic
1153900480 18:9614138-9614160 GCGAGGCCTGGGCCGGGCCCTGG - Intronic
1155509246 18:26560499-26560521 GATAGGTCTGGGAAGTGGCCTGG + Intronic
1157488669 18:48107378-48107400 GAGAGGTGGGAGAAGGGCCCAGG + Intronic
1157617944 18:48998467-48998489 GGGAGGTCTGGCTCGGGGCCAGG - Intergenic
1157863929 18:51165078-51165100 GAGAGGCCTGGGAAGGGCCTGGG + Intergenic
1158273468 18:55741607-55741629 GAGAGGTCTGTATATGGCCAAGG - Intergenic
1159960923 18:74555358-74555380 GCGAGGGCTGGGAAGGGCCAAGG - Intronic
1160722602 19:604098-604120 GAGAGATCTGGGTGGGGTCAAGG + Intronic
1160722645 19:604221-604243 GAGAGATCTGGGTGGGGTCAAGG + Intronic
1160722676 19:604303-604325 GAGAGATCTGGGTGGGGTCAAGG + Intronic
1160951947 19:1672034-1672056 GAGGGGTCTGGGGAGGACCCCGG - Intergenic
1161366669 19:3883926-3883948 GAGCAGTCTGGGTGGGGGCCAGG - Intronic
1161735653 19:5990752-5990774 GAGAGGAGTGGGCAGGACCCAGG + Intergenic
1161791337 19:6361955-6361977 GAGAGTCCTGGGGAGGGTCCCGG - Intronic
1162124420 19:8491592-8491614 GAGAGGTTTGGGAGGGGACCTGG - Intronic
1162144472 19:8605373-8605395 CAGAGGCCTGGGGTGGGCCCTGG + Intronic
1162780936 19:13006778-13006800 GAGAGCTCTGGGCTGGGGCCCGG + Intronic
1163105032 19:15118396-15118418 TAGAGGCCTGGGTGGGGCCAAGG + Intronic
1163130966 19:15272790-15272812 GAGTAGTGTGGGCAGGGCCCAGG - Intronic
1163312294 19:16521727-16521749 GTGGGGTCAGGGCAGGGCCCAGG + Intronic
1163673854 19:18645417-18645439 GAGACGCCTGGGTAGGGCCCAGG + Intronic
1165112570 19:33510935-33510957 GAGAGAGCTGGGTTGGGCCTGGG - Intronic
1165167740 19:33869015-33869037 GAGCAGTGTGGGCAGGGCCCAGG + Intergenic
1165933853 19:39377375-39377397 CAGAAGGCTGGGTAGGACCCTGG - Intronic
1165994993 19:39837686-39837708 GAGGGGTCTGGGGGTGGCCCCGG - Intronic
1166102376 19:40578319-40578341 GGGAGGACTGGTTATGGCCCTGG + Intronic
1166704446 19:44900916-44900938 GGGAGGACGGGCTAGGGCCCTGG + Intronic
1168287036 19:55340254-55340276 GTGAGGTCAGGGAAAGGCCCTGG - Intronic
1168301615 19:55407952-55407974 GAGAGGGCTGGGTAGCGGGCCGG + Intergenic
1168405544 19:56108418-56108440 GAGAGCTCTGGGCAGGGGCAGGG - Intronic
926222363 2:10944652-10944674 GAGAGGGCAGGGAAGGGGCCAGG - Intergenic
927432209 2:23036336-23036358 TAGAGGACAGGGCAGGGCCCAGG - Intergenic
928206478 2:29288174-29288196 GACAGGTCTGAGTAGGGCAGGGG + Intronic
929486781 2:42361601-42361623 GCGTGGTCTGGGTAGGGGCGGGG + Exonic
929594516 2:43167993-43168015 GAGAGGCCTGGGGATTGCCCAGG - Intergenic
930604038 2:53473942-53473964 GAGAGCCCTGACTAGGGCCCTGG + Intergenic
934752284 2:96800773-96800795 CAGAGGCCCGGTTAGGGCCCAGG + Intronic
934886870 2:98032659-98032681 GAGAGGGATGGGGTGGGCCCTGG + Intergenic
935652234 2:105392111-105392133 CGGAGGTCTGGGGATGGCCCAGG + Intronic
937314476 2:120922294-120922316 GAAGGGTCTGGGCAGGTCCCTGG + Intronic
937981815 2:127620193-127620215 GAGGAGGCTGGGCAGGGCCCCGG + Intronic
938899793 2:135790344-135790366 GAATGGTCTGGGTAGGGCCCAGG - Intronic
940120237 2:150256376-150256398 GAAAGGTCTGGGAAGGGTCTCGG - Intergenic
940850434 2:158683113-158683135 GAGTGGTCAGGGTGGGGTCCAGG - Intergenic
941067935 2:160924403-160924425 TATAGGTCTGGGCTGGGCCCTGG - Intergenic
941285821 2:163611038-163611060 GTGGGGTCTGGGTACAGCCCTGG - Exonic
941874794 2:170421510-170421532 GAGAGGGCTGGGTGGCACCCCGG - Intronic
942042292 2:172078851-172078873 GAGGGGTGTGGGCAAGGCCCAGG + Intronic
946169947 2:217889150-217889172 GAAAATTCTGGTTAGGGCCCTGG - Intronic
946178250 2:217935060-217935082 GAGAGGTCTGTGTAGTGCCGCGG - Intronic
946188571 2:217995502-217995524 GGGAGGGCTGGGTAGGTACCAGG - Intronic
947750412 2:232529209-232529231 CAGAGGCATGGGGAGGGCCCTGG - Intronic
948496360 2:238352352-238352374 GAGAGGTCTGGGGTCAGCCCTGG + Intronic
949045514 2:241871072-241871094 GAGAGGTTTGGGGAGAGCACTGG - Intronic
949047512 2:241878665-241878687 GAGAGCTCAGGGGAGGGCTCAGG - Intergenic
949048122 2:241881566-241881588 GAGGGGGCTGGGTAGGGGCGTGG + Intergenic
1170703929 20:18728065-18728087 GAGGGGCATGGGTAGGACCCTGG + Intronic
1171001759 20:21422575-21422597 GAGAGGTTTGGGAGGGGCCAGGG - Intergenic
1172020767 20:31912308-31912330 CACAGGTCTGGGTGGGGCCTGGG + Intronic
1172073613 20:32277519-32277541 GAGGGGTCTGGGCGGGGCTCAGG - Intergenic
1172106988 20:32522827-32522849 GAGAGCTCAGTGGAGGGCCCGGG + Intronic
1173650401 20:44660124-44660146 GACAGGTCTGGGCAGGCCTCAGG + Intergenic
1173810111 20:45950270-45950292 TTGGGGTCTGGGTAGGGGCCCGG + Exonic
1174119045 20:48248586-48248608 GAGAGGGGTGGGCAGGGACCAGG - Intergenic
1175169775 20:57072088-57072110 GGGAGGTCTGGGGAGGGGTCTGG - Intergenic
1175448471 20:59042747-59042769 GAGATGTCCGGGTAGCGCCAGGG + Exonic
1175522668 20:59612055-59612077 TAAAGCTCTGGGGAGGGCCCAGG - Intronic
1175903955 20:62370867-62370889 GAGGGGTCTGGCTATGGCTCAGG - Intergenic
1175937941 20:62523533-62523555 GAGGGCTCTGGGGAGGGCCGGGG - Intergenic
1176011667 20:62900184-62900206 GAGAGGTGTGGGGAGGGGCAGGG - Intronic
1176137906 20:63532926-63532948 CAGAGGTCTGGGCCGGGCACAGG - Intronic
1179535759 21:42050391-42050413 GAGAGCTCTGAGAGGGGCCCTGG + Intergenic
1179908857 21:44437620-44437642 GACAGGGGTAGGTAGGGCCCAGG + Intronic
1180089187 21:45525077-45525099 CAGAGCTCAGGGTAAGGCCCGGG - Intronic
1180137174 21:45869370-45869392 GAGGGGTCTGGGTGGGGTCCAGG - Intronic
1181264693 22:21624100-21624122 GGGAGGGCTGGCTGGGGCCCAGG + Intergenic
1181541602 22:23575942-23575964 AAGAGGTCTGGGTGGGGTCTGGG - Intronic
1181551474 22:23641277-23641299 AAGAGGTCTGGGTGGGGGTCTGG - Intergenic
1181796785 22:25317364-25317386 AAGAGGTCTGGGTGGGGGCTGGG + Intergenic
1182050124 22:27306264-27306286 AACAGGTCTGGGTTGGACCCAGG - Intergenic
1182401298 22:30080045-30080067 GAGAGGTCTGAGGCGGGCGCGGG - Intergenic
1182424657 22:30265784-30265806 GAGAGGTCAGGGGAGAGCCCTGG - Intronic
1182900015 22:33890022-33890044 GGGAGGGCTTGGCAGGGCCCTGG - Intronic
1183095158 22:35547488-35547510 GAGAGGTAAGGGCAGGACCCAGG + Intronic
1183186626 22:36295155-36295177 GAGAGGCCTGGCCAGGGCACAGG + Intronic
1183360509 22:37380708-37380730 GAGAGATCTGGCTGGGCCCCAGG - Intronic
1183413706 22:37670995-37671017 GTAAGGTCTGGGTGGGGGCCAGG - Intergenic
1183694601 22:39414553-39414575 GACTGATCTGGGCAGGGCCCGGG - Intronic
1183731208 22:39619517-39619539 GAGAAGACTGATTAGGGCCCGGG + Intronic
1183978408 22:41526217-41526239 CAGAGGTCAGGGCATGGCCCTGG - Exonic
1184146781 22:42616405-42616427 AAGAGGTCTGGGAAGGAGCCCGG - Intergenic
1184464487 22:44660743-44660765 GAGAGGTCTGTGTGGGGCCCAGG + Intergenic
1185330311 22:50249288-50249310 GAGGGGGCTGGGTGGGGACCTGG + Intronic
950457508 3:13101481-13101503 AGGAGGTCTGGGAAGGCCCCGGG + Intergenic
950522403 3:13504969-13504991 GAGAGGACAGGCTAGGTCCCAGG + Exonic
950614434 3:14147794-14147816 GAGAGGGCTGGGAAGAGCCTGGG + Intronic
950663449 3:14481188-14481210 GAGAGGTATGGGTGGTGCCTGGG + Intronic
953450799 3:43004212-43004234 GAGATGTCTGGGTCAGGCCATGG + Intronic
953752203 3:45617474-45617496 GGGAGGAATGGGTAGGGCACTGG - Intronic
954365443 3:50143662-50143684 GTGGGGTCTGGGTGGAGCCCGGG + Intergenic
954401368 3:50321410-50321432 GAGCGGGCTGGGCTGGGCCCGGG - Exonic
954420310 3:50415532-50415554 GAGGGGTCTGGGCAGGACCAGGG - Intronic
954648410 3:52145178-52145200 GAGAGTACTGGGTAGGGAACTGG - Intronic
954701685 3:52453963-52453985 GACAGGGCTGGGTAGGGCTGGGG - Intronic
957056196 3:75444773-75444795 GAGAGGCCTGGGCAGGAACCGGG - Intergenic
960094693 3:113677925-113677947 GAGAGGTCTGGGTAGGGCCCAGG + Intronic
960479506 3:118171398-118171420 GAGAGGTGTGGGCAGGAACCGGG + Intergenic
961452909 3:127010499-127010521 GAGAGGACCGGGTGTGGCCCAGG + Intronic
962971169 3:140403428-140403450 AGGAGGTCTGGGTGGGGCCTGGG + Intronic
964109474 3:153073805-153073827 GACAGGTCTGGGTTGGGACATGG - Intergenic
964198127 3:154088038-154088060 GAGAGGTGTGGGCAGGACCCAGG + Intergenic
964381065 3:156099469-156099491 GAGAGGCGTGGGTAGGAACCGGG + Intronic
964466353 3:156997488-156997510 AGTAGGTCTGGGTAGGGCCTAGG + Intronic
965715375 3:171596876-171596898 GAGAGGCCTGGGCAGGGGCCAGG + Intergenic
967785724 3:193492380-193492402 GAGAGGTTTAGGGAGGGCACTGG - Intronic
967861213 3:194153324-194153346 GGGAGGTCTGGGTGGAGCCCTGG - Intergenic
968093085 3:195909868-195909890 GGGAGAGCGGGGTAGGGCCCCGG - Intronic
968481310 4:834342-834364 GAGAGGTGTGGGTCAGGCCCGGG + Intergenic
968514656 4:1011170-1011192 GAGCGGTCTGGGCCCGGCCCGGG + Exonic
968610150 4:1553371-1553393 GCGGGGTCTGGGAAGGGGCCCGG + Intergenic
968672062 4:1857026-1857048 GAGCGGACAGGGTATGGCCCAGG - Intergenic
968705232 4:2074586-2074608 GAGTGGTCTGGGTGGGCCCCAGG + Intronic
968977514 4:3829820-3829842 TAGACGTCTGGGGATGGCCCGGG - Intergenic
969002268 4:3991908-3991930 ATTAGGTCTGGGTTGGGCCCCGG - Intergenic
969202374 4:5616224-5616246 CACAGGTCTGGTCAGGGCCCAGG + Intronic
969343635 4:6557945-6557967 GAGAGGTCTGGGGTGGGGCTGGG - Intronic
969435695 4:7188047-7188069 TTCTGGTCTGGGTAGGGCCCAGG + Intergenic
969710025 4:8837468-8837490 GAGAGGACAGGGCAGGGCGCTGG - Intergenic
970412753 4:15825358-15825380 GAGAGGTCAGGGGAGGTGCCAGG + Intronic
972394758 4:38649319-38649341 GAGTGGTCGGAGGAGGGCCCAGG + Intergenic
977304384 4:95304445-95304467 GAGAGGCCTGAGTAGGGACCAGG - Intronic
978619373 4:110623145-110623167 GAGAGGGCTGGGGAGGGCCGCGG - Intronic
978830018 4:113072569-113072591 CAGAGGTTTGGGTAGGGGACAGG + Intronic
984194506 4:176642498-176642520 GAGAAGCCTGGGTAGGGAGCTGG + Intergenic
984941041 4:184932612-184932634 GAGAGGGCTGGGAGGAGCCCAGG + Intergenic
985542184 5:492304-492326 GGGAGGTCAGGGTGGGGCCTTGG + Intronic
986781248 5:11067687-11067709 GAGGGGTCTGGGAAGGCTCCAGG - Intronic
988609670 5:32712569-32712591 GAGCGGTTGGGTTAGGGCCCGGG - Intronic
989317965 5:40104134-40104156 GAGTGGTCTGTGTATGGTCCGGG + Intergenic
989592107 5:43121430-43121452 GAGGGGTGTGGGTAGGGGCGTGG + Intronic
992013736 5:72556095-72556117 GAGTGGCCTGGGTGGGCCCCAGG - Intergenic
992910847 5:81394331-81394353 GAGAAGTCTGGGAAGTGCGCGGG + Intergenic
993493193 5:88577324-88577346 GAGAGGACTGGGAGGGGCCAGGG - Intergenic
993849657 5:92990923-92990945 GGGAGGTCAGGATAGGTCCCTGG + Intergenic
998214479 5:140227054-140227076 CAGAGGGCTGGTTAGGGACCTGG + Intronic
1002106523 5:176881926-176881948 CAGAGGTGTGGGCTGGGCCCAGG - Exonic
1002643809 5:180643339-180643361 GAGAGGTGGGGGCAGGGGCCTGG - Intronic
1004075466 6:12340440-12340462 TAGAGGCCTGGGTCTGGCCCTGG + Intergenic
1004925564 6:20412315-20412337 GATTGGTCTGGGTGGGGCCTAGG - Intronic
1005013837 6:21359556-21359578 GAGGGGTTTGGGTGGGGCCTGGG - Intergenic
1006133662 6:31883221-31883243 GAGAGGACTGGGCAAGGCCTGGG - Intronic
1006170400 6:32088751-32088773 CAGAGGTTAGGGAAGGGCCCTGG - Intronic
1006547563 6:34792325-34792347 GAGAGGGTTAGGAAGGGCCCAGG - Intronic
1006876874 6:37305433-37305455 GAGAGGACGGGGTAGGGACTAGG - Intronic
1011025951 6:82869286-82869308 GAGAGGTCTTGCTATAGCCCAGG + Intergenic
1013587354 6:111591394-111591416 GAGAGGTCTGGGGAGGTCCTGGG + Exonic
1017310076 6:152966287-152966309 GAGAGGCGTGGGTGGGGACCGGG - Intergenic
1017818335 6:158030971-158030993 GGCAGGTCTGGGCTGGGCCCAGG + Intronic
1018368818 6:163149275-163149297 GAGAGGCCTGGGGAGGGCCGGGG - Intronic
1018813709 6:167316316-167316338 GGGAGGGCTGGGGAGGGCCTGGG - Intergenic
1019329160 7:454243-454265 GACAGGTCTGGGGAGACCCCTGG + Intergenic
1019350121 7:550617-550639 GAGAGGTCAGGGCTGGGCCTGGG + Intronic
1019610334 7:1933494-1933516 GAGAGGGCTGGCAAGGTCCCTGG - Intronic
1019695889 7:2446016-2446038 GAGAGGTCTGGGCAAAGCCAGGG - Intergenic
1020135061 7:5582866-5582888 AAGGGGTCTGGGAATGGCCCAGG + Intergenic
1022248784 7:28586334-28586356 CAGAGCTCTGGGAGGGGCCCAGG + Intronic
1022787954 7:33657869-33657891 GAGAGCTCAGGGGAAGGCCCAGG + Intergenic
1023202229 7:37711255-37711277 AACAGGTCTGGGTGGGGCCCTGG + Intronic
1023819946 7:43975065-43975087 GAGGGGTCGAGGCAGGGCCCTGG + Intergenic
1023870179 7:44259042-44259064 GATCGGGCTGGGTAGGGCCCGGG + Intronic
1023874884 7:44281566-44281588 GAGAGGCCTGGCCAGGGTCCTGG - Intronic
1024582386 7:50810418-50810440 TGCAGGTCTGGGTAGGGCCCAGG - Intergenic
1026850383 7:73719761-73719783 GCGGGGTCTGGGCGGGGCCCGGG - Intergenic
1026854206 7:73742559-73742581 GAGAGGGCTGGGCAGCCCCCAGG - Intergenic
1028790381 7:94847277-94847299 TAGAGGTCTTGGAAGTGCCCTGG + Intergenic
1028883286 7:95904237-95904259 CTGAGGTCTGGCTAGGGTCCAGG - Intronic
1029748221 7:102528518-102528540 GAGGGGTCGAGGCAGGGCCCTGG + Intergenic
1029766168 7:102627605-102627627 GAGGGGTCGAGGCAGGGCCCTGG + Intronic
1030124189 7:106139022-106139044 GAGATTTCTGGGTGGGTCCCAGG - Intergenic
1032548051 7:132759718-132759740 GAGAGGGCTGGGGAGGGGCTGGG + Intergenic
1033267896 7:139901844-139901866 AGCAGGCCTGGGTAGGGCCCAGG - Intronic
1035296401 7:157869229-157869251 GGGAGGTCTGGGTAGGGCCTTGG + Intronic
1035623801 8:1056036-1056058 GAGAGGGCTTGGTAGCTCCCAGG + Intergenic
1035790153 8:2297093-2297115 GAAAGGGCTGGGAAGGCCCCCGG + Intergenic
1035802652 8:2424612-2424634 GAAAGGGCTGGGAAGGCCCCCGG - Intergenic
1037936459 8:22918126-22918148 GAAAGGTCCGAGTAGTGCCCAGG + Intronic
1039256716 8:35726784-35726806 GAAAGGTTTGGGTAGTCCCCAGG + Intronic
1040600395 8:48878269-48878291 GAACGGGCTGGGTAGGACCCTGG + Intergenic
1041015342 8:53587625-53587647 GAAAGGTCTGGGTGGGTCCTGGG - Intergenic
1046965659 8:120162822-120162844 GAGATGTCTGGGTAAGGTTCAGG - Intronic
1048817659 8:138348952-138348974 GAGAGTTGTGGCCAGGGCCCAGG + Intronic
1048878035 8:138852067-138852089 GGGAGGTCTGGGAAAGGACCTGG + Intronic
1049236632 8:141515424-141515446 GAGAGGGCAGGGCAGGGGCCAGG - Intronic
1049272171 8:141701579-141701601 GGGAGGTGTGGGCAGGGACCTGG - Intergenic
1049429291 8:142551741-142551763 GAGAAGTCTGAGAGGGGCCCTGG + Intergenic
1049685330 8:143937123-143937145 GAGGGGTCTGGGTGGGGCCCAGG + Intronic
1050832233 9:10028950-10028972 GAGATGGCAGGGTGGGGCCCAGG + Intronic
1055330117 9:75174872-75174894 GAGAGTGCTGGGTAGGGGCTGGG + Intergenic
1056382041 9:86064543-86064565 GAGAGGGCTGGGTGGGGAGCAGG - Intronic
1057342393 9:94214390-94214412 GGGAGGACTGGGTGGGGCCTCGG + Intergenic
1058562355 9:106243329-106243351 GAGATGTCTGGGTAGGAACCAGG + Intergenic
1059379876 9:113914721-113914743 GAGAGGGCTGGGTAGGGGAAGGG + Intronic
1059477030 9:114555454-114555476 GAGTAGCCTGGGTAGGGCCTGGG + Intergenic
1060242279 9:121914405-121914427 GGGAGGCCTGGGTTGGGCCAGGG + Intronic
1060263005 9:122092609-122092631 CAGAGGTCTCGGCACGGCCCAGG - Intronic
1060439900 9:123628510-123628532 GAGGGGTCTGGAATGGGCCCAGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061199682 9:129130193-129130215 TACAGGTCTGGGTAGGGACTGGG + Intronic
1061397981 9:130353836-130353858 GATGGGTCTGAGCAGGGCCCCGG + Intronic
1061707118 9:132461693-132461715 GCCAGGCCTGGGAAGGGCCCAGG - Intronic
1061761378 9:132854364-132854386 GAGAGGGCAGGGGAGGGCTCAGG - Intronic
1062244957 9:135561524-135561546 GAGGGGCCTGGGTCGGGTCCAGG - Intergenic
1062312746 9:135948055-135948077 GAGAGTTCTGTGCAAGGCCCAGG + Intronic
1062392579 9:136339841-136339863 GAGTGGGCTGGGCAGTGCCCGGG - Intronic
1062499787 9:136847444-136847466 AAGAAGTCGGGGTGGGGCCCTGG - Exonic
1062518818 9:136949352-136949374 GAGAGTGCTGTGTGGGGCCCCGG + Intronic
1062690345 9:137838178-137838200 GAGGGGGCTGAATAGGGCCCTGG + Intronic
1188542750 X:31267536-31267558 AATAGGTCTGGGCCGGGCCCAGG - Intronic
1189915390 X:45851245-45851267 GCGAGGGCTGGGTAGGTCCAGGG - Intergenic
1190004895 X:46726378-46726400 GAGAGGTCTGAATGGGGCCAAGG - Intronic
1190301037 X:49057743-49057765 CAGGGGTCTGGGTAGGGCTTGGG + Intronic
1190731894 X:53232127-53232149 GGGAGGACTGGAAAGGGCCCTGG + Intergenic
1190856206 X:54297277-54297299 CAAAAGTCTGGGTAGGGGCCGGG + Intronic
1193150394 X:78118628-78118650 CAGAGGTGTGGGTAGGGTTCAGG + Intronic
1193840821 X:86405836-86405858 CAGAGGTCTGGGGAGGCCTCAGG + Intronic
1196663694 X:118294663-118294685 GAGAGGTGTGGGTGGGAGCCAGG - Intergenic
1198935223 X:141896946-141896968 GAGAGATCTTGGGAGGACCCTGG - Exonic
1199437481 X:147828837-147828859 GAGAGGTGTGGGTGGGAGCCGGG - Intergenic
1202365177 Y:24156117-24156139 GAAAGGTGTGGGCAGAGCCCCGG + Intergenic
1202505604 Y:25514005-25514027 GAAAGGTGTGGGCAGAGCCCCGG - Intergenic