ID: 960096535

View in Genome Browser
Species Human (GRCh38)
Location 3:113695984-113696006
Sequence CAGGAAAAGGTGAAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 913
Summary {0: 2, 1: 0, 2: 7, 3: 80, 4: 824}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960096535 Original CRISPR CAGGAAAAGGTGAAGGAGGC GGG Intronic
900122227 1:1053687-1053709 CAGGACAGGGTGGGGGAGGCGGG - Intronic
900393871 1:2445170-2445192 CTGGAAAGGATGAGGGAGGCAGG + Intronic
900422110 1:2560151-2560173 GGGGAACAGGTGATGGAGGCAGG + Intronic
900516567 1:3085016-3085038 CAGGAAAAGGGGCTGGATGCTGG - Intronic
900786284 1:4652820-4652842 CATTAAGAGGCGAAGGAGGCAGG - Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
902237141 1:15064725-15064747 CCGGAAAATGTGGAGGAGTCTGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903230680 1:21920629-21920651 CAGGAATGTGTGAAGCAGGCAGG - Intronic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903610164 1:24605603-24605625 CAGGAAAATGAGGACGAGGCGGG + Exonic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904102703 1:28046305-28046327 CAGGAAAAGATGAAGGTGATGGG + Intronic
904389402 1:30171916-30171938 AAGGGAAAGGGGAAGAAGGCTGG + Intergenic
904625795 1:31801320-31801342 CAAGAAAAGAGGAAGGAGGTGGG - Intronic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
905192726 1:36248174-36248196 TATTAAAAGATGAAGGAGGCTGG - Intronic
905782377 1:40723502-40723524 GATGAACAGGTGAGGGAGGCAGG + Intronic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
905975258 1:42169565-42169587 ATGGCAAAGGTGTAGGAGGCTGG - Intergenic
906011192 1:42528160-42528182 CTAGAAAAGGTAGAGGAGGCCGG - Intronic
906040508 1:42785013-42785035 CAGGAAACGGGGCAGGAGGGCGG + Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906291720 1:44623736-44623758 CAAGATAAGGTCCAGGAGGCAGG + Intronic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907239386 1:53072648-53072670 AGGGAAAATGTCAAGGAGGCAGG - Intronic
907290048 1:53407798-53407820 CAGCAGAAGGTGAAGGGAGCAGG - Intergenic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907337025 1:53706515-53706537 CAGAAAATGCTGAAGGCGGCAGG - Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907418901 1:54333277-54333299 CAGGAATAGGCAGAGGAGGCGGG - Intronic
908241032 1:62189107-62189129 CAAGAAAAAATGAGGGAGGCCGG - Intergenic
910524723 1:88164767-88164789 AAGGCAAAGGGGAAGCAGGCGGG - Intergenic
911195119 1:94986795-94986817 GAGGAAAAGGTGATGGATGTGGG - Intronic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912201646 1:107464752-107464774 CATAAAAAGGTGCAGGAGGGTGG - Intronic
913245233 1:116864936-116864958 GAGGAAGATGCGAAGGAGGCTGG - Intergenic
913428869 1:118766774-118766796 AAGGAAAAGGTGGAGGAGCAGGG - Intergenic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914170205 1:145215893-145215915 GAGGAAGAGGTGGAGGAGGAGGG + Intergenic
914320559 1:146555431-146555453 CAGGAAAAAGGAAAGGAAGCAGG + Intergenic
914422374 1:147541320-147541342 GAGGAAAAGGTGGAGGGGGGAGG + Intergenic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914937565 1:151993922-151993944 CAGGAAGAGGGGGAGGAGACAGG - Exonic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915301624 1:154954913-154954935 CAGGAAAAGGGAAGTGAGGCTGG + Intronic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916374681 1:164139452-164139474 AAGGAAAAGGGGCAGGTGGCTGG + Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916598925 1:166273444-166273466 CAGGAGAAGGTGAGAGAAGCAGG - Intergenic
916646583 1:166792599-166792621 CAGGAAAATGGGATGGAGCCAGG + Intergenic
917279515 1:173367821-173367843 CAGGTGTAGGTCAAGGAGGCAGG - Intergenic
917454446 1:175174050-175174072 CAGGACTGGGTGAAGCAGGCAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918187413 1:182140729-182140751 TAGGAACAGGTGAAGGAGCTGGG - Intergenic
918239539 1:182609582-182609604 CAGGGAGAGGTGGAGGAAGCTGG - Intergenic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
918892682 1:190295571-190295593 CAGGTAGTGGTGAAGCAGGCTGG + Intronic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920100520 1:203514316-203514338 CAGGAGTAGGTAAAGGAAGCGGG - Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920307951 1:205031054-205031076 CAGGAAAGGGGGAAGGAGAGAGG + Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920430764 1:205917421-205917443 CAGGAAAAGGGACAGGTGGCCGG + Intronic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
920786202 1:209043967-209043989 GAGGAAAAGGTAAAGCAGGGAGG - Intergenic
920818815 1:209361068-209361090 CAGGAAAAGTTAATGGAAGCGGG + Intergenic
921704566 1:218307480-218307502 GATGAAAAGGTTAAGGAAGCTGG + Exonic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922956885 1:229610449-229610471 CAGGATAAGGTGAATGAGAGAGG + Intronic
923254969 1:232213953-232213975 GTGGAAAAAGTGAAGGAAGCAGG - Intergenic
924178550 1:241418266-241418288 CAGGAAATTGTGCAGGAGACTGG + Intergenic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063503796 10:6579093-6579115 AAAGAAAAGGTCAAAGAGGCCGG + Intronic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1063768710 10:9172904-9172926 TAGGAAAAGGTGACGGAGGTGGG - Intergenic
1064056909 10:12105716-12105738 GAGGAAAAGATAAAAGAGGCTGG - Intronic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065421317 10:25547470-25547492 CAGGCAAAGATGAAAGAGGGAGG - Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065861914 10:29879037-29879059 CAGCAAAAGGTCCAGGAGCCAGG + Intergenic
1066664781 10:37771968-37771990 GATTAAAAGGTAAAGGAGGCCGG + Intergenic
1067019127 10:42780047-42780069 CAGGAAAAGGTGGTGGGGGGAGG + Intergenic
1067410004 10:46055821-46055843 CAGGACAATGTGAAGCAGGCAGG + Intergenic
1069240298 10:66130016-66130038 CTGGCAGAGGTGAAGCAGGCAGG - Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1071030277 10:81171736-81171758 CTGGAAAAGGTGAAAAAGGAAGG + Intergenic
1071479427 10:86053744-86053766 CAGGGAAAGGGGAAAGATGCAGG + Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072450240 10:95533898-95533920 CAGGAAATGGCAAAGGAAGCTGG + Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1073325433 10:102642242-102642264 CAGGGAAAGGGGGAGGAGCCGGG + Intergenic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073581526 10:104671199-104671221 CAGGAACAAGTCAAGGAAGCTGG - Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074273332 10:111976547-111976569 TGGGAACAGGTAAAGGAGGCTGG + Intergenic
1074429596 10:113382607-113382629 AAGGAGAAGGTGGAGGAGGTAGG - Intergenic
1074706272 10:116134985-116135007 AAGGAAAAGGTGGAGGAGGTTGG - Intronic
1074975569 10:118578548-118578570 CAGGAAGAGGCAATGGAGGCTGG + Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075234206 10:120711831-120711853 TAGGAAAAGATGCAGGAGGCTGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075708417 10:124517106-124517128 CAAAAAAAGATGAAGGAGCCCGG + Intronic
1075781060 10:125017497-125017519 TAGGAAAAGGTGAGGGAGGGTGG - Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076180609 10:128404604-128404626 AAGGAGAAGGTGGAGGAGTCAGG + Intergenic
1076342758 10:129760815-129760837 CAGGAAGAGATGGAGGAGGTGGG - Intronic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076858287 10:133127971-133127993 CAGGAAGAGGTGAAGTGGGGTGG - Intronic
1077028326 11:451557-451579 CAGGAAAACGTGTGGGAGACAGG + Intronic
1077283471 11:1755825-1755847 GAGGCAAAGGCGGAGGAGGCTGG - Intronic
1077344343 11:2039463-2039485 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078333995 11:10450112-10450134 CAGGAAGAGGTGAGCGAGGGAGG + Intronic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1080926559 11:36763259-36763281 GAAGAAAAGGTGAGGGAGGGGGG + Intergenic
1081567071 11:44266564-44266586 CAGGGAGAAGTAAAGGAGGCAGG + Intronic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081743228 11:45455445-45455467 TAAGAAGAGGTGAAGGTGGCAGG - Intergenic
1082006591 11:47422727-47422749 CAGGAAAAGGTGGTAGAGTCAGG + Intronic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083824345 11:65189966-65189988 CAGGCACAGGTGCAGAAGGCTGG - Intronic
1083971509 11:66079411-66079433 CAGGAAAAGGTTAGTGAGGAGGG - Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1085514082 11:77102385-77102407 CAGGAGCAGGTGGAGAAGGCAGG - Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1085929271 11:81061659-81061681 CAGGAAAAGGGTCTGGAGGCAGG + Intergenic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087009020 11:93496168-93496190 GAAGAAAAGGGGAAGCAGGCAGG + Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087474527 11:98619715-98619737 CAGGAAAAGGTGAAAAAGGTTGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088818268 11:113435805-113435827 AAAGTAAAGGTCAAGGAGGCTGG - Intronic
1088924418 11:114285794-114285816 CAGGAAGAGGTGAAGGGAGCAGG + Intronic
1088960933 11:114663535-114663557 CAGGAGATGGTGAAGGGGCCTGG - Intergenic
1089148224 11:116345892-116345914 CAAGAAAAGGGACAGGAGGCAGG - Intergenic
1089170535 11:116508406-116508428 CAGGTAAAGATGAAGGAGAAAGG - Intergenic
1089268185 11:117282049-117282071 CAGGAAGGGGTGAGGAAGGCTGG - Exonic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1202827329 11_KI270721v1_random:94652-94674 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092076617 12:5678721-5678743 CAGGAGAAGGTGAAAGAGAGTGG - Intronic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1093169238 12:15840844-15840866 TAGGAAAAAATGAAAGAGGCTGG - Intronic
1093264551 12:16987355-16987377 CAGGAAAAGCTGATGGAGACAGG - Intergenic
1094044680 12:26154480-26154502 GAGGAATTGGTGAAGGAGGCAGG - Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1095952255 12:47787996-47788018 CAGGAGGAGGTCAATGAGGCTGG + Intronic
1095982641 12:47981842-47981864 CAGGTAGAGGTGAGGGAGGCAGG + Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096529608 12:52234457-52234479 AAGGAGAACGTGAGGGAGGCGGG - Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096758015 12:53816262-53816284 CATGAAAAGGAGAGGGAGGTAGG - Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1098086201 12:66846874-66846896 TAGGAAAGGATGAGGGAGGCAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1099069340 12:78025773-78025795 CAAGAAAAAGTGAAGGTGCCAGG - Intronic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1100217434 12:92466813-92466835 CATGAAATGGTGAAAGAGTCAGG - Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101358332 12:104002253-104002275 CATGAAAAGGTGTTGTAGGCTGG - Intronic
1101735339 12:107458972-107458994 GGGGAGTAGGTGAAGGAGGCAGG - Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102780854 12:115563329-115563351 CAGGAAAAGGATGAGGTGGCGGG - Intergenic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103172309 12:118832232-118832254 CAGGAAAGTGTGTGGGAGGCAGG - Intergenic
1103326890 12:120127650-120127672 CAGGAAAAGGTGAGAGATGGAGG + Exonic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104448035 12:128848602-128848624 GCGAAAAAGGTGGAGGAGGCTGG + Intergenic
1104904988 12:132208319-132208341 GAAGATCAGGTGAAGGAGGCCGG + Intronic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105779724 13:23695779-23695801 CAGGAGAAGGTGCTGGCGGCAGG - Intergenic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106139778 13:27002476-27002498 CAGGAGAGGGTGAATGTGGCTGG - Intergenic
1107662962 13:42658443-42658465 CAGGAAGATGTGCAGGTGGCTGG - Intergenic
1108168742 13:47719573-47719595 CAGGAAAAGGTGTACAAAGCAGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108343652 13:49522644-49522666 CAGGAGGAGGTGAAGGTTGCTGG - Intronic
1108581062 13:51828492-51828514 CAGGAAATGTTGATGGGGGCAGG + Intergenic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1109149200 13:58823628-58823650 CAGTTAGAGGTGAAGCAGGCTGG - Intergenic
1109245034 13:59943913-59943935 AGGGAAAAGATGATGGAGGCTGG + Intronic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109642584 13:65209770-65209792 AAGGCAAAGGGGAAGTAGGCTGG + Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1110216486 13:73030003-73030025 AAGGAAAAGGTGCAGCAAGCCGG + Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1112198934 13:97256510-97256532 CTGGAAAAAGTGAAGCAGACAGG + Intronic
1113249689 13:108438232-108438254 TAGGAAGAGCTGAAGGAAGCAGG - Intergenic
1113673971 13:112195793-112195815 AAGGAAGAGGGGAAGGAGGGGGG - Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115469945 14:33758161-33758183 CTGGAGGAGGTGAAGCAGGCTGG - Intronic
1116954549 14:50910771-50910793 CAGGAAAAGTGGAAGGAAGGAGG - Intronic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118049702 14:62013628-62013650 CAGGTAAAGTTGAAGGAGGTGGG - Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119730571 14:76948486-76948508 AAGGAAAAGGTGGAGGAGGGTGG - Intergenic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120202377 14:81552237-81552259 CAAGAATAGGTGAAGCTGGCTGG + Intergenic
1120385420 14:83839506-83839528 CAGGAAAATGTGAATAATGCCGG - Intergenic
1120678003 14:87444088-87444110 CATGAAAAGCTGAAGCAGACTGG + Intergenic
1120846049 14:89126008-89126030 AAGGAAAAGGACAAGGATGCAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121449129 14:93996582-93996604 CCAGAGAGGGTGAAGGAGGCAGG - Intergenic
1121451069 14:94008728-94008750 CAGGAAATGTCCAAGGAGGCGGG + Intergenic
1121624613 14:95374973-95374995 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624644 14:95375076-95375098 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624673 14:95375190-95375212 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624683 14:95375225-95375247 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624699 14:95375280-95375302 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624711 14:95375315-95375337 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122383306 14:101325935-101325957 TGGCAAAAGGTGAAGAAGGCTGG - Intergenic
1122959154 14:105086763-105086785 CAGGATAAGGTGAGGGTGTCAGG + Intergenic
1123108891 14:105856094-105856116 CAGGAGAAAGTGATGGAGTCGGG + Intergenic
1123151499 14:106185971-106185993 CCAGAGCAGGTGAAGGAGGCTGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123213659 14:106785415-106785437 AATGCAAAAGTGAAGGAGGCTGG - Intergenic
1123997133 15:25726753-25726775 TAGAAAACGGTGAGGGAGGCCGG + Intronic
1124336793 15:28863200-28863222 CAAGAGAAGGTGGTGGAGGCTGG - Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125251294 15:37707931-37707953 CATGAAAAGGGGAAGGAAGGAGG - Intergenic
1125483190 15:40094354-40094376 CAGGCCTAGGTGCAGGAGGCAGG + Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1128788850 15:70417968-70417990 GATGAAGAGGTGAAGGAGGAGGG - Intergenic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129876984 15:78982048-78982070 CAGGGATAGGTGACAGAGGCTGG - Intronic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1130363392 15:83210384-83210406 CAAGAAAGGATGAAGGAGCCAGG + Intergenic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130882174 15:88064811-88064833 TGGGTAAGGGTGAAGGAGGCAGG - Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1132753145 16:1468228-1468250 CAGGCCAAGGTGAAGGCTGCCGG + Intronic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133656722 16:7872090-7872112 AAGGAAAAAGGGAAGGAGGGAGG - Intergenic
1134037707 16:11043993-11044015 AAGGAAGGTGTGAAGGAGGCAGG - Intronic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134693069 16:16203732-16203754 GAGGAACAGGTGAGGGAGCCAGG - Intronic
1134978778 16:18590963-18590985 GAGGAACAGGTGAGGGAGCCAGG + Intergenic
1135066258 16:19312737-19312759 CAGGAAGAGGTGAATGACCCTGG - Intronic
1135130738 16:19851856-19851878 GAGGAAAAGGGGAGGGAAGCAGG - Intronic
1135175075 16:20220876-20220898 CAGGACAGGGTTATGGAGGCAGG + Intergenic
1135660433 16:24291924-24291946 AAGGAAAGGGTTAAGGAGGATGG + Intronic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1135942134 16:26831057-26831079 CAGCAAGAAGTGCAGGAGGCAGG + Intergenic
1136052516 16:27662228-27662250 CAGGAAATTGTGAATTAGGCTGG - Intronic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136474881 16:30506678-30506700 CAGGGAAAGATGGAGGAGGGAGG - Intronic
1136480046 16:30535438-30535460 CAGGAAGACGTGAAGCAGGAAGG + Intronic
1136520895 16:30795093-30795115 CAGGGAGAAGTGAAGGGGGCTGG - Intergenic
1136630106 16:31484997-31485019 CAGGAAAGGGGGAATGAGACTGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137698178 16:50476728-50476750 TAGGAAAAGGTGGAGAAGCCAGG + Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138447645 16:57074596-57074618 CAGCAGAAGGTGACTGAGGCTGG - Exonic
1138643110 16:58401682-58401704 CAATAAAAGGTGAAGCCGGCTGG - Intronic
1139278526 16:65750024-65750046 GAGGAAGAAGTGAAGGAGGGAGG + Intergenic
1140012974 16:71154675-71154697 CAGGAAAAAGGAAAGGAAGCAGG - Intronic
1140612519 16:76618467-76618489 CAAGAACAGGTGTAAGAGGCTGG + Intronic
1141583981 16:85020731-85020753 TAGCAACAGGTGAAGGACGCTGG + Intergenic
1141775767 16:86121772-86121794 TAGGAGGAGGTGAAGGAGGCAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142228696 16:88889381-88889403 CAGGAAAAAGCAGAGGAGGCAGG + Intronic
1142322508 16:89393202-89393224 TGGGAACAGGTGAATGAGGCTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142883184 17:2896732-2896754 TAGGAAAAAGGGCAGGAGGCGGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1144257887 17:13487635-13487657 CAGGGAATGGTGCAGGAGACAGG + Intergenic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1144438102 17:15259243-15259265 AAGGAAAAGGGGAAGGAGAAAGG + Intronic
1144826900 17:18110214-18110236 CAGGATGAGGTGAAACAGGCTGG - Intronic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145208456 17:20996726-20996748 GAGGAAGAGGTGCAGGAGGAAGG - Intergenic
1146177378 17:30674647-30674669 GAGGAAGAAGTGCAGGAGGCCGG + Intergenic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1146587274 17:34093219-34093241 CTAGAAAAGGTGAAGGAGTTAGG - Intronic
1146912697 17:36658504-36658526 CTGGAAGGGGTGGAGGAGGCTGG + Intergenic
1147121787 17:38339359-38339381 TGGGAAAAGGGGAGGGAGGCAGG + Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147353244 17:39868462-39868484 CAGGGCGAGGCGAAGGAGGCAGG - Intronic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148134919 17:45286065-45286087 GAGGAAAAAGGGAAGGAGGTGGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1149639993 17:58196496-58196518 CAGGAAAGGTTGCAGGAAGCTGG - Intronic
1150226692 17:63528298-63528320 CAGGAGTGGGTGAAGCAGGCAGG + Intronic
1150309839 17:64119064-64119086 CAGGATACTGTGAAGGAGCCTGG + Intronic
1150628544 17:66859431-66859453 CAGTAAAATGTGCTGGAGGCAGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1151811762 17:76447777-76447799 AAGCAAAAGGTGCACGAGGCGGG - Intronic
1152219506 17:79054866-79054888 AAGGCAAAGGGGAAGCAGGCTGG - Intergenic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152556354 17:81055075-81055097 CAGGAAGCGGTGGAGGAGCCGGG - Intronic
1152795972 17:82306522-82306544 CAAGAAAATGAGAACGAGGCCGG - Intergenic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154139612 18:11811319-11811341 GAGGACATGGTGAAAGAGGCTGG - Intronic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156748455 18:40421006-40421028 CAGGAACAGAGGCAGGAGGCTGG - Intergenic
1157112279 18:44832647-44832669 CAGGAAGAGATGAGGAAGGCTGG - Intronic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160910854 19:1473243-1473265 GAGGAAGAGGTGATGGCGGCAGG - Exonic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161186135 19:2922096-2922118 CAGGAGATGGTGAGGGAAGCAGG - Intergenic
1162337448 19:10070713-10070735 CTGGAAAAGGTGAGAGGGGCCGG + Intergenic
1162367209 19:10256830-10256852 CAGGACAGGGTGGAGGGGGCGGG + Intronic
1162497410 19:11030979-11031001 CAAGACAATGTGGAGGAGGCTGG - Intronic
1162510728 19:11116630-11116652 CAGAAAAACTTCAAGGAGGCTGG - Intronic
1162527819 19:11216876-11216898 CAGGAGATGATGGAGGAGGCAGG - Intronic
1162669723 19:12245882-12245904 CAGGAAAACAGGCAGGAGGCCGG - Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1162981116 19:14240616-14240638 AAGGAAGAAGTGCAGGAGGCCGG - Intergenic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163331856 19:16644084-16644106 CAGGAAAAGGTTTACCAGGCTGG + Intronic
1163698601 19:18776107-18776129 CGGGTAAAGGTGAAGCAGCCGGG + Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164438786 19:28255606-28255628 CAGCCAAAGGTGTAGGAGACAGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1164973023 19:32548755-32548777 AAGAAAAAGGTGAATGTGGCCGG + Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165610712 19:37149820-37149842 GAGGAAAAGGTCTATGAGGCTGG + Exonic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167492181 19:49799261-49799283 CAGGAGAAGGTGGAGGACTCGGG - Intronic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167674896 19:50877889-50877911 CAGGAGACTGTGAGGGAGGCTGG - Intronic
1167861030 19:52284300-52284322 CATGAATAGGTCAAGGAGGCAGG - Intronic
1167869391 19:52355255-52355277 CATGAATAGGTCAAGGGGGCAGG - Intronic
1167873689 19:52394133-52394155 AAGAAAAAGGTCAAAGAGGCCGG - Intergenic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168462430 19:56570321-56570343 CAGGAAGAGGTAGAGGTGGCAGG + Exonic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
924965735 2:74849-74871 CAGGACAAATTGAAGCAGGCAGG - Intergenic
925023303 2:588318-588340 CAGCAGAAGGTGGAGGGGGCGGG + Intergenic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925828313 2:7872553-7872575 CAGGAAAAGGGGTAGAAGGGAGG - Intergenic
926083331 2:10006247-10006269 CAGTAAGAGGTGAAGCGGGCTGG - Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927123361 2:19989892-19989914 CAGGACCGGGTGAAGGAGCCTGG + Intronic
927676242 2:25108208-25108230 CAGGAGAAGGTGGGGGAGTCAGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928833016 2:35511651-35511673 CTGGTGAAGGTTAAGGAGGCAGG - Intergenic
929365285 2:41147130-41147152 GTGGAAAAGATGAAGAAGGCAGG + Intergenic
929426392 2:41848890-41848912 AATGAAAAGTGGAAGGAGGCTGG + Intergenic
930589336 2:53308746-53308768 CAAGAAAAGGGGATGGAGGTGGG - Intergenic
930639189 2:53838027-53838049 CAAGAAAAGGTGAAGGTGTAAGG + Intergenic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
931169832 2:59790974-59790996 AAGGGAAAGGCGAGGGAGGCTGG + Intergenic
931928397 2:67100294-67100316 AAGGCAAAGGGGAAGCAGGCAGG + Intergenic
932411097 2:71548377-71548399 CAGGTAAAGGTGAACAAGGAAGG + Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933794258 2:85907097-85907119 CTGGAAAGGGTGATAGAGGCAGG - Intergenic
933978589 2:87531714-87531736 GAGGAAGAGGAGAAGGAAGCAGG + Intergenic
934534039 2:95118176-95118198 CAGGAAAAGGTACAGCTGGCAGG - Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
935591052 2:104845467-104845489 CAGGGAGCGGTGAAGGAGACTGG - Intergenic
936054806 2:109254487-109254509 GAGGCAAAGCTGAACGAGGCTGG - Intronic
936315243 2:111419088-111419110 GAGGAAGAGGAGAAGGAAGCAGG - Intergenic
936629504 2:114186519-114186541 CAGGAAAAGGAGAGAGAAGCAGG - Intergenic
937217088 2:120319601-120319623 CAGCACAAGGTGAAGCTGGCTGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937377231 2:121345710-121345732 CTGGAAGAGGTGTATGAGGCAGG - Intronic
937729444 2:125209932-125209954 CAAGATAAAGTAAAGGAGGCTGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938261769 2:129901945-129901967 TAGGAAGAGGTGTAGGAGGAGGG - Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939480855 2:142745330-142745352 CAGGATAATGTGACAGAGGCTGG - Intergenic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
939590889 2:144062225-144062247 GATGAACAGGTGCAGGAGGCGGG - Intronic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940804263 2:158168324-158168346 AAGCAAGAGGTGAAGCAGGCTGG + Intergenic
940922785 2:159328266-159328288 CAAGAAAAGGTGATGGGGGTTGG - Intronic
940961312 2:159789296-159789318 CATGAAAAACTGAAGTAGGCTGG - Intronic
941696114 2:168552652-168552674 CAGGAACAGGTGAGCCAGGCTGG + Intronic
942432298 2:175925404-175925426 GAGGAAAAGCTCAAGAAGGCTGG + Exonic
943334750 2:186600143-186600165 CAAGATAAGGTCAAGGAGCCTGG - Intronic
943786454 2:191883032-191883054 TGGGCAAAGGTGAAGGAGGCAGG - Intergenic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945009392 2:205445458-205445480 AAGGCAAAGGGGAAGCAGGCAGG + Intronic
945304317 2:208244245-208244267 CAGGAACAGGTGTTGGAGCCAGG + Intronic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
946068979 2:217014888-217014910 CATGAGAAGCTAAAGGAGGCTGG + Intergenic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946679590 2:222199366-222199388 CAGGAAGAAGGGAAGGAGGGAGG + Intergenic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947139435 2:227007972-227007994 TAGGAAATGGTGAATGAGCCAGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947308808 2:228777825-228777847 CAGAAAAAGTTGAATGAGGGAGG + Intergenic
947451196 2:230210781-230210803 TAGGAATAGGTGACTGAGGCAGG + Intronic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948000209 2:234561255-234561277 CAGGAAAAGGTGATGCCTGCAGG + Intergenic
948169545 2:235890008-235890030 GGGGAAGAGCTGAAGGAGGCTGG - Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948593688 2:239066511-239066533 CTGGAAGAGGTGCAGGGGGCAGG - Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169982049 20:11395574-11395596 CTTGAATAAGTGAAGGAGGCAGG + Intergenic
1170040838 20:12037477-12037499 AAAGGAAAGGTGGAGGAGGCAGG - Intergenic
1170266585 20:14472789-14472811 CATGAAATGATGAAGGAGCCTGG + Intronic
1170944107 20:20874625-20874647 CAGGTAAAGGTGAAGGGAGGAGG + Intergenic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171282622 20:23913892-23913914 CAGGAATTGGTGTAGGGGGCGGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171308174 20:24123780-24123802 CTGGAAATGGTAAAGGTGGCAGG + Intergenic
1172147120 20:32764481-32764503 CAGGAAAAGGAGAGGCTGGCAGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172948559 20:38706891-38706913 CAGGGAAAGGTGAGGGAGAAGGG - Intergenic
1172952026 20:38728479-38728501 CAGGCGCAGGTGAAAGAGGCTGG - Exonic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173648754 20:44650167-44650189 CAGTAAGACGTGAAGGAGGCAGG + Intronic
1173738400 20:45378069-45378091 AAGGAAAAGGTGAAGGGTGAAGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174563574 20:51448343-51448365 AAAGAAATGGTGGAGGAGGCCGG + Intronic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1175385423 20:58591893-58591915 CATGACAATGTGAGGGAGGCAGG + Intergenic
1175392440 20:58635880-58635902 AAGGAAGAAGTAAAGGAGGCAGG + Intergenic
1175768701 20:61609023-61609045 CAGGAAAAGATGGAGGAGCTGGG - Intronic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1177159296 21:17530259-17530281 GAAAAAAGGGTGAAGGAGGCCGG - Intronic
1177393668 21:20507469-20507491 CATGTAAAAGGGAAGGAGGCAGG + Intergenic
1177831967 21:26149071-26149093 CAGGAGAGGGTGAAAGAAGCTGG + Intronic
1178038747 21:28615316-28615338 GGGGAAAAGGGGAAGGAGGGAGG - Intergenic
1178045382 21:28687788-28687810 CAGGAAAAGCTTAAGGATGGAGG + Intergenic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179367206 21:40769542-40769564 CAGGGATGGTTGAAGGAGGCTGG - Intronic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1179928355 21:44550713-44550735 GAGGAAAAGCTGCAGGAGGCTGG + Exonic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1180854228 22:19036223-19036245 CAGGCTAAGGTGGAAGAGGCTGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1180883117 22:19220712-19220734 CAGGAAAAGCCCAAGCAGGCTGG + Intronic
1181130441 22:20728463-20728485 TAGGAAAAGGAGTAAGAGGCAGG - Intronic
1181752313 22:24997340-24997362 CAGGAAAAAGAGAAGGCGACTGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182140070 22:27946708-27946730 CAAGAAATGTTAAAGGAGGCTGG - Intergenic
1182160203 22:28114020-28114042 CTGGAAAAGGATATGGAGGCTGG - Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182748851 22:32626026-32626048 CAGGAAAAGCTTAAGGAAGGAGG + Intronic
1183061837 22:35340889-35340911 CAGGGCAAGGTGGAGGACGCTGG + Intronic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1183887552 22:40897322-40897344 GATGAAAAGATGAAGGAGGCCGG - Intronic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184394691 22:44226212-44226234 CAGGAGAAAGTGAAGGGGGGTGG - Intergenic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949677014 3:6467180-6467202 AGGGAAAAAGTGAAGGAGGTAGG + Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
950219858 3:11186159-11186181 CAGGAAAAGGTGGAGTTGTCCGG - Intronic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950715587 3:14845551-14845573 TAGGAACAGGTGATGCAGGCAGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
951233750 3:20210874-20210896 CAAGGAAAAGTGAAGGAAGCAGG - Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951934057 3:28002115-28002137 AAGGAAAAGTTGAAGGAATCAGG - Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952591466 3:34960007-34960029 CTGGTAAAGGTGATGTAGGCAGG + Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953121275 3:40045119-40045141 AAGGAAAAGGTGTGGGAGGCAGG - Intronic
953393212 3:42545750-42545772 CATGACAAGGTTAAGAAGGCTGG - Intergenic
953559642 3:43976691-43976713 CAGAAAAAGGTGGGGCAGGCCGG - Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
953855558 3:46497133-46497155 AAGGAAAAAGGAAAGGAGGCTGG - Intergenic
954196558 3:49000580-49000602 CAGGAACAAGGGAAGGAAGCAGG + Intronic
954421663 3:50422112-50422134 CAGGATAAGGTGAGGCAGCCAGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
956190261 3:66601323-66601345 TAGGAAAAGCTGAAGAGGGCAGG - Intergenic
957181571 3:76885835-76885857 GAGGAAAACATGAAGGAGGCAGG - Intronic
957271024 3:78030124-78030146 CAGTGAGAGGTGAAGCAGGCTGG + Intergenic
957321906 3:78642363-78642385 GCGGAAATGGTGAAGGAGGCTGG + Intronic
957851923 3:85819203-85819225 CAGGAAAAGGTGGAAGAAGCTGG - Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958091282 3:88879908-88879930 CAGGAAAATGTGGAGAAGCCTGG + Intergenic
959829323 3:110841606-110841628 CAGGAAGAGGTGGGGGAGGTAGG - Intergenic
960063861 3:113350101-113350123 CATGAAAAGGGGAAGGAGAGGGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961470447 3:127107941-127107963 CAGGAAAAGGCCCAGGAGCCAGG - Intergenic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
962106640 3:132396614-132396636 CAGTGAAAGGTGAAGCCGGCTGG + Intergenic
962453817 3:135546961-135546983 CAGGGAAAGGTGCAAGAGGAGGG - Intergenic
962462590 3:135628371-135628393 CAGGAAGTGGGGAAGGAGGAAGG - Intergenic
963066727 3:141270007-141270029 GAGGAAAGGGTCAAGGAGGGAGG + Intronic
963390008 3:144649303-144649325 AAGGAAAAGGTAAATGATGCTGG - Intergenic
963562356 3:146881839-146881861 CAGAAACAGTTGAAAGAGGCTGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
964589461 3:158343978-158344000 CAAAAAAAGATGAATGAGGCTGG + Intronic
964931297 3:162027843-162027865 CAGGGAAAGGTGAAGGTTGCAGG + Intergenic
965327813 3:167329520-167329542 CAGAAAAAGGTGCAAGAAGCAGG + Intronic
965505374 3:169509504-169509526 GAGGAAATGGGGGAGGAGGCAGG - Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965680595 3:171247478-171247500 CGGGAAAACATGAAGAAGGCAGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967277374 3:187789905-187789927 AAGGAAGAGGGGAAGGAGGGAGG + Intergenic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
969080699 4:4615787-4615809 CAAGAACAGATGATGGAGGCAGG + Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969649095 4:8452996-8453018 CCAGAAAAGGTGATGGAGCCGGG - Intronic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969895052 4:10295859-10295881 GAGGAAATGGTGATGGAGGTAGG + Intergenic
970137079 4:12936784-12936806 CAGGAAACTGTGAAAGAGCCCGG - Intergenic
970158487 4:13165547-13165569 CGGGAAGAAGTGAAGGAGGGAGG + Intergenic
970370468 4:15400869-15400891 CGGGAAATGGTGATGGTGGCTGG - Intronic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970750995 4:19360917-19360939 AAGGAAAATGGGAAGGAGACAGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970957103 4:21825859-21825881 CAGGAAAATGTGAGAGAGGATGG + Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971479047 4:27098317-27098339 AGAGAAAAGGGGAAGGAGGCAGG + Intergenic
971768075 4:30859958-30859980 CATGAAAATGTGACTGAGGCTGG + Intronic
972296909 4:37747902-37747924 AAGGCAAAGGGGAAGGAAGCAGG + Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
975290242 4:72670088-72670110 CAAGAGAAAGTGAAGAAGGCAGG + Intergenic
976081130 4:81356126-81356148 AAGGAAAGGGTGGAGGAGACAGG + Intergenic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
977228038 4:94416997-94417019 CAGGAATAAGTTAAGGAGACAGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979833458 4:125330352-125330374 TAGAAATTGGTGAAGGAGGCTGG - Intronic
980515016 4:133845368-133845390 AAGGAAAAGGTGAGGGAGAGGGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980908382 4:138971559-138971581 CTGGAAGAGGTGAAAGAGGCAGG + Intergenic
981027863 4:140094764-140094786 CAGGAAAGGAGGAAGGAAGCGGG - Intronic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981766000 4:148250922-148250944 AAGAAAAAGGTGATGGAGACTGG - Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
983072987 4:163291812-163291834 GAGGAAAAGGGGAAGGAGAAGGG + Intergenic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
983790569 4:171792771-171792793 CAGGAAGAGGTGAGGGAAGGAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985803466 5:2021463-2021485 CAGGAACAAGTGAAGGACCCTGG - Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986384858 5:7222706-7222728 CAGGAAAAGATAAAGGAAGTAGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986551525 5:8961359-8961381 AACCAAAAGGTGAAGGAGGAGGG - Intergenic
986598949 5:9452059-9452081 GTGGAAAAGGTGAAGGAAGTGGG - Intronic
986788759 5:11140250-11140272 CTGGACAGGTTGAAGGAGGCAGG - Intronic
987067501 5:14303817-14303839 TAGGAAAGGCTTAAGGAGGCAGG - Intronic
987769699 5:22284866-22284888 CAGGAAAAGGGAAAGAAGCCAGG + Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988400363 5:30753453-30753475 CAGGGAATGGTGAAGATGGCTGG - Intergenic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
990018956 5:51101678-51101700 CAGGAAGAGTTGAAGTCGGCCGG + Intergenic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
990979847 5:61592722-61592744 AAGAAAATGGTGAAGGATGCTGG + Intergenic
991370676 5:65916305-65916327 CAGGAACAGCTGCAGGAGTCAGG - Intergenic
992096770 5:73370087-73370109 CAGAAATATGTGAAGGAAGCTGG + Intergenic
992576287 5:78117028-78117050 CAGCAAGAGGTGAGAGAGGCAGG - Intronic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
992790211 5:80206768-80206790 TAGGAAAGGGTTCAGGAGGCAGG - Intronic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
994003978 5:94816027-94816049 CAAGAAAAGGTAAAGTAGGAAGG + Intronic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996311211 5:122107866-122107888 CAGCAAAATGTGGAGGAAGCAGG - Intergenic
996371350 5:122756188-122756210 TAGGAAAGGGTGAAGGATGAAGG + Intergenic
996992458 5:129651431-129651453 CAGGAGAAGTTAAAGGGGGCAGG - Intronic
997308804 5:132862282-132862304 CACTAAAGGTTGAAGGAGGCTGG + Exonic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997528264 5:134567180-134567202 AAGGAAGAGGTGAAAGGGGCTGG + Intronic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998093673 5:139384930-139384952 CTGGAACAGGTGAAGGATGGAGG + Intergenic
998548289 5:143050892-143050914 CAGGCAAAGGTGATGGTGGCTGG - Intronic
998650794 5:144119097-144119119 GAGGAAGGAGTGAAGGAGGCTGG + Intergenic
999019770 5:148152332-148152354 CAGGAAAATATGATGGAGGTGGG + Intergenic
999275292 5:150325898-150325920 AGGGAAAAGGTGAGTGAGGCAGG - Intronic
999279598 5:150356608-150356630 AGGGAAAAGGTGAGGTAGGCTGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999708835 5:154298261-154298283 CCTGAAAAGAGGAAGGAGGCTGG - Intronic
1000367086 5:160501748-160501770 CATCAAAAGGTGAAGTAGACAGG + Intergenic
1000599996 5:163261173-163261195 CAGGAAGAGGTGAAGGAGAAAGG + Intergenic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1001437903 5:171714917-171714939 GAGGAAAAGGGGAGGGATGCTGG - Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002294592 5:178223319-178223341 CAGGCAAATCTGCAGGAGGCAGG - Intronic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002847227 6:957670-957692 CAGGATAGGCTGAAGGGGGCAGG - Intergenic
1003250423 6:4424851-4424873 CAAGAAAAGGGAAAGAAGGCCGG + Intergenic
1003286597 6:4739655-4739677 CATAAAAAGGTGATTGAGGCCGG + Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004285760 6:14318980-14319002 CAGGGAAAAGTTAAGGAAGCTGG - Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1005047162 6:21653401-21653423 CAGGAAAAGGTGGAATAAGCTGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005396937 6:25392514-25392536 AAGGAAAAGCTGAAGGAAGTAGG - Intronic
1005419115 6:25630955-25630977 GAGGAAATGCTGGAGGAGGCTGG - Intergenic
1005446562 6:25930112-25930134 CAGGAAAAGGAGAACATGGCCGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005824105 6:29622168-29622190 GAGGAACGAGTGAAGGAGGCTGG - Exonic
1006114830 6:31769970-31769992 CAGGAAACGGGGAAGAAGGGAGG + Intronic
1006154751 6:32008061-32008083 CATGAAAATGTGGTGGAGGCTGG + Intergenic
1006304162 6:33208761-33208783 GAGGAGAAGGCGAAGAAGGCTGG - Exonic
1006527925 6:34624126-34624148 CCAGAATTGGTGAAGGAGGCTGG - Intronic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006713634 6:36098583-36098605 GAGGAAAATGTGAATGAGTCAGG - Intronic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007265102 6:40589821-40589843 CATGAAAAGGTGAAAGATGGTGG + Intergenic
1007302461 6:40877608-40877630 AAGGTGAAGGTGGAGGAGGCAGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007586341 6:42992353-42992375 CAAGAAAAGGGCAAGGGGGCCGG - Intronic
1007599957 6:43075569-43075591 CAGCAAGGGGTGTAGGAGGCGGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007879423 6:45146425-45146447 CAGGAAGAAGGGATGGAGGCGGG + Intronic
1008221808 6:48863405-48863427 GGGGAAATGGTGAAGGAGGTTGG - Intergenic
1008614591 6:53214081-53214103 CTGGTAAAGGTAAAGGAGACTGG + Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011329460 6:86187648-86187670 CAGGAAGATGTAAAGGATGCAGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012745627 6:103083518-103083540 CAGAAAAACTTAAAGGAGGCGGG - Intergenic
1012874545 6:104711153-104711175 CAGGCATATGTGAAGGAGGCAGG - Intergenic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015391596 6:132688539-132688561 TAGGAAAAGATTGAGGAGGCAGG + Intronic
1015545955 6:134361514-134361536 CAGGGTAAGGTGATGGAGACAGG - Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016594482 6:145784006-145784028 CAGGAAAAGGGTTAAGAGGCGGG - Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018304878 6:162444545-162444567 TAGGAAGAGGAGAAGGAGGGAGG - Intronic
1018690496 6:166340434-166340456 GAAGAAAAGGTGAAGCAGGAAGG - Intronic
1018814424 6:167320430-167320452 GAAGAAAAGGGGAAGGAGGAAGG - Intergenic
1019290302 7:247009-247031 AAGGAAAGAGGGAAGGAGGCAGG + Intronic
1019362091 7:610068-610090 CAGGAACAGGTGAAGGAGCGAGG - Intronic
1019510837 7:1416532-1416554 GAGGAAACTGTGCAGGAGGCAGG + Intergenic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020835082 7:13139113-13139135 CAGGAAAAGGTTAATGTGGTAGG - Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1022117514 7:27275324-27275346 CAGGAAAAGGTGGAGGAATGGGG - Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022256152 7:28660700-28660722 GAGGAAAAGGTGAAGGGGTGGGG - Intronic
1022765883 7:33410823-33410845 AAAGAAAAGTTGTAGGAGGCAGG - Intronic
1023049236 7:36236575-36236597 CAGTAAGAGGTGAAGCTGGCTGG + Intronic
1023867931 7:44247599-44247621 CAGGGAAGGGTCAAGGCGGCTGG + Intronic
1024403982 7:48956309-48956331 CAGGAAAAAGTGAAGTAGACTGG + Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1025045552 7:55689274-55689296 CCGGAGAGGGTGAAGCAGGCAGG - Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026329017 7:69336063-69336085 CAAGAACAGGTGAAGTAGGATGG - Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1026865048 7:73818509-73818531 AAGGAAAAAGGGAGGGAGGCAGG - Intronic
1027171765 7:75877952-75877974 GAAGAAAAGGGGCAGGAGGCTGG - Intronic
1027610967 7:80360127-80360149 GAGGAAAAGCTGAAGGATGCTGG - Intergenic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028792297 7:94866724-94866746 AAGGCAAAGGGGAAGCAGGCAGG - Intergenic
1029306475 7:99623583-99623605 CAGGAAAAGGGAAATGATGCTGG - Intronic
1029372009 7:100156315-100156337 AAGGAAAAAGTCAGGGAGGCAGG - Intronic
1029897456 7:103999174-103999196 CAGGAAAAAATGAAGGAGCATGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1031116147 7:117670866-117670888 AAGGAAAAAGTGACTGAGGCAGG - Intronic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1031627759 7:124009860-124009882 TAGGAAAAGGTAATGGCGGCCGG + Intergenic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1033007174 7:137578748-137578770 CAGGAAAAGGTGGAAGAAGGTGG + Intronic
1033553247 7:142466457-142466479 CATTAAAAGGTGATGGAGGCTGG + Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035031118 7:155861343-155861365 CACGAAATGGGGAGGGAGGCAGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035323770 7:158051625-158051647 GGGGAAAAGATGAAGGTGGCGGG - Intronic
1036719100 8:11156152-11156174 CAGTAAAAGGTGAAGAGGGAAGG - Intronic
1036933056 8:12974737-12974759 CATGAAAAGGGACAGGAGGCGGG + Intronic
1037683340 8:21117003-21117025 AAGGGAGTGGTGAAGGAGGCAGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037806430 8:22060150-22060172 CAGGAAGAGGGGAGGGAGGGAGG - Intronic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038013967 8:23497725-23497747 CCCCAAAAGGTGAAGGGGGCTGG + Intergenic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039432781 8:37538414-37538436 CAGGAAAAGGTAAGAGAGCCAGG + Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040683537 8:49842600-49842622 CATGAACAGGTGCAGGAGCCAGG - Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042905258 8:73766048-73766070 GAGGAAAAGGGGAGGGAGGGAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043284646 8:78514343-78514365 AAGGCAAAGGGGAAGCAGGCAGG - Intergenic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1046864809 8:119135724-119135746 CAGGAAAAGGTAAAGCATGGCGG + Intergenic
1047039822 8:120980588-120980610 TAGGAAGGGCTGAAGGAGGCAGG - Intergenic
1047070754 8:121340603-121340625 AACGAAAAGGTGGAGGAAGCAGG + Intergenic
1047091659 8:121582182-121582204 TAGGAAGAGGTGAGGGACGCAGG - Intergenic
1047780434 8:128106643-128106665 CAGGAAAGAGTTAAGGATGCAGG + Intergenic
1048452362 8:134544650-134544672 GAAGAAAAGGTGGAGGAGGGAGG + Intronic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049208929 8:141376440-141376462 CAGGAAGAGGTGAGGGAGCCTGG + Intergenic
1049208945 8:141376499-141376521 AGGGAAGAGGTGAGGGAGGCTGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049737654 8:144218381-144218403 CTGGAATAGGTGCAGGAGTCCGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050701749 9:8347524-8347546 GAGGCAAATGTGAAGGATGCTGG + Intronic
1050922882 9:11228471-11228493 CAGGAAAACTTGAAGCAGGGAGG + Intergenic
1052002437 9:23302142-23302164 GAGGAACAGGCGAAGGAGGAAGG + Intergenic
1052838820 9:33273454-33273476 CAGGAAAAGGATAATTAGGCAGG - Intronic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053474384 9:38371457-38371479 AAGGCAAAGGTGAAGGTGGTGGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1054922529 9:70556348-70556370 GAGTAAAAGGTGGGGGAGGCTGG - Intronic
1055153242 9:73028812-73028834 CATGAAAATGTAAAGGAGGGGGG - Intronic
1055252114 9:74320389-74320411 CACAAAAATGTGAATGAGGCTGG + Intergenic
1056616905 9:88176487-88176509 AAGGCAATGGTGAAAGAGGCAGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056740713 9:89252156-89252178 CAGCAAAGGGTGAAGGTTGCTGG + Intergenic
1056983026 9:91334390-91334412 GAACAAAAGGTGAAGGAGGAAGG + Intronic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1057289284 9:93790849-93790871 CAGGAAAAAGTGAAGAGGGGAGG + Intergenic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1059014820 9:110504415-110504437 GAAGAAAAGGAGAAGGAAGCAGG - Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060537000 9:124398244-124398266 AAGGAAAGGGTAAAGAAGGCAGG + Intronic
1060943632 9:127557467-127557489 CAGGAAGAGGGGAGGGAGGGCGG + Intronic
1061038218 9:128125203-128125225 CAGGAAAGGAGGAAGGATGCAGG + Intronic
1061374466 9:130215797-130215819 CAGGGAAAGGTGCAGAGGGCTGG + Intronic
1061512845 9:131071448-131071470 GAAGAAAAGGTGTATGAGGCTGG - Intronic
1061672959 9:132199394-132199416 CAGGAAAAGGTGCACAGGGCTGG + Intronic
1061865707 9:133490901-133490923 GAGGAAAAGGTGGAGGAGGGAGG + Intergenic
1061865726 9:133490965-133490987 GAGCAAAAGGTGGAGGAGGGAGG + Intergenic
1061905111 9:133692694-133692716 CGGGAGGAGGTGAAGGAGGCCGG - Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062272241 9:135714827-135714849 CGGGAAAAGTTGAAGGGCGCCGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062643216 9:137532819-137532841 CTGGAGAAGGTGAAGCAAGCAGG + Intronic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186319301 X:8406972-8406994 CAGGGAAATGTGAATGAGGTTGG + Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190040616 X:47068554-47068576 TAGGAAAACATGAAGGAAGCAGG - Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190935340 X:54994444-54994466 GAGGCAAAGGTGATGGAGGTAGG + Intronic
1191254250 X:58273001-58273023 CAGGAGTAGGTTCAGGAGGCCGG - Intergenic
1191254815 X:58275129-58275151 CAGGGAAAGGTTGAAGAGGCTGG - Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192106808 X:68325781-68325803 CGGGAAAAGGAGAAGGATACCGG - Intronic
1192479642 X:71473818-71473840 TGGGGAAAGGTGAAGAAGGCAGG + Intronic
1192747180 X:73950825-73950847 GTGGAAAAGATGGAGGAGGCAGG + Intergenic
1193810811 X:86048499-86048521 AAGCAAAAGGGGAAGGATGCTGG + Intergenic
1193861274 X:86671582-86671604 AAGGCAAAGGGGAAGGAAGCAGG - Intronic
1194981812 X:100449380-100449402 CAGGAAAATATGAAGAAGGAAGG - Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195821342 X:108948098-108948120 GAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196911854 X:120491874-120491896 CAGGCAAGGGTTAAGGAGGAAGG + Intergenic
1197187570 X:123605338-123605360 CATGAAAAGTTGAAGAGGGCAGG - Intronic
1197930415 X:131689296-131689318 AAGGCAAAGGGGAAGCAGGCAGG + Intergenic
1198543378 X:137664650-137664672 CATGAAAAGCTGAAAGTGGCCGG - Intergenic
1199278332 X:145971551-145971573 TAGGGAAAGGTGAAGGAGAGGGG + Intergenic