ID: 960096756

View in Genome Browser
Species Human (GRCh38)
Location 3:113696674-113696696
Sequence GCTTGCTGAGCTGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960096756_960096760 -6 Left 960096756 3:113696674-113696696 CCCGCGGCCGCAGCTCAGCAAGC 0: 1
1: 0
2: 2
3: 17
4: 148
Right 960096760 3:113696691-113696713 GCAAGCGAACAGCCTACCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 67
960096756_960096759 -7 Left 960096756 3:113696674-113696696 CCCGCGGCCGCAGCTCAGCAAGC 0: 1
1: 0
2: 2
3: 17
4: 148
Right 960096759 3:113696690-113696712 AGCAAGCGAACAGCCTACCCTGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960096756 Original CRISPR GCTTGCTGAGCTGCGGCCGC GGG (reversed) Intergenic
901777425 1:11569930-11569952 GCTTGCTGAGCTGCTGCCCCTGG + Intergenic
903590684 1:24453572-24453594 GTTTGCAGAGCTGTAGCCGCTGG + Intronic
903750397 1:25617449-25617471 CCTTCCCGCGCTGCGGCCGCCGG - Exonic
907905673 1:58782513-58782535 GCGCGCTGAGCAGCGGCGGCGGG - Exonic
909629812 1:77759688-77759710 GCTTGCGGAGGTGCGGCTGCAGG - Exonic
911164029 1:94709289-94709311 GCTCACTCAGCTGCAGCCGCTGG + Intergenic
915263483 1:154696878-154696900 GCTTGCTGAAGTGAGGCCACCGG - Intergenic
915906769 1:159884489-159884511 GCTTGCTGAGCAGCGGGAGCAGG - Exonic
916000469 1:160610530-160610552 GCTTGCTGTGCAGTGGCTGCAGG - Exonic
921737426 1:218643891-218643913 GCTTGCTGAGCTGCAGACAATGG - Intergenic
922200078 1:223393862-223393884 GCGGGCAGGGCTGCGGCCGCTGG - Exonic
1063201060 10:3785596-3785618 GCTCCCTTAGCTCCGGCCGCGGG - Intergenic
1066337094 10:34488946-34488968 GCATGCTGGGCTGTGGGCGCTGG - Intronic
1067288910 10:44927456-44927478 GCTTGCTGAGGGGTGGCGGCAGG - Intronic
1067799593 10:49349891-49349913 GATTGCTGAGCTGCTGCCTGTGG + Intergenic
1074861295 10:117512288-117512310 GCTTGCTGGGCTGTGGCAGCGGG + Intergenic
1075393782 10:122112827-122112849 GCCTGCCGCTCTGCGGCCGCGGG + Intronic
1075455947 10:122585111-122585133 GCTTGCTGAGCTGCAGACTTGGG + Intronic
1075458072 10:122597815-122597837 GCTTGCTGAGCTGCAGACTTGGG + Intronic
1076176898 10:128375083-128375105 GCTGGCTGAGCTGCCTCTGCAGG - Intergenic
1077008159 11:368962-368984 GCCTGCAGGGCTGGGGCCGCAGG - Intergenic
1077486913 11:2843088-2843110 GCTTGCTGTGCTGTGGCCAGTGG - Intronic
1081863543 11:46347586-46347608 GCGTGCTGAGCCCCGGCCGCCGG + Intronic
1083174153 11:60938912-60938934 GCTTCCTCAGCTGCGGGCCCAGG - Intronic
1083890224 11:65592289-65592311 GCGTGCTGAGCTGAGGCCGCCGG + Exonic
1083941866 11:65900248-65900270 GCTGCCTGCGCTGCGGCCGGGGG + Exonic
1089557623 11:119323334-119323356 GCATGGTGAGCTGAGGCCCCTGG + Intergenic
1091403670 12:196106-196128 CCGAGGTGAGCTGCGGCCGCCGG - Exonic
1091695331 12:2624432-2624454 CCTTGCTGAGCCTCGGCCCCTGG - Intronic
1097581333 12:61460557-61460579 GACTGCTGAGGTGCTGCCGCTGG + Intergenic
1102418828 12:112787925-112787947 GCTTGCTGAATTGCGGCCTGAGG + Intronic
1104010735 12:124928367-124928389 GCTTGCGGAGCTGCGCCCAGGGG - Intergenic
1104432558 12:128728365-128728387 GCTTGCTGAGCTGCCTTCCCAGG + Intergenic
1104505165 12:129325158-129325180 GGTTACTGAGCTTCTGCCGCGGG + Intronic
1106569800 13:30916453-30916475 GCTGGCTGAGCTGAGCGCGCGGG - Intronic
1107787046 13:43968350-43968372 GCGTGCTGAGCCCCGGCCGCCGG + Intergenic
1113570096 13:111347406-111347428 GCTTCCTGAGGTGAGGCCTCAGG - Intergenic
1113781997 13:112982246-112982268 GATTTCTGAGCTGGGGCCGAAGG + Intronic
1114450330 14:22821311-22821333 GCTTGCTGTGCGGCCACCGCAGG - Intronic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1115788998 14:36857779-36857801 ATTTGCTGGGCTGAGGCCGCAGG + Intronic
1118990474 14:70792847-70792869 GCCTGCTGAGCTGAGGCCAATGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1123060751 14:105593179-105593201 GCATGCAGAGCTGGGGCCTCAGG - Intergenic
1123085226 14:105714156-105714178 GCATGCAGAGCTGGGGCCTCAGG - Intergenic
1130906727 15:88246012-88246034 GCTTCCTGACCTGGGGCTGCAGG - Intronic
1132400085 15:101499732-101499754 GCTTCCTGAGCTGGGGCTACAGG + Intronic
1132541937 16:514235-514257 GGTTGCTGACCTGGGGCTGCAGG - Intronic
1132762801 16:1519104-1519126 GTCTGCTGAGCTGAGGCCACAGG - Intronic
1133323844 16:4931486-4931508 GGTTGCTGTGCTGCAGCCTCTGG - Intronic
1134104606 16:11476853-11476875 GCTGGCGGCGCTGCGGACGCTGG + Exonic
1134786889 16:16952697-16952719 GCTTGTTGGGCAGCAGCCGCGGG + Intergenic
1136448841 16:30340798-30340820 GCTTGCTGAGCTGCACCAACAGG - Intergenic
1136506446 16:30707203-30707225 GATTGCTGAGCTGCGGAAGGAGG + Exonic
1137755031 16:50894360-50894382 GCTTGCTGAGCTGTGGAATCTGG - Intergenic
1138335010 16:56246108-56246130 GCTGCCTGAGCTGCTGCCTCAGG + Intronic
1138352067 16:56351371-56351393 GCATGCGGTTCTGCGGCCGCAGG - Intronic
1138660783 16:58515834-58515856 GCTTCCTGAGCTGGTGCCGGCGG + Exonic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1140098578 16:71895501-71895523 GCTTGTTGTGCTGAGGCCGAGGG + Intronic
1140127538 16:72130713-72130735 GCTTGCTGAGCTGCAGAAGCAGG + Exonic
1141574304 16:84954271-84954293 CCTTTCTGAGCTGCGGTCGGAGG + Intergenic
1144572489 17:16408180-16408202 CCTGGCTGAGCTGTGGCCTCTGG + Intergenic
1147967305 17:44200088-44200110 TGCTGCCGAGCTGCGGCCGCGGG - Intronic
1150875020 17:68961363-68961385 GCTTGCTGAGATAGGGACGCGGG + Intergenic
1151801732 17:76383289-76383311 GCGCGCGGAGCTGCGGCCCCAGG + Intronic
1152109972 17:78352728-78352750 GCTTTCTGAGCAGCCGCCCCTGG + Intergenic
1152285456 17:79410124-79410146 GCATGCTGAGCTGAGGCAGCAGG - Intronic
1153805394 18:8705630-8705652 GCTGCCTGAGCTGCTGCCGGCGG + Intergenic
1160090083 18:75818819-75818841 GATCGCTGACCTGCGGCCACAGG - Intergenic
1160442861 18:78905567-78905589 ACTTGCTGGGCTGAGGCCGGAGG + Intergenic
1161575509 19:5052419-5052441 GCTTCCTGCCCTGTGGCCGCAGG + Intronic
1161779263 19:6280090-6280112 GCCTGCCGGGCTGCGGCCGGAGG + Intergenic
1161802241 19:6422801-6422823 GTTTTCTGAGCTGGGGCCACTGG - Intronic
1162561121 19:11418706-11418728 GCTGACTGCGCTGCCGCCGCAGG + Exonic
1163598270 19:18232984-18233006 ACTTCCTGAGCTCCGGCCGCGGG + Exonic
1163714070 19:18863939-18863961 GCTTCCTGAGCTGAGGCCCAAGG + Intronic
1164748786 19:30635903-30635925 GCTTTCTGAGCTGTGGCTGCAGG + Intronic
1165343968 19:35232107-35232129 GCTTGCTGAGATGCGCATGCAGG - Intergenic
1165395714 19:35562599-35562621 GGCTGCTGAGCTGCTGCTGCGGG - Exonic
1166205129 19:41264587-41264609 GCTTGCTGAGCGGCTGCAGGCGG + Exonic
1167321398 19:48799219-48799241 CCCTGCTGAGCTGAGGCCACTGG + Intronic
925134599 2:1517497-1517519 GCTTCCTCAGGTGCGGCAGCTGG + Intronic
927893586 2:26767467-26767489 GCCTGCTGTGCTGGGGCGGCAGG + Intronic
928823656 2:35392315-35392337 GCTTGCTCTGCTGCGCCAGCGGG - Intergenic
928983177 2:37156787-37156809 GCGTCCTGAGCTGGGGACGCAGG + Intronic
930535580 2:52642400-52642422 GCTTGCTGAGCTTTGGCTGGTGG + Intergenic
932420425 2:71598281-71598303 GCTTCCTGAGCTGTGGCTGCTGG - Intronic
932607655 2:73175773-73175795 GCTTGCAGAGCCGGGGCCCCGGG + Intergenic
945119582 2:206443796-206443818 GCTAGCTGCGGGGCGGCCGCGGG - Exonic
946309270 2:218873709-218873731 ACCTGCTGTGCTGCGGCCGCGGG + Exonic
947753091 2:232542932-232542954 GCTTCCTGGGCTGGCGCCGCTGG - Exonic
947796985 2:232900940-232900962 CCTGGCTGATCTGAGGCCGCCGG - Intronic
948115812 2:235493951-235493973 GCTTGCCGCCCTCCGGCCGCCGG - Intergenic
1174794877 20:53513665-53513687 GGTTGCTCAGCTGTGGCCGTGGG - Intergenic
1175248861 20:57597096-57597118 GCCTGGTGAGCGGCGGCCGGCGG + Intergenic
1175562295 20:59940378-59940400 CCTGGCTGAGCTGAGGCCGGCGG - Intronic
1175743234 20:61435484-61435506 GCTTGGTGCACTGCGGCCGGAGG + Intronic
1175839789 20:62019682-62019704 GCATGCTGAGCTGGGGACGTGGG - Intronic
1180991042 22:19936433-19936455 GCTGTCTGAGTTGGGGCCGCAGG - Intronic
1181804337 22:25366044-25366066 GCTGGGTGAGCTGTGGCCGGTGG + Intronic
1183057391 22:35315321-35315343 GCTTGCTGAGATGTGGCCTGTGG + Intronic
1183294019 22:37019460-37019482 GCCTGGGGAGCTGCGGCCGGGGG - Exonic
1183691040 22:39388614-39388636 TCTCGCTGAGCAGCGGCCTCAGG - Intergenic
1185038101 22:48489997-48490019 GCTGGCTGGGCTCCGACCGCCGG - Intronic
950481206 3:13245327-13245349 GTGTTCTGAGCTGCGGCTGCTGG - Intergenic
950964752 3:17138481-17138503 TCTTGCAGAGCTGCTGCCCCAGG + Intergenic
952453767 3:33453873-33453895 GCTTCCTGCACTGGGGCCGCAGG - Intergenic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
963133171 3:141876763-141876785 GCGAGAGGAGCTGCGGCCGCGGG - Exonic
966201328 3:177361779-177361801 GGGTGCTGAGCTTCGGCAGCGGG + Intergenic
966596245 3:181726684-181726706 CCTTTCAGAGCTGCGGCAGCCGG + Intergenic
966936327 3:184711987-184712009 GCTGGCGGCGTTGCGGCCGCAGG - Exonic
967411849 3:189174188-189174210 GCTTGCAGAGCAGCAGCCACAGG + Intronic
968512662 4:1002481-1002503 GCTGGGTGAGCCGGGGCCGCTGG + Exonic
968583697 4:1406333-1406355 GCTTCCTGGGCAGCGGCGGCGGG + Intergenic
968850569 4:3074975-3074997 GCTTCCTCAGCCGCCGCCGCAGG + Exonic
969868634 4:10091587-10091609 GCTTGCTGAGCAGCTGCCCAAGG - Intronic
977536403 4:98260790-98260812 GCTGGCTGAGGAGGGGCCGCCGG - Intergenic
980537403 4:134146515-134146537 GCTTGCTGAGCTGCTGGCGGTGG - Intergenic
982460954 4:155667795-155667817 GCGTGCAGCGCTGCGGCCTCCGG + Intronic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
983456593 4:167972563-167972585 GCTTGCTGAGCTGTGGGTGGTGG + Intergenic
986581674 5:9272273-9272295 CCTTGCTGAGCTGCGGTGGTGGG - Intronic
991006332 5:61831993-61832015 GCTTGCTGATCTGCGTCAGCTGG + Intergenic
992832984 5:80613479-80613501 GCCTCCTGAGCTGAGGCAGCTGG + Intergenic
993495209 5:88601199-88601221 GCTTGCTGAGATGGGGGCACTGG - Intergenic
997830184 5:137142867-137142889 GTTGGCTGAGCTGCAGCCCCAGG - Intronic
997978420 5:138453959-138453981 GCTTGCTGGGCGGTGGCCTCAGG + Intergenic
999272272 5:150303356-150303378 GCTTCCTGACTTGCAGCCGCGGG - Intronic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002105890 5:176879318-176879340 GTTTGCTGAGCTGCTGGCTCTGG + Exonic
1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG + Exonic
1006458376 6:34144555-34144577 GGTTGCCGGGCTCCGGCCGCTGG + Intronic
1007575940 6:42925292-42925314 GCTTGAAGAGCAGCAGCCGCAGG - Exonic
1007709086 6:43810319-43810341 GCTGAGTGAGCTGCGGCAGCAGG + Intergenic
1014817640 6:125953102-125953124 GCTTGCTGAGCTGCAGGCGGTGG + Intergenic
1017103166 6:150865960-150865982 GCTTGGACAGCGGCGGCCGCAGG + Exonic
1018960019 6:168441403-168441425 GCTCGCTGGGCTGCTCCCGCCGG + Exonic
1019048924 6:169168479-169168501 GCCTGCTGACCTGGGGCCGCAGG + Intergenic
1019300530 7:301287-301309 TCCTGCTGAGCTGAGGCTGCTGG + Intergenic
1019525516 7:1478765-1478787 GCATCCTGAGCTGTGCCCGCAGG + Exonic
1024610811 7:51062654-51062676 GCTTGCTGATCTGCAGGGGCTGG + Intronic
1024828727 7:53422527-53422549 GCTTGCTGAGCTGCTGGTGGTGG + Intergenic
1027227699 7:76254811-76254833 GCTTGATGAGCTGAGGGTGCTGG + Intronic
1031869018 7:127072193-127072215 GCTTGCTGAGCTGAGACTACAGG - Intronic
1032086853 7:128888930-128888952 GCTTCGTGACCTGCGGCCGCCGG - Exonic
1032947764 7:136871296-136871318 GCCTGCAGCGCTGCAGCCGCAGG - Intronic
1033589342 7:142797043-142797065 GCTGGGTAAGCTGGGGCCGCCGG + Intergenic
1034270590 7:149801860-149801882 GCCAGCTGAGCTGTGGCAGCGGG + Intergenic
1037725140 8:21477143-21477165 GCAGGCTGCGCTGCAGCCGCTGG + Intergenic
1040928877 8:52714096-52714118 GCTGGCTCTGCTGCTGCCGCCGG - Exonic
1043618740 8:82160844-82160866 GCTTGCTGAGCAGCGGGTGGTGG + Intergenic
1044591404 8:93917162-93917184 GCTCGCGGATCGGCGGCCGCGGG + Exonic
1045691017 8:104759862-104759884 GCTTGCAGAACAGCGGCCCCTGG + Intronic
1047746913 8:127851981-127852003 GCTGGCTGAGCTGCAGCCCTTGG - Intergenic
1049180898 8:141221650-141221672 GCACCCTGAGCTGGGGCCGCCGG - Exonic
1049661501 8:143821602-143821624 GGTTGGTGAGCTGCTGCTGCTGG + Exonic
1056595826 9:88007018-88007040 GCTGGCTGGACTGCGGCCTCAGG - Intergenic
1057449519 9:95144270-95144292 ACTTGCTGAGCTGAAGCCACAGG + Intronic
1057880293 9:98788015-98788037 GCTTGGTGAACTGAGGCAGCTGG + Intronic
1059852883 9:118363807-118363829 GCTTCCTGAGCTGCGGGTGATGG + Intergenic
1061019699 9:128006153-128006175 GCTTCCTGTGCTGTGGCAGCTGG - Intergenic
1061385787 9:130288669-130288691 GTTTGCTGAGCTCCTGCCCCGGG + Intronic
1061450120 9:130663258-130663280 CCTTGCTGAGCTGCAACCTCGGG - Intergenic
1061499198 9:130992569-130992591 GCTTGCTGCTGTGCGGCTGCAGG - Intergenic
1062500545 9:136850214-136850236 GCGTGCTCAGCTGGGGCCACGGG - Intronic
1201333466 Y:12853165-12853187 CCTTGCTGAGCTGCGGTGGGCGG + Intronic