ID: 960096796

View in Genome Browser
Species Human (GRCh38)
Location 3:113696857-113696879
Sequence ATCGGGCGGCCCAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960096791_960096796 -6 Left 960096791 3:113696840-113696862 CCAAGGAGTGAACGGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 79
Right 960096796 3:113696857-113696879 ATCGGGCGGCCCAATGAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960096796 Original CRISPR ATCGGGCGGCCCAATGAGGA GGG Intergenic
902768026 1:18630013-18630035 ATCTGGGGGCCCAAAGAGGTGGG - Intergenic
1077306213 11:1869773-1869795 ATGGGGCGCCCCACAGAGGAGGG + Intronic
1098284269 12:68892334-68892356 GTCGAGGGGCACAATGAGGATGG + Intronic
1100379661 12:94049739-94049761 ATCTGGAGGCTCAATGGGGAAGG + Intergenic
1105749253 13:23407099-23407121 TTCGGGTGGCAGAATGAGGATGG - Intronic
1114430180 14:22654128-22654150 ATCAGGAGGCCCAGTGAGAAGGG - Intergenic
1121839005 14:97117334-97117356 ATCGGGTGGCCCAGGAAGGACGG + Intergenic
1129255429 15:74331453-74331475 ATGGGGCGCCTGAATGAGGAGGG - Intronic
1132864055 16:2085009-2085031 ATCCTGCTGCCCAATGAGGTAGG + Exonic
1146574076 17:33976725-33976747 ATCAGGTGGCCCAAGGAGAAAGG + Intronic
1147285679 17:39401393-39401415 ACCCGCCGGCCCCATGAGGAGGG - Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152605068 17:81285505-81285527 ACGGGGCGGCCGAATGCGGAAGG + Intronic
1153629545 18:7056291-7056313 ATCAGGCAGCCCATTGGGGAGGG + Intronic
1154173583 18:12067724-12067746 CATGGGCGGCCCAATGCGGAGGG - Intergenic
1155175683 18:23299353-23299375 ACCGGGAGGACCACTGAGGAGGG - Intronic
1173151857 20:40573293-40573315 TTAGGGCCGCCCAATGAGGTAGG - Intergenic
1175942430 20:62543655-62543677 TTCAGGCTGCCCACTGAGGAGGG - Intergenic
1175992678 20:62797242-62797264 ATCGGGCGGCACAGGGAGGGCGG - Intronic
1179787443 21:43737791-43737813 CTCGGGCGGCCCAAGGAGCCTGG - Intronic
952255958 3:31695963-31695985 ACAGAGCGGCCCTATGAGGAAGG + Intronic
960096796 3:113696857-113696879 ATCGGGCGGCCCAATGAGGAGGG + Intergenic
961082205 3:124035814-124035836 ACTGGGCTGCCCAAGGAGGAGGG - Intergenic
988452372 5:31356268-31356290 ATCTGGTGGCCCATTGTGGAGGG - Intergenic
997505145 5:134411478-134411500 TTCGGGCCGACCAATGCGGATGG + Intronic
999551552 5:152692923-152692945 ATAGGGAGGCCCAAGGAGAAGGG + Intergenic
1002094472 5:176822976-176822998 ATCTGGCAGCCCATGGAGGATGG + Intronic
1002317438 5:178352137-178352159 CTCGGGCGGCCCTGTGAGGGGGG + Intronic
1022606115 7:31815768-31815790 ATCCTGCAGCCCAATGAGGTGGG + Intronic
1024325690 7:48107582-48107604 ATCGGGGTGCCCCAGGAGGAGGG - Intronic
1025610619 7:63073029-63073051 ATCAGGAGGCCCTGTGAGGAAGG - Intergenic
1032336229 7:131027574-131027596 ATCTGGCGGCCCTCGGAGGAAGG + Intergenic
1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG + Intronic
1035705160 8:1669584-1669606 CTGGGGCGGCCCAGGGAGGAGGG + Intronic
1049264256 8:141658874-141658896 ATCGTGCAGCCAAATGTGGATGG + Intergenic
1052085125 9:24255855-24255877 ATTGGCTGGCCCAATGAGAAAGG + Intergenic
1189311950 X:40025489-40025511 AGTGGGTGGGCCAATGAGGAAGG + Intergenic
1200216160 X:154369099-154369121 AGGGGGCGGGCCTATGAGGAGGG + Intronic