ID: 960097127

View in Genome Browser
Species Human (GRCh38)
Location 3:113699291-113699313
Sequence CAGGAAAAGGTGAAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960097127_960097136 23 Left 960097127 3:113699291-113699313 CCCGCCTCCTTCACCTTTTCCTG No data
Right 960097136 3:113699337-113699359 CTTGCCCTCTGATTCTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960097127 Original CRISPR CAGGAAAAGGTGAAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr