ID: 960105273

View in Genome Browser
Species Human (GRCh38)
Location 3:113788857-113788879
Sequence AGACCTCTGGGAAGTCCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960105273 Original CRISPR AGACCTCTGGGAAGTCCCGG AGG (reversed) Exonic
900148825 1:1169516-1169538 AGACCTCTGGGAGGTTCCCGGGG + Intergenic
905456918 1:38094722-38094744 AGACCTCTGGCAAGACTCAGTGG + Intergenic
905563220 1:38943381-38943403 AGCGCTCTGGGAAGTCAAGGCGG - Intergenic
906062310 1:42957276-42957298 AGACCCCGGGGAAGTTCCCGGGG - Intronic
908520983 1:64941831-64941853 AGAACACTGGAAAGTCCCAGGGG - Intronic
909251546 1:73363369-73363391 AGACCTTTGGGAAGCCAAGGCGG + Intergenic
909757411 1:79243773-79243795 AGACCTGTGAGAATTCCAGGTGG - Intergenic
911768111 1:101703338-101703360 AGACCTCTGGGAAATTCCCAAGG - Intergenic
914426681 1:147584292-147584314 AGCACTTTGGGAAGTCCAGGAGG - Intronic
917232270 1:172851287-172851309 AGCCCTCTGGAGGGTCCCGGGGG + Intergenic
917429662 1:174952835-174952857 AGCCCTGTGGGAAGTCAAGGTGG - Intronic
919488577 1:198175003-198175025 AGAACTTTGGGAAGCCACGGTGG - Intronic
919687261 1:200495832-200495854 AGACAGCTGGGAAGTCATGGGGG - Intergenic
919767120 1:201134637-201134659 AGAGCCTTGGGAAGTCCAGGCGG - Intergenic
919962600 1:202486555-202486577 AGCACTCTGGGAAGTCGAGGTGG + Intronic
922757065 1:228102545-228102567 AGACCTCCGCGAAGTCCTGCAGG + Exonic
924727157 1:246681685-246681707 AGCACTTTGGGAAGTCCAGGCGG - Intergenic
1065517514 10:26539161-26539183 AGAACTCTGGGAGGACCAGGTGG + Intronic
1067514797 10:46929489-46929511 AGAACTCTGAGAAGTCACAGAGG - Intronic
1067647459 10:48122324-48122346 AGAACTCTGAGAAGTCACAGAGG + Intergenic
1067902781 10:50259448-50259470 AGCCCTTTGGGAGGTCCAGGCGG - Intergenic
1069686546 10:70322654-70322676 TGGCCTCTGGGAAGCCCCTGGGG - Intronic
1070325294 10:75384846-75384868 AGACCAATGGGTAGTCCCAGGGG - Intergenic
1072049962 10:91693648-91693670 AGAACTTTGGGAGGTCCAGGTGG + Intergenic
1073259592 10:102179031-102179053 AGAACTCTGGGAAGCCTAGGCGG - Intergenic
1074743670 10:116509222-116509244 AGCACTTTGGGAAGTCGCGGCGG + Intergenic
1075052406 10:119192483-119192505 AGAACTTTGGGAAGTCGAGGCGG - Intergenic
1075342301 10:121656957-121656979 AGCACTTTGGGAAGTCACGGTGG - Intergenic
1075374668 10:121969095-121969117 AGCACTTTGGGAAGTCCAGGCGG + Intronic
1076778246 10:132709878-132709900 AGACCCTTGGGAAGCCCCGTGGG - Intronic
1077462450 11:2717432-2717454 AGACTTCTGGGTAGCCCAGGTGG + Intronic
1078590632 11:12637791-12637813 AGAACTCTGGGAAGCCGAGGTGG + Intergenic
1081573381 11:44304797-44304819 AAATCTCGGCGAAGTCCCGGAGG - Intronic
1083651118 11:64205487-64205509 AGCACTTTGGGAAGTCCAGGCGG - Intergenic
1084260160 11:67971836-67971858 AGACCTCTGGGAGGCCGAGGTGG + Intergenic
1088630801 11:111772176-111772198 AGCACTTTGGGAAGTCCAGGTGG + Intergenic
1088921374 11:114261742-114261764 AGACTTCTGGAAAGGCCCAGCGG - Intronic
1089754699 11:120678107-120678129 AGGCCTCTGGGCAGTGCCTGTGG + Intronic
1091399349 12:173004-173026 AGGCCGCTGCGAAGTCCAGGCGG + Intronic
1092071720 12:5636825-5636847 AGACCTCTGGGGGGTACCTGGGG + Intronic
1092479869 12:8850227-8850249 AGGTCTCTGGGAAGTACTGGCGG - Exonic
1096164351 12:49408801-49408823 AGAACTCTGGGAAGCCGAGGTGG - Intronic
1098977612 12:76919778-76919800 GTCCCTCTGGGAAGTCCAGGGGG - Intergenic
1100540741 12:95555110-95555132 AGCACTTTGGGAAGTCCAGGTGG - Intergenic
1101147201 12:101852449-101852471 AGCACTTTGGGAAGTCCAGGTGG - Intergenic
1102087260 12:110152836-110152858 AGTACTTTGGGAAGTCCAGGCGG - Intronic
1102227271 12:111237642-111237664 AAACCTCTGGGAACTTCCAGTGG + Intronic
1103578791 12:121898965-121898987 AGAACTTTGGGAAGTCAAGGTGG - Intronic
1104051107 12:125194463-125194485 AGACCCCTTGGAAGGCCCGGGGG - Intronic
1106464065 13:29997018-29997040 AGGGCTGTGGGAAGTCCCAGTGG - Intergenic
1107241690 13:38242851-38242873 AGCACTCTGGGAAGCCCAGGTGG + Intergenic
1107403373 13:40090756-40090778 AGTGCTCTGGGAGGTCCAGGAGG - Intergenic
1108790629 13:53966062-53966084 AGACCTCTGAAATGTCCTGGAGG - Intergenic
1109862549 13:68219249-68219271 AAATGTCTGGGAAGCCCCGGTGG - Intergenic
1110460571 13:75740339-75740361 AGCCCTCTGGGAGGTCAAGGCGG + Intronic
1111841878 13:93459311-93459333 AGAACTTTGGGAAGTCAAGGTGG - Intronic
1112289667 13:98134156-98134178 AGATCCCTGGGAAGTCCCAGAGG - Intergenic
1114218757 14:20678032-20678054 AGAACTTTGGGAGGTCCAGGCGG + Intergenic
1114250192 14:20953140-20953162 AGCACTTTGGGAAGTCCAGGGGG + Intergenic
1116882496 14:50185442-50185464 AGAACTTTGGGAAGTCAAGGTGG + Intronic
1119057459 14:71437607-71437629 AGCACTTTGGGAAGTCCAGGCGG - Intronic
1119300898 14:73570320-73570342 AGCACTTTGGGAAGTCTCGGCGG + Intronic
1120621883 14:86775061-86775083 AGACCTCTGACATGTCCTGGAGG - Intergenic
1122666507 14:103333997-103334019 AGACCTCTGGGAAAGGCGGGGGG + Exonic
1123055216 14:105566250-105566272 AGTCCTCTGGGAAGTGCCCTGGG + Intergenic
1123079665 14:105686094-105686116 AGTCCTCTGGGAAGTGCCCTGGG + Intergenic
1123125829 14:105945352-105945374 AGCCCTCTGGGAAGGCGCTGGGG - Intergenic
1125557568 15:40599050-40599072 AGCACTCTGGGAAGTCAAGGTGG - Intronic
1127106868 15:55625998-55626020 AGACCTTTGGGAAGTCAAGGTGG - Intronic
1127552821 15:60058015-60058037 AAATCTCTGGCAAGTCCCGGAGG - Intronic
1127674695 15:61228498-61228520 AGCGACCTGGGAAGTCCCGGGGG - Intronic
1129106067 15:73308117-73308139 AGAACTCTCAGAAGTCCAGGGGG + Intergenic
1130201177 15:81828235-81828257 AGCACTCTGGGAAGTCAAGGTGG + Intergenic
1130679172 15:85981332-85981354 AGACCTCCAGGAAGTTCTGGGGG + Intergenic
1130765744 15:86869263-86869285 GGACCACTGGGAAGACACGGTGG - Intronic
1131102647 15:89705304-89705326 AGACGTCTGGGAGATGCCGGTGG + Intronic
1131461467 15:92620565-92620587 AGACCTGTGGGAGGCCACGGCGG + Intronic
1132419410 15:101652510-101652532 AGCCTTCTGGGAGGTCCCCGAGG + Intergenic
1133568174 16:7014969-7014991 AGCCCTTTGGGAGGTCCAGGCGG - Intronic
1135094186 16:19550398-19550420 AGAGCTCTGGGAAGCCGAGGTGG - Intronic
1137262433 16:46842729-46842751 CCACCTCTGAGAAGCCCCGGAGG + Intergenic
1141180714 16:81751772-81751794 AGCCCTTTGGGAAGTCACGGTGG + Intronic
1141289001 16:82700183-82700205 AAGCCTCTGAGAAGTCCCGCAGG - Intronic
1141871537 16:86789774-86789796 AGATCTCAGGGCAGTCCTGGGGG + Intergenic
1142903046 17:3025574-3025596 GGACTCCTGGGAAGTCCCGGGGG - Intronic
1143215653 17:5222910-5222932 AGCCCTTTGGGAAGCCCAGGTGG - Intronic
1144886693 17:18467773-18467795 AGCCCTTTGGGAGGTCCAGGCGG + Intergenic
1145145518 17:20476534-20476556 AGCCCTTTGGGAGGTCCAGGCGG - Intergenic
1145776844 17:27535038-27535060 AGGCATCTGAGAAGTCCCTGGGG + Intronic
1147808705 17:43151055-43151077 AGACCTCTGCAAAGGCCCTGAGG - Intergenic
1148741513 17:49895706-49895728 AGTACTCTGGGAAGTCAAGGTGG - Intergenic
1150003752 17:61457077-61457099 AGGCCTCTGGGACGTCGCCGAGG + Intronic
1152022010 17:77784878-77784900 AGCACTCTGGGAAGCCCAGGTGG - Intergenic
1152410686 17:80121066-80121088 AGCACTTTGGGAAGTCCAGGCGG + Intergenic
1152859025 17:82684864-82684886 AGAACTCTGGGAGGTCGAGGCGG + Intronic
1153203449 18:2670651-2670673 AGCACTTTGGGAAGCCCCGGCGG + Intronic
1153699865 18:7681858-7681880 AGACCTCTGGGGACTTCCAGGGG - Intronic
1156355722 18:36338735-36338757 ACACCTCAGGGAAGTCCAGCTGG - Intronic
1159979415 18:74758825-74758847 AGAACTCTGGGAAGTCAAGGTGG - Intronic
1160049888 18:75423165-75423187 AAACCTCTGGGAAGTCCTGTAGG - Intronic
1160212668 18:76895488-76895510 AGACCTTTGTGCAGTCCCTGTGG - Intronic
1161549875 19:4906504-4906526 AGCACTTTGGGAAGTCCAGGCGG + Intronic
1163277831 19:16296671-16296693 GGACCTCGGGCAAGTCACGGAGG - Intergenic
1164207812 19:23072479-23072501 AGCACTTTGGGAAGTCCAGGTGG + Intergenic
1165842044 19:38793993-38794015 AGCACTCTGGGAAGCCTCGGTGG - Intergenic
1167295691 19:48647817-48647839 AGAACTCTGGGAGGTCAAGGTGG + Intergenic
1167849013 19:52188017-52188039 AGCGCTCTGGGAAGTCCAAGTGG + Intergenic
925373686 2:3366058-3366080 AGCACTTTGGGAAGTCCAGGTGG + Intronic
926152564 2:10432995-10433017 AGCCCGCTGGGAAGAGCCGGAGG - Intergenic
926246698 2:11126836-11126858 AGCACTCTGGGAAGTCAAGGTGG + Intergenic
927890718 2:26746705-26746727 AGCACTTTGGGAAGTCACGGTGG - Intergenic
929780885 2:44956091-44956113 AGACCTATTGCAAGTCCAGGTGG - Intergenic
929784868 2:44982132-44982154 AGACCTCTGAGAAGAGGCGGAGG - Intergenic
929935924 2:46294710-46294732 AGCACTCTGGGAAGCCCAGGTGG + Intronic
931362289 2:61587925-61587947 AGGACTCTGGGAAGTCAAGGTGG + Intergenic
936470547 2:112795081-112795103 AGACATGTGGGAATTGCCGGAGG - Intergenic
937874724 2:126814481-126814503 AGCACTTTGGGAAGTCCAGGGGG - Intergenic
946271880 2:218601105-218601127 AGAACTCTGGGAAGCCGAGGTGG + Intergenic
946842491 2:223832444-223832466 AGACCTGTGGGAAGGGCCAGTGG + Intronic
947114705 2:226756714-226756736 AGAACTCTGGGAGGCCCAGGTGG + Intronic
948275498 2:236705068-236705090 AGCCCTGTGGGAGGTCCCTGAGG + Intergenic
948379493 2:237542622-237542644 AGCCCTCGGGAAAGCCCCGGAGG + Exonic
1168965149 20:1894458-1894480 CGGCCTCTGGGCAGCCCCGGCGG + Exonic
1168975959 20:1966058-1966080 GGACCTCTGGGAAGTCAATGGGG + Intergenic
1171989783 20:31687068-31687090 AGAACTTTGGGAGGTCCAGGAGG + Intronic
1172354987 20:34273476-34273498 AGCACTCTGGGAAGTCGAGGTGG - Intergenic
1173223711 20:41149352-41149374 AGCCCTCTGAGAAGTCCCACTGG - Intronic
1174203334 20:48822265-48822287 AGACCTCTGGGCTGCCCAGGTGG - Intronic
1176549341 21:8214608-8214630 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1176557234 21:8258831-8258853 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1176576176 21:8441866-8441888 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1177881221 21:26697044-26697066 AGACCACTGGGGAGTCCATGAGG + Intergenic
1178546046 21:33493767-33493789 AGCCCTCTGGGAGGCCCAGGTGG + Intergenic
1179005351 21:37508993-37509015 TGACCTCTGTGAAATCCAGGTGG - Intronic
1180921833 22:19525136-19525158 AGAGGTCTGGGAAGCCCCTGCGG - Intronic
1181095225 22:20500469-20500491 AGCACTCTGGGAAGTCAAGGTGG - Intronic
1181165103 22:20979149-20979171 TGACCTCTGGGGAGACCAGGAGG + Intronic
1182469975 22:30542504-30542526 CGGCCTCTGGGCAGCCCCGGCGG + Intronic
1183389664 22:37538281-37538303 AGCCCTTTGGGAAGCCACGGTGG - Intergenic
1185135324 22:49068009-49068031 AGGCCTCTGGGACTTCCAGGTGG - Intergenic
1185232139 22:49689398-49689420 AGAACTCTGAGAAGTGCAGGGGG + Intergenic
1203254226 22_KI270733v1_random:130924-130946 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1203262282 22_KI270733v1_random:176003-176025 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
951767199 3:26213412-26213434 GGGCCTCTTGGAAGGCCCGGTGG + Intergenic
952413409 3:33069140-33069162 AGCACTCTGGGAAGTCACGGTGG + Intronic
952475523 3:33706003-33706025 AGAACTTTGGGAAGTCAAGGTGG + Intronic
952958817 3:38577032-38577054 AGAGCTCTGGGAAGCCACTGGGG + Intronic
960105273 3:113788857-113788879 AGACCTCTGGGAAGTCCCGGAGG - Exonic
963680307 3:148366410-148366432 AGACCCCTGGGAAGTTACAGAGG + Intergenic
965440008 3:168700583-168700605 AGAACTTTGGGAAGTCAAGGCGG - Intergenic
966362550 3:179146475-179146497 AGCACTCTGGGAAGTCGAGGGGG + Intergenic
967454563 3:189668763-189668785 AGAACTTTGGGAAGTCAAGGCGG + Intronic
968486651 4:866196-866218 TGACCTCTGGGACGTCCTGCAGG + Intronic
970093527 4:12435917-12435939 AAACCTCAGGGAAGTCACTGGGG + Intergenic
970756228 4:19429700-19429722 AAACCTCTTGGAAGGCCCTGGGG + Intergenic
974866971 4:67592929-67592951 AGCACTTTGGGAAGTCCAGGTGG - Intronic
977704490 4:100055985-100056007 AGACCTCTGGAAAGAACCCGCGG - Intergenic
978083458 4:104621639-104621661 AGACCTCTGACATGTCCTGGAGG + Intergenic
978769375 4:112438198-112438220 AGACCTCTGGTAAGACAAGGGGG - Intronic
982650191 4:158078800-158078822 AGAACTCTGGGAGGTGCCAGTGG - Intergenic
984248076 4:177299541-177299563 AGAACTTTGGGAAGCCCAGGAGG - Intergenic
984598974 4:181704743-181704765 AGACCCCTGGCAGGGCCCGGTGG + Intergenic
986443337 5:7799809-7799831 TGCCCTCTGGGAAGTCCCATTGG + Intronic
986936922 5:12900539-12900561 AGAACTTTGGGAAGTCAAGGCGG + Intergenic
988546906 5:32166558-32166580 AGACCTTTGGGAAGGCGAGGTGG + Intronic
988594310 5:32577421-32577443 AGACCACTGTGAAGTACCAGTGG + Intronic
989167231 5:38444016-38444038 AGCCCTTTGGGAGGTCCAGGCGG - Intronic
989469360 5:41797065-41797087 AGTCCTGTGGGAAGTCAAGGAGG + Intronic
990037998 5:51346056-51346078 AGACCTATAGGAAGTTCCTGAGG - Intergenic
997441578 5:133912324-133912346 AGAACTTTGGGAGGTCCAGGTGG + Intergenic
1002093253 5:176817020-176817042 AGAGCTCTGGGAAGTCTGAGTGG + Intronic
1002779824 6:357543-357565 ATACCTTGGGGAAGTCCCCGAGG + Intergenic
1004550891 6:16646107-16646129 AGAGCTCTGGGAAGTTGGGGTGG + Intronic
1005472587 6:26176282-26176304 AGAACTTTGGGAAGTCAAGGCGG - Intergenic
1008876095 6:56329731-56329753 ACACCTATGGGAAGTCCTAGGGG - Intronic
1013111731 6:107069924-107069946 AGAGCTCGGGGAAGAGCCGGTGG + Exonic
1013894394 6:115068235-115068257 AGACTGCTGGGGAGTCCCAGAGG - Intergenic
1016007911 6:139108114-139108136 AGCACTCTGGGAAGCCCAGGTGG + Intergenic
1021928312 7:25554262-25554284 AGACCTCTGTGAGGGCCAGGAGG - Intergenic
1023849412 7:44141748-44141770 AAACCTCTGGGAAGCCCCGGGGG - Intergenic
1028171364 7:87600617-87600639 AGTCCTCTGGCAAGTCCATGGGG - Intronic
1028421012 7:90632839-90632861 AGACCTTTGGGAAGCCGAGGTGG + Intronic
1028621858 7:92835179-92835201 AGACCCCCGGGCAGTCCCTGGGG - Intronic
1032396084 7:131591094-131591116 AGCACTTTGGGAAGTCCAGGCGG - Intergenic
1033345348 7:140521921-140521943 AGACCTCCAGGAAGTGGCGGAGG + Exonic
1034991041 7:155548394-155548416 AGTCCTCTAGGAAGAGCCGGCGG + Intergenic
1035142321 7:156775118-156775140 AGCACTCTGGGAAGCCCGGGTGG + Intronic
1035622090 8:1042645-1042667 CATCCTCTGGGAAGTCCTGGGGG + Intergenic
1035622424 8:1043988-1044010 CGTCCTTTGGGAAGTCCTGGGGG - Intergenic
1037944189 8:22976187-22976209 AGACCACTGGGGACTCCTGGGGG + Intronic
1039352502 8:36778807-36778829 ATACCTCTGGGTAGTTCTGGGGG - Intergenic
1042882989 8:73515213-73515235 AGACCATGGGGAAGTCCCAGAGG + Intronic
1043293056 8:78628096-78628118 AGACCTTTGGGAAGCCGAGGTGG + Intergenic
1043624825 8:82243818-82243840 AGACCTCTGGGAAATCTTCGAGG + Intergenic
1043954158 8:86342464-86342486 AGACTGCTCGGAAGACCCGGAGG + Intergenic
1044572251 8:93733842-93733864 AGACCTTAGGGAAGCTCCGGAGG - Exonic
1045935439 8:107673038-107673060 ACACCTCTGGGAAGTTGTGGGGG - Intergenic
1046173665 8:110546357-110546379 AGAACTCTGGGAGGTACCAGCGG - Intergenic
1048461709 8:134626609-134626631 GGATCTCTGGGAAGTTCTGGAGG + Intronic
1053210849 9:36226429-36226451 AGCACTTTGGGAAGTCCAGGTGG - Intronic
1055018637 9:71645783-71645805 AGACCTTTGGGAGGTCGAGGTGG - Intergenic
1056580085 9:87884062-87884084 TTACCTCTGGGGAGTCCCGGGGG - Intronic
1056826636 9:89880414-89880436 GGCCCCCTGGGAAGTCCTGGTGG + Intergenic
1059193841 9:112352167-112352189 AGCACTTTGGGAAGTCCAGGTGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060795628 9:126510801-126510823 AGAGGTCTGGGAAGGCCCTGAGG + Intergenic
1061627524 9:131849880-131849902 AAGCCTCTGTGAAATCCCGGTGG + Intergenic
1203470627 Un_GL000220v1:114068-114090 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1203478448 Un_GL000220v1:158040-158062 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1190043684 X:47094167-47094189 AGAGCTTTGGGAAGTCAAGGCGG - Intergenic
1198743223 X:139863283-139863305 AGAACTTTGGGAAGCCCAGGTGG + Intronic
1201390118 Y:13489053-13489075 AGACCACTGGGAAGTACATGTGG + Intergenic
1202297733 Y:23377495-23377517 AGCACTCTGGGAAGTCAAGGTGG + Intergenic
1202573076 Y:26293102-26293124 AGCACTCTGGGAAGTCAAGGTGG - Intergenic