ID: 960111845

View in Genome Browser
Species Human (GRCh38)
Location 3:113852515-113852537
Sequence CTAAGGGTACCTAGCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960111839_960111845 25 Left 960111839 3:113852467-113852489 CCAACACTTCTGGCAATACAAGA 0: 1
1: 0
2: 1
3: 11
4: 246
Right 960111845 3:113852515-113852537 CTAAGGGTACCTAGCAATGCTGG 0: 1
1: 0
2: 1
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960111845 Original CRISPR CTAAGGGTACCTAGCAATGC TGG Intronic
901276236 1:7993269-7993291 CTACAGGTACCTGGCACTGCAGG + Intergenic
911102412 1:94105091-94105113 CTCATTGTACCTAGCAATGCTGG + Intronic
913156516 1:116104813-116104835 CTGAGTGAACCTAGCCATGCAGG - Intergenic
920954233 1:210602814-210602836 CTAAGGATCATTAGCAATGCAGG + Intronic
922424983 1:225484237-225484259 CTAAACGTGCCTAGCAGTGCTGG - Intergenic
1066275678 10:33866099-33866121 CTAGGGGCACCTAGGATTGCTGG - Intergenic
1083187088 11:61024022-61024044 CTGTGGGTACCTTGCCATGCTGG + Intergenic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1106369397 13:29117005-29117027 GTAACCCTACCTAGCAATGCTGG - Intronic
1106814183 13:33388638-33388660 CAAAGGGGAATTAGCAATGCAGG - Intergenic
1108002965 13:45921784-45921806 CTAAGGGTACCAAGCAAAAGAGG + Intergenic
1121066943 14:90976445-90976467 CTAAGGGTACCAAGCCCTACCGG - Intronic
1125592161 15:40861567-40861589 CTCTGGGGACCTAGCAATCCAGG + Intergenic
1127971890 15:63968326-63968348 CTAAGGATACCTGGCCATGGTGG + Intronic
1129383404 15:75182353-75182375 CTAGGGGCAACTATCAATGCAGG - Intergenic
1133631127 16:7623029-7623051 CATAAGGTACCTAGCAATGGAGG - Intronic
1133634162 16:7650332-7650354 CCAAGGGTACCTAGCCTTCCAGG + Intronic
1134879505 16:17733055-17733077 CAAAGGGTACTTAGTAATGGTGG + Intergenic
1139593281 16:67944693-67944715 CCAAGGAGACCTAGCAAAGCTGG + Exonic
1165421009 19:35721895-35721917 CTGAGGGTTCCCCGCAATGCTGG - Intronic
1166125789 19:40714785-40714807 CTAAGGGTTCCTAGCAACCAGGG - Intronic
930857143 2:56031007-56031029 CTGAAGGAATCTAGCAATGCTGG + Intergenic
940943459 2:159589888-159589910 TTAAGGATACCCAGCAAGGCCGG + Intronic
944243128 2:197504981-197505003 CTAAGGCCACTTAGCAATACTGG + Intronic
1175252046 20:57615661-57615683 CTAGGGGTAAGTGGCAATGCCGG + Intronic
1180869406 22:19137892-19137914 CTAAGTCTACCTAGCACTGCAGG - Intronic
1184080115 22:42213378-42213400 CAAAGGCCACCTAGCAATGGTGG - Exonic
960111845 3:113852515-113852537 CTAAGGGTACCTAGCAATGCTGG + Intronic
962251182 3:133836997-133837019 CCAAGGGTTCCCAGCAATGCTGG + Intronic
968962503 4:3752724-3752746 CTAGGGGAACCCAGCAGTGCTGG + Intergenic
972075887 4:35086598-35086620 AGAAGGGAACCTAGGAATGCAGG - Intergenic
972918341 4:43906600-43906622 CTAAGGGTTCCTAGCAAAGGGGG - Intergenic
981516609 4:145617110-145617132 CAAATTGTAGCTAGCAATGCTGG - Intergenic
984824672 4:183913823-183913845 CTAATAATACCTAGCAGTGCTGG - Intronic
988894267 5:35655182-35655204 CTAAAAGTCCCAAGCAATGCTGG - Intronic
989264346 5:39455727-39455749 CTGAAGGTTTCTAGCAATGCAGG + Intronic
998825305 5:146095469-146095491 CTAAGAGCACCTAGAAAAGCTGG - Intronic
998941775 5:147291269-147291291 ATAAGACTTCCTAGCAATGCAGG - Intronic
1012107074 6:95176099-95176121 CTAAGGGTAGCGAGCCAGGCAGG - Intergenic
1012583870 6:100899170-100899192 CTAAGGGTCCCTAGCAAAAAGGG - Intergenic
1022678947 7:32526322-32526344 CTAAGGGTCCCTAGCAAAAGGGG + Intronic
1023115001 7:36854171-36854193 CTATGGTGACCTAGCAATGGTGG + Intergenic
1031876931 7:127152281-127152303 CTAAGGGTATATAGCAATGCAGG + Intronic
1032590056 7:133183529-133183551 CTAAGGCTACCTAACAGAGCTGG - Intergenic
1036734931 8:11304626-11304648 CTGGTGATACCTAGCAATGCAGG + Intronic
1043330567 8:79112688-79112710 TTAAGGGTACAAAACAATGCTGG + Intergenic
1185764820 X:2716784-2716806 CTAAGGGCACCTCCCACTGCAGG - Intronic
1187245596 X:17550591-17550613 TTCAGGGTACCTAGCAGGGCTGG - Intronic