ID: 960118208

View in Genome Browser
Species Human (GRCh38)
Location 3:113919178-113919200
Sequence GTGAAAAGGAGTAAAGTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960118200_960118208 27 Left 960118200 3:113919128-113919150 CCAAATTAGGGGTGCTGAGCAGA 0: 1
1: 0
2: 1
3: 5
4: 87
Right 960118208 3:113919178-113919200 GTGAAAAGGAGTAAAGTAGCGGG 0: 1
1: 0
2: 1
3: 16
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960118208 Original CRISPR GTGAAAAGGAGTAAAGTAGC GGG Intronic
900827725 1:4940070-4940092 GTGAAGAGGAGAAAGGCAGCTGG + Intergenic
904881438 1:33700301-33700323 ATAAAAAGGAGTGAAGTGGCCGG - Intronic
905116575 1:35646396-35646418 GTGAAAAGGGATGTAGTAGCTGG + Intergenic
906848008 1:49215580-49215602 GTGAAAAAGAGTACAGAAACTGG - Intronic
908893259 1:68869701-68869723 GAGAAAAGGAGGAAATTACCAGG + Intergenic
909581043 1:77235418-77235440 GTGAGAAGGAGAAGAGTAGAAGG + Intergenic
910083305 1:83369291-83369313 GTTAAAATGAGGAAAGCAGCAGG - Intergenic
911415785 1:97571537-97571559 TTGAAAAGGAGAAAAGTGGAGGG + Intronic
911889547 1:103349868-103349890 GTTAAAAGTAGAAAAGTAGTGGG - Intergenic
913305236 1:117423321-117423343 TTGAAAAGGAATAAAGTTGGAGG - Intronic
914865062 1:151420024-151420046 AAGAAAAGGAATAAATTAGCTGG + Intronic
915606029 1:156951475-156951497 GTGGAGAGGGGTCAAGTAGCTGG + Intronic
915897557 1:159823635-159823657 GTGCACAGGAGTAAATTAGCTGG - Intergenic
916945704 1:169725085-169725107 GTGATAAGAAATAAAGTAACAGG + Intronic
917535425 1:175871178-175871200 GAGAAAAGCAGTAACATAGCAGG + Intergenic
917892050 1:179449457-179449479 ATGAAAAAGAATAAAGTAGGAGG - Intronic
918194893 1:182212096-182212118 GTGAAAAAGAGTGGAGGAGCTGG - Intergenic
918710819 1:187727610-187727632 GATAAATTGAGTAAAGTAGCAGG + Intergenic
919717645 1:200796405-200796427 GTGAAAGGGAACAAAGTAGGAGG - Intronic
921833544 1:219754774-219754796 TTGAAAAGGAATAAAGTTGGAGG + Intronic
922526190 1:226306024-226306046 GTGAAAGGGAGGAAAGTGGCTGG + Intronic
924378849 1:243442209-243442231 GTGAAAAGGATTTTAGTAGAAGG + Intronic
924405237 1:243737593-243737615 GTGAAAAGGAGAAAAGGGACAGG + Intronic
1065255591 10:23863880-23863902 GTGCAGAGGAGTTAAGTAGCTGG - Intronic
1065985139 10:30943302-30943324 GTGTAAGGGAGTAAAGTTGAGGG + Intronic
1066440553 10:35434919-35434941 GTAAAAAGGAGTCGAGAAGCAGG - Intronic
1066566624 10:36728035-36728057 TTGGAAAGGAGTACAGTAGTTGG - Intergenic
1066743574 10:38581561-38581583 GTGGAAAGGAATAGAGTAGAAGG + Intergenic
1067694959 10:48528035-48528057 GAGAAATGGAGTAAAGTGGCAGG - Intronic
1071953158 10:90728019-90728041 GTAAAAAGAAATAAAATAGCTGG - Intergenic
1071958497 10:90784861-90784883 GTGAATAGGAGTTAAGAAACTGG - Intronic
1073150498 10:101308164-101308186 GTGAAATGCAGTAGAGTGGCAGG - Intergenic
1073273037 10:102282966-102282988 GTGAGAGGAGGTAAAGTAGCGGG + Intronic
1073347477 10:102794744-102794766 GTGAAAAAGAAAAAAGTAGGGGG + Intronic
1073669830 10:105575244-105575266 GTGCAAAGGACTAAATTAACTGG + Intergenic
1073835703 10:107438505-107438527 GTGATAAGGAGGAAGGTATCTGG - Intergenic
1074479101 10:113802282-113802304 TTGAAAAGGAGTAAAGGATGTGG + Intergenic
1074632012 10:115268652-115268674 ATGAAAAGAAGTAAAGTTGATGG - Intronic
1075372536 10:121950126-121950148 GTGAAGAGGAGTAAAAAAGGCGG + Intergenic
1076617092 10:131762326-131762348 GTGAAAAGCAGCAGACTAGCTGG + Intergenic
1078460364 11:11510677-11510699 GTGAAAAGTGGCACAGTAGCTGG - Intronic
1080001024 11:27350135-27350157 GGAAAAAGGAGAAAAGTAGAGGG + Intronic
1081336466 11:41872881-41872903 GTGAATAGGAGCATACTAGCAGG - Intergenic
1081644712 11:44781672-44781694 GGGAAAAGGAAAAAAGTTGCTGG - Intronic
1083077413 11:60055428-60055450 GTGACAAGGAGTAAGGAAGTAGG - Intergenic
1083673458 11:64312910-64312932 GTCAAAAGGAGGCAAGAAGCAGG + Intronic
1084092810 11:66889780-66889802 GAGAAAAGGAGAAAAGGACCCGG - Intronic
1085925455 11:81014305-81014327 GTGAAAATGACTAAAATAACAGG + Intergenic
1086043314 11:82503649-82503671 ATTAAAAGGAGTGAAGTAGGAGG - Intergenic
1086945396 11:92839464-92839486 GTGAAAAGGAGCAAAATAAGAGG + Intronic
1088591964 11:111411275-111411297 GTGAACAGGAGGAGAGTAGAAGG - Intronic
1089492361 11:118892039-118892061 GTGGACAGGAGTAGAGAAGCTGG + Intronic
1090191780 11:124776051-124776073 GTGAAACTCAGTAAAGTAGAAGG - Intronic
1091763723 12:3104733-3104755 GTAAATTGGAGTAAAGTTGCTGG - Intronic
1094201773 12:27802278-27802300 GTGAAAAGGAGGAGTGAAGCTGG + Exonic
1097465521 12:59919939-59919961 GTGAGGAGGAGCAAAGTTGCTGG - Intergenic
1100337946 12:93650179-93650201 GAGAAAAGGAGCAGGGTAGCGGG - Intergenic
1100890294 12:99118082-99118104 ATAAAAATGATTAAAGTAGCAGG + Intronic
1100969203 12:100049109-100049131 GGGAAAAGGGGAAAAGTAGTTGG + Intronic
1101213155 12:102554629-102554651 TTGAAATAGAGTAAAGTATCTGG - Intergenic
1101485512 12:105154394-105154416 GAGAAAAGGTGTAAAGAATCTGG + Intronic
1101510402 12:105387815-105387837 GAGAAAGGGAGTAAAGGGGCTGG + Intronic
1104511269 12:129381111-129381133 GAGAAAAGGAGTAAAGGATAGGG + Intronic
1106732148 13:32552433-32552455 GTGAAGAAGAGAAAAGTGGCTGG - Intergenic
1106896754 13:34311276-34311298 GTGAAAGGGGGAAAAGTAACTGG + Intergenic
1108566316 13:51701994-51702016 TTTTAAAGAAGTAAAGTAGCTGG - Intronic
1111523283 13:89432956-89432978 ATGAAAAGTAGTAATTTAGCCGG + Intergenic
1111526159 13:89473785-89473807 ATGAAAAGGACTAGAGAAGCAGG - Intergenic
1113187748 13:107708691-107708713 GAGAAAAGGTATAAAGTAGTTGG - Intronic
1114004714 14:18299971-18299993 TTGGAAAGGAGTACAGTAGTTGG - Intergenic
1114078763 14:19182868-19182890 CTGGAAAGGAGTAAAGAAACAGG - Intergenic
1115128157 14:30021452-30021474 GTGAGAAGTAGTACAGTATCTGG + Intronic
1115597224 14:34921016-34921038 GGGAACTGGAGTAAAGAAGCAGG - Intergenic
1116457769 14:45138904-45138926 GTGAAAAGAAGTAATGTATTTGG + Intronic
1117515382 14:56495392-56495414 GAGAAAAGGAGAAAAGGAGGGGG - Intronic
1117878466 14:60281543-60281565 GTGAAGAGGAGTTAGGTAGTAGG - Intronic
1118082601 14:62378557-62378579 TTGAAAAAGAATAAAGTAGGTGG + Intergenic
1118168509 14:63361515-63361537 GAGAAAAGGAGAGGAGTAGCGGG + Intergenic
1119669778 14:76509645-76509667 GTGGAAAGGAATAAGGTAGGAGG - Intergenic
1120729788 14:87989900-87989922 GTGATAAGGGATAAAGTATCAGG - Intronic
1120991121 14:90378262-90378284 GTGAAAAGGAGTAAATAACAAGG + Intergenic
1121853782 14:97247774-97247796 GTGAAAAGGAGGAAAGGCCCTGG - Intergenic
1122111689 14:99507901-99507923 GAGAAAAGCTGTAAAGTAGATGG + Exonic
1123389176 15:19852217-19852239 TTGGAAAGGAGTACAGTAGTTGG - Intergenic
1126893722 15:53235476-53235498 GTGTAAAGGAGTTAAGAGGCTGG - Intergenic
1127016099 15:54690196-54690218 GGGAAGAGGAGTAACGAAGCAGG + Intergenic
1127833417 15:62770587-62770609 GTGGAAAAGGGTAAGGTAGCAGG - Intronic
1128650448 15:69408578-69408600 GAGAAAAGGTGAAAAGTACCTGG - Intergenic
1129032578 15:72629532-72629554 CTGAAAAGGAGTCAAGGAGGAGG + Intergenic
1129407352 15:75328352-75328374 CTGAAAAGGAGTCAAGGAGGAGG + Intergenic
1130209646 15:81911407-81911429 GTAAAAAGGAGAAATGCAGCAGG + Intergenic
1130448403 15:84026501-84026523 TTGAAAAGGAACAAAGTTGCAGG + Intronic
1132089233 15:98934369-98934391 GTAAAAAGGAGGAGAGTAGTAGG - Intronic
1134321363 16:13167366-13167388 GAGAAGAGGAGTAAAGTGGCCGG - Intronic
1137499495 16:48999399-48999421 GTCCAAAGGAGAAAAGAAGCTGG - Intergenic
1139176547 16:64696238-64696260 GTGAAAAGGAGAAAAAGATCAGG - Intergenic
1139522093 16:67489356-67489378 GAGAAAAGGAATAAAGCAGTTGG - Intergenic
1140536620 16:75715620-75715642 GAGAGTATGAGTAAAGTAGCAGG - Intronic
1140913353 16:79473346-79473368 GTTAAAAGGAGTGAAGTTCCTGG - Intergenic
1144557019 17:16291203-16291225 GTGAAAAGAAGTAAATTATATGG + Intronic
1144670796 17:17131587-17131609 GAGAAAAGGAGACAAGTACCAGG - Intronic
1147644188 17:42024025-42024047 GTGAGAGGGAGCAAAGTGGCTGG - Exonic
1149973173 17:61239165-61239187 GCAAAAAGGAATAAAATAGCAGG + Intronic
1150392427 17:64797849-64797871 GTGGCAAGCAGTGAAGTAGCTGG + Intergenic
1152993298 18:382754-382776 GCAAAAAGGAGAAAAGAAGCAGG - Intronic
1153148574 18:2062511-2062533 GTTAAAAAGGGTAAAGTAGAAGG + Intergenic
1153315064 18:3713181-3713203 GTGAACAGCAGCAAAGAAGCAGG - Intronic
1153661588 18:7330926-7330948 GAGAAAAGGGTTAAAGCAGCAGG - Intergenic
1154532712 18:15363897-15363919 TTGGAAAGGAGTACAGTAGTTGG + Intergenic
1155407593 18:25506280-25506302 TTGACAAGGAGAAAAGTAGCAGG + Intergenic
1155620662 18:27775141-27775163 GTGAACAGGAGAGAAGTAGGTGG - Intergenic
1159049312 18:63403778-63403800 GTGAAATGGAGTGACGTTGCTGG - Exonic
1159642954 18:70885390-70885412 ATGGAAAGGACTACAGTAGCAGG + Intergenic
1159789172 18:72755583-72755605 CTGAAGTGGAGTGAAGTAGCTGG + Intronic
1162201718 19:9025309-9025331 GTAAATAGCAGTAAAGGAGCTGG + Intergenic
1162747034 19:12804497-12804519 GAGAAAAGGAGAAAAGTGGAGGG + Intronic
1164378587 19:27711616-27711638 GTGAAAAGAAGATAAGTAGGGGG + Intergenic
1164805158 19:31110606-31110628 GAGAAGAGGAGAAAAGGAGCCGG - Intergenic
1166834617 19:45659642-45659664 GAGAAAAGGAGTAAAGAGGCAGG + Intergenic
1167436505 19:49481509-49481531 GTGAGAGGGAGGAAAGGAGCTGG + Intronic
926791756 2:16579556-16579578 GTGAAAAGGTGTTAATTTGCAGG + Intronic
927584820 2:24292596-24292618 GTGAAAGGAAGGAAAGAAGCTGG - Intronic
928100556 2:28435031-28435053 GGGAGAAGGAGTCAAGAAGCAGG - Intergenic
929689771 2:44064539-44064561 GTTACAAGGAGTAAAGAAGCAGG + Intergenic
933760072 2:85666865-85666887 GTGCCAAGGAGTTAAGTAGTTGG + Intronic
934546950 2:95225638-95225660 GTGAAAAGGACTAAAGTTTTGGG - Intronic
937381300 2:121379887-121379909 GTGAGAAGGAGGAAATTACCTGG - Intronic
938531809 2:132195124-132195146 TTGGAAAGGAGTACAGTAGTTGG + Intronic
941799592 2:169643329-169643351 TTTTAAAGGAGTAAAATAGCTGG - Intergenic
941854639 2:170218610-170218632 CTGAAATGGAATAAAGTAGTAGG - Intronic
942399299 2:175584451-175584473 CTGACAAGAAGTAAAGTAGTGGG - Intergenic
943670211 2:190651971-190651993 TTGAAAAGGATAAAAGAAGCAGG - Intronic
944829188 2:203515088-203515110 TTGAAAAGTAGGAAAGTAGAGGG + Intronic
945417385 2:209590875-209590897 ATGAAGAGGAGGACAGTAGCAGG - Intronic
947094011 2:226545462-226545484 GTGAAAACCACTAAACTAGCAGG + Intergenic
1169355299 20:4900166-4900188 ATGAAAAGGAGAAATGCAGCTGG - Intronic
1169918530 20:10708081-10708103 GAGAAAAGTGTTAAAGTAGCTGG - Intergenic
1174852872 20:54012989-54013011 GAGAAAAGGAATAAAGTGGCAGG - Intronic
1174970542 20:55270433-55270455 GTGAACAAGAGAAAAGAAGCTGG - Intergenic
1177629354 21:23706443-23706465 GTGAAAAAGAGAAAATTGGCTGG + Intergenic
1177668550 21:24194360-24194382 GGGAAATGAAGTAAAGTTGCTGG + Intergenic
1178205515 21:30459836-30459858 GTGAAAAACAGGAAAGTAGATGG - Intergenic
1180429228 22:15230761-15230783 TTGGAAAGGAGTACAGTAGTTGG - Intergenic
1180511844 22:16099118-16099140 TTGGAAAGGAGTACAGTAGTTGG - Intergenic
1180944959 22:19687744-19687766 GTGCAAAGGGGTAAGGGAGCAGG + Intergenic
1182231569 22:28841221-28841243 GTGAAACGGAATAAATTAGTAGG - Intergenic
949101049 3:145659-145681 GTGAGAAGAGGGAAAGTAGCTGG - Intergenic
949442694 3:4099741-4099763 GATAAAAGCAGTAAAGTTGCAGG + Intronic
949585015 3:5428714-5428736 GAGAAAAGGAAAAAAGCAGCTGG - Intergenic
949969536 3:9392810-9392832 TTGAAAAGGAGATAGGTAGCTGG + Intergenic
950928762 3:16768650-16768672 GTAGGAAGAAGTAAAGTAGCTGG - Intergenic
951689486 3:25380778-25380800 GAGAAGAGGAGGAAATTAGCAGG - Intronic
955033010 3:55238882-55238904 GGGAAAAGGAATCAAGCAGCAGG + Intergenic
955607277 3:60719257-60719279 GTTAAAAGGAAAAAAATAGCAGG - Intronic
957568839 3:81919902-81919924 TTGAAACGGATTAAAGGAGCAGG + Intergenic
959931111 3:111984120-111984142 GAGAAAAGGAGAAAATTAGTTGG + Intronic
960118208 3:113919178-113919200 GTGAAAAGGAGTAAAGTAGCGGG + Intronic
960593591 3:119388610-119388632 GTGGGAAGGAGGAAAGTGGCTGG + Intronic
960729146 3:120705359-120705381 ATGAAAAAGAATAAAGTAGAAGG + Intronic
962865035 3:139441500-139441522 GTGAATAGGAGCAAAATGGCAGG + Intergenic
964412370 3:156411821-156411843 GTGAAAAAGAGTAAAGCTGGAGG - Intronic
964783680 3:160370250-160370272 GTGAATAGAAGTAAAGTACTTGG + Intronic
965279535 3:166731103-166731125 AAGAAAAGGAGGAAAGTAACTGG - Intergenic
965969204 3:174532924-174532946 GAGAAAAGGAGAAAAGGAGGGGG - Intronic
966220694 3:177548351-177548373 GTGAAAAGGAGTAAACAGGAGGG - Intergenic
966402472 3:179562152-179562174 CTAAAAATGAGAAAAGTAGCCGG - Intergenic
966805519 3:183804645-183804667 GTGAAAACTAGTAATGTTGCAGG + Intronic
967106698 3:186260307-186260329 GAGAAAGGGAGTAAAATGGCAGG + Intronic
967237036 3:187395380-187395402 GTGAAAAGGAGTCAAGCTGGTGG - Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
972157452 4:36181952-36181974 GGGAAAGGAAGTAAAGAAGCAGG + Intronic
973912683 4:55597986-55598008 GTTAAAAATAGTAAAGTAGAAGG - Intronic
975718857 4:77231053-77231075 GTGAAGTGTAGAAAAGTAGCAGG + Intronic
978093940 4:104752072-104752094 GAAAACAGGAGTTAAGTAGCAGG + Intergenic
978963856 4:114717802-114717824 GTGAAAAGGAGTACAGTGTTTGG + Intergenic
980030876 4:127828548-127828570 GTGGAAAGCAGTATAGTTGCTGG - Intronic
981651268 4:147061653-147061675 GTGAAAATGAGGAAGGTAACAGG - Intergenic
982283931 4:153715161-153715183 GAGAAAAAGAGTGAAGTATCAGG - Intronic
985320890 4:188709635-188709657 GAGAACAGGAGGAAAGAAGCTGG + Intergenic
987686974 5:21217389-21217411 GTGAAAAGGAATCATGTATCTGG + Intergenic
988048135 5:25986567-25986589 TAGAAATGCAGTAAAGTAGCAGG + Intergenic
988235513 5:28538465-28538487 GTGAAAAGCAATAAAGGAGTGGG + Intergenic
988398666 5:30732049-30732071 GGGTAAAGGAGTTAAGTAGAGGG - Intergenic
988413402 5:30915313-30915335 GGCAAAAGAAGTAAAGTAGATGG + Intergenic
988651640 5:33158221-33158243 ATGAAAAGGGGCAAAGTAGAAGG + Intergenic
989079101 5:37597681-37597703 GTGAAAAGGAGAAAAGGAGCAGG - Intronic
990131268 5:52588338-52588360 GTGAAAATCAGTAAAATAGATGG - Intergenic
990940195 5:61194770-61194792 GTGAAAAAGAGTAAAGGAATTGG - Intergenic
993903454 5:93599276-93599298 GTGAAAAGGAGGAAGGAAGAAGG + Intergenic
994429305 5:99636180-99636202 GTGAAGAGGATTAAAGCAGTCGG + Intergenic
994507370 5:100659154-100659176 GGGAAAAGGAAAAAAGTAGTTGG - Intergenic
995404847 5:111783215-111783237 GAGAAAAGGAGCAAAGGAGCAGG + Intronic
996143731 5:119947585-119947607 GTGGCAAGGAGAAAAGGAGCTGG + Intergenic
996549238 5:124712521-124712543 GTGAGAAGGAGCAGAGTGGCTGG + Intronic
997135065 5:131316609-131316631 GTGAAAAGGAAGAAAATAGATGG + Intronic
998648577 5:144091715-144091737 GAGAGATGGAGAAAAGTAGCAGG - Intergenic
999004145 5:147957505-147957527 ATGAAAAGGGGTAAAGTAAGAGG + Intergenic
1001077088 5:168638026-168638048 GAGAAAAGGATTAAAGAAGTGGG + Intergenic
1003523876 6:6882508-6882530 GAGAAAAGGAGGAAAAGAGCAGG - Intergenic
1005572228 6:27156672-27156694 GTGAAAAAGAATCAAGTGGCCGG + Intergenic
1008443475 6:51559815-51559837 GTGGAAAGGAGTAGGGTGGCAGG + Intergenic
1008444154 6:51569121-51569143 GTGAAAAGATGTAAAGAACCTGG + Intergenic
1008892824 6:56514875-56514897 GTGTAAATGGGTAAAGTAGGAGG - Intronic
1008920385 6:56837768-56837790 GTGAGAAGGTGAAAAGTACCAGG - Intronic
1013023772 6:106248637-106248659 GTGTAAAGAAATAAAGTCGCAGG + Intronic
1015580075 6:134714740-134714762 ATGAAAGGAAGTAAAGTACCTGG + Intergenic
1016000968 6:139040817-139040839 CTGAAAACGAGTAAGGTGGCTGG - Intronic
1016609834 6:145976345-145976367 GTGAAAAGGAATTGAGTAGAGGG - Intergenic
1018702226 6:166436388-166436410 TTGCAAAGGAGTAGAGTGGCTGG + Intronic
1019642545 7:2111960-2111982 GTGAAATGGAGTAAAGCTGCTGG - Intronic
1020415582 7:7942087-7942109 ATGAAAAGGAGTCAGGTAGCTGG - Intronic
1021306753 7:19040991-19041013 GTGAAAAGGAGTAATAAAGTGGG + Intronic
1022443816 7:30453941-30453963 GTAAAAGCTAGTAAAGTAGCTGG + Intronic
1025888002 7:65616775-65616797 GTGAAAAGGTGGAAAGAAGAAGG - Intergenic
1027300136 7:76825433-76825455 GTTAAAATGAGGAAAGCAGCAGG - Intergenic
1027486086 7:78763385-78763407 GTGAAAACGTGAAAAGAAGCTGG - Intronic
1027853891 7:83484326-83484348 ATGACAAGGAGGAAGGTAGCAGG - Intronic
1028003221 7:85528421-85528443 GTGAAAATGAGAAAAGTAGTGGG - Intergenic
1028157474 7:87447904-87447926 GTAGAAAGTAGTACAGTAGCTGG + Intronic
1028391773 7:90325464-90325486 CTGAAAAAGAGTAAAGTCACAGG + Intergenic
1028731224 7:94150649-94150671 GAGAAAAAGAGTAAAATAGTTGG - Intergenic
1029165321 7:98585131-98585153 GAGAAAAGGAGGAAAGGAGGAGG - Intergenic
1029226384 7:99031693-99031715 GTGAAATGGGGTAATGCAGCTGG - Intronic
1030151462 7:106410229-106410251 TTGAAAAAGAATAAAGTAGGAGG + Intergenic
1030653889 7:112145070-112145092 GTAAAAAGGAGGAAAGTTGCAGG + Intronic
1031270226 7:119639571-119639593 GTCAAAAGGACAAAAGGAGCTGG + Intergenic
1032001274 7:128267079-128267101 GGGAAAAGCAGTAAAGAAGCAGG - Intergenic
1032064987 7:128761320-128761342 ATTAAAATGAGTAAAGGAGCTGG + Intronic
1035078435 7:156196901-156196923 GAGAATAGGAGGAAAGGAGCAGG - Intergenic
1035991853 8:4500091-4500113 GTGAAAAGGTATAAAGAGGCTGG + Intronic
1037373904 8:18208408-18208430 GTTAAATCCAGTAAAGTAGCAGG + Intronic
1038439699 8:27562795-27562817 GTGAAAAGGAGTCAATTGGAAGG - Intergenic
1039745509 8:40422546-40422568 GTGAAAATGAGTAAAGGAAAGGG + Intergenic
1040944338 8:52867502-52867524 GAGAAAAAGAATAAAGTAGGAGG - Intergenic
1041082879 8:54230143-54230165 GTGGAAAGGAGAAAATTAACAGG + Intergenic
1041361882 8:57063654-57063676 GTCAAAAGGAGTATACTAGGAGG - Intergenic
1042807575 8:72788450-72788472 GTGAAATGGAGTCATGAAGCTGG - Intronic
1044266129 8:90183800-90183822 TTGAAAAGCAGTCAAGAAGCAGG + Intergenic
1045841427 8:106586509-106586531 GAGAAATGGAATAAACTAGCTGG + Intronic
1047549614 8:125855895-125855917 CTGAAAAGGAGTTAATTAGGAGG + Intergenic
1047849815 8:128844604-128844626 CTGAAAAGAAGAAAAGTAGAGGG - Intergenic
1047853326 8:128882790-128882812 GTTAAAAGGAGAAGAGTAGTTGG + Intergenic
1048301490 8:133254596-133254618 CTGGAAAGGAGTAAAGTGGGTGG + Intronic
1048493116 8:134912989-134913011 GTGAACAGAAGAAAAGTAGACGG + Intergenic
1048738662 8:137530575-137530597 GTGAAAAGCAAAAAAGAAGCAGG - Intergenic
1048808251 8:138261005-138261027 ATAAAAAGCAGTAAAGTAGAAGG - Intronic
1049837006 8:144742674-144742696 GTGCCAAGGAGTAGAGAAGCAGG - Intronic
1049911992 9:277712-277734 GTGAAATGGAATGAATTAGCTGG + Intronic
1050174665 9:2857214-2857236 GTAAAAAGCAGTAAAGAAGGTGG + Intergenic
1050861329 9:10435505-10435527 AGGAAAAAGAGCAAAGTAGCAGG - Intronic
1052897940 9:33765969-33765991 ATAAAAAGGAATGAAGTAGCCGG + Intronic
1053710421 9:40801616-40801638 TTGGAAAGGAGTACAGTAGATGG + Intergenic
1054420329 9:64922405-64922427 TTGGAAAGGAGTACAGTAGATGG + Intergenic
1055633993 9:78256367-78256389 TTGAAAAACAGTAAAGTAACTGG + Intronic
1056058008 9:82849030-82849052 GTTAAAAGAAGTAAAGTAAAAGG - Intergenic
1058089171 9:100784652-100784674 GTGAAATGCAATAAAGCAGCCGG - Intergenic
1058784674 9:108375209-108375231 TTGAAAAGGATTTAAGGAGCTGG - Intergenic
1058852051 9:109022014-109022036 GAGAAAAGGAGTAAGGGAGGGGG - Intronic
1059291453 9:113228378-113228400 CAGAAATGGAGTAAAGTAGCTGG + Intronic
1059697925 9:116746380-116746402 GTGAAAAGGACTCAATTGGCCGG - Intronic
1062181562 9:135193799-135193821 GAGACAAGGACTAAAGTCGCGGG - Intergenic
1203367078 Un_KI270442v1:268432-268454 CAGAAAAGGATTAAAGTAGGAGG - Intergenic
1187767981 X:22664310-22664332 GTGAAAATGAGAAAAATGGCTGG + Intergenic
1187883652 X:23868816-23868838 TTGAAGAGAAGTATAGTAGCAGG - Intronic
1189128433 X:38473510-38473532 GTGAAATTGAGTAAGTTAGCAGG - Intronic
1190028574 X:46949364-46949386 ATAATTAGGAGTAAAGTAGCTGG + Intronic
1190873159 X:54441609-54441631 GTGAGAAGGAGTTAACTAGGTGG + Intronic
1191794601 X:65007551-65007573 GGGAAAAAGAGAAAAGTAACAGG + Intronic
1192120010 X:68446655-68446677 GGGAAAAGGAGTAATGAAGTAGG - Intergenic
1192713963 X:73619347-73619369 GTGAAAAGAAATAGAGTGGCTGG - Intronic
1192833154 X:74771843-74771865 GTGTAAAGAAGTACAGTACCTGG + Intronic
1197323731 X:125066086-125066108 GTGGAAAGGACTCAAGTAACAGG + Intergenic
1197598741 X:128501080-128501102 GAGAAATGGAGTAGAGTAGGTGG - Intergenic
1198422990 X:136486493-136486515 GTGAAAAAGAGCAAAGTATTTGG - Intergenic
1199747833 X:150785241-150785263 GTGAAAAAAATTAAAGAAGCAGG - Intronic
1201744371 Y:17354341-17354363 GGGAAAATGAGGGAAGTAGCTGG + Intergenic