ID: 960119857

View in Genome Browser
Species Human (GRCh38)
Location 3:113936849-113936871
Sequence CCACCACACCTGGCTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2468
Summary {0: 1, 1: 5, 2: 198, 3: 629, 4: 1635}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960119854_960119857 5 Left 960119854 3:113936821-113936843 CCTGAGTAGCTGAGATTACAGGT 0: 2070
1: 39517
2: 162289
3: 257692
4: 208796
Right 960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG 0: 1
1: 5
2: 198
3: 629
4: 1635
960119849_960119857 21 Left 960119849 3:113936805-113936827 CCTCCTGCCTCAGCCTCCTGAGT 0: 4945
1: 11993
2: 28383
3: 42039
4: 82442
Right 960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG 0: 1
1: 5
2: 198
3: 629
4: 1635
960119851_960119857 14 Left 960119851 3:113936812-113936834 CCTCAGCCTCCTGAGTAGCTGAG 0: 5969
1: 105788
2: 209886
3: 237927
4: 149550
Right 960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG 0: 1
1: 5
2: 198
3: 629
4: 1635
960119850_960119857 18 Left 960119850 3:113936808-113936830 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG 0: 1
1: 5
2: 198
3: 629
4: 1635
960119852_960119857 8 Left 960119852 3:113936818-113936840 CCTCCTGAGTAGCTGAGATTACA 0: 3650
1: 63393
2: 151745
3: 233670
4: 198282
Right 960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG 0: 1
1: 5
2: 198
3: 629
4: 1635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960119857 Original CRISPR CCACCACACCTGGCTAAAAT TGG Intronic
Too many off-targets to display for this crispr