ID: 960126568

View in Genome Browser
Species Human (GRCh38)
Location 3:114005153-114005175
Sequence GGTCCACATGGAGCAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960126568_960126570 -5 Left 960126568 3:114005153-114005175 CCAGGGGCTGCTCCATGTGGACC 0: 1
1: 0
2: 2
3: 25
4: 246
Right 960126570 3:114005171-114005193 GGACCTGATGTTGTCTGACTTGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960126568 Original CRISPR GGTCCACATGGAGCAGCCCC TGG (reversed) Intronic
900186755 1:1336478-1336500 GGTCCACCCGGAGCAGCCGCCGG - Exonic
900302610 1:1985677-1985699 TGCCCACATGGCACAGCCCCAGG + Intronic
900531357 1:3155048-3155070 TACCCACATGGAGCACCCCCTGG - Intronic
901634726 1:10665206-10665228 TGTCTACATGGTGCAGCCCCAGG - Exonic
902619965 1:17645060-17645082 GGGACACAGGGAGCAGCTCCAGG - Intronic
902695494 1:18138083-18138105 GGGACACATGCAGCTGCCCCAGG + Intronic
903276949 1:22228460-22228482 TGTCCCCATGGACCAGCCCAGGG - Intergenic
904627451 1:31815015-31815037 GCTCCACATGCAGCTGCCCTCGG - Exonic
905899232 1:41570154-41570176 GCTCCACATGGCCCAGCCCCAGG - Intronic
906633139 1:47389206-47389228 GTTCTCCATGGAGCAGCCACAGG - Intergenic
909245580 1:73278269-73278291 TGTCCACCTGGAGCTGCCCTTGG + Intergenic
912793589 1:112675635-112675657 GGTCTCCATGGAGAAGCCACAGG - Intronic
914765803 1:150636689-150636711 GGTCCCCATGGAGCAGCGGAAGG - Intergenic
916074777 1:161193943-161193965 CCTCCACATGGACCAGCTCCAGG - Exonic
921379752 1:214512343-214512365 GGGCCACATGGAGAAGCAGCAGG - Intronic
922355881 1:224774600-224774622 GGGCCACATGGGGAAGCACCAGG - Intergenic
922481233 1:225941132-225941154 GGGCCACATGGTGCTGCCCTGGG + Exonic
922504567 1:226119059-226119081 GGACAACAGGGAGGAGCCCCAGG + Intergenic
923078269 1:230629505-230629527 GGGCCACATGGGGAAGCACCAGG - Intergenic
923651322 1:235876873-235876895 GGTCCTGGTGGGGCAGCCCCAGG + Intronic
923861180 1:237893599-237893621 GATCCACCTCGAGGAGCCCCAGG + Intergenic
1065773820 10:29101354-29101376 GGTCAGGATGGAGCAGCCACAGG + Intergenic
1067544767 10:47184839-47184861 GGGCCACATCGAGGTGCCCCAGG + Intergenic
1069758655 10:70792097-70792119 GGTGAACATTGAGCAGGCCCCGG - Intergenic
1069858818 10:71457554-71457576 GGTCCACATGGGGCAGGTGCTGG + Intronic
1069955819 10:72050806-72050828 GGTCAGCATGGAGGAGCCCTGGG + Intergenic
1070973969 10:80590075-80590097 GGGCCACATGGGGAAGCCCCAGG + Intronic
1071471833 10:85988935-85988957 GGGCCACATGGGGAAGCCCCAGG + Intronic
1072309187 10:94138227-94138249 GGTCAATATGCAGCACCCCCTGG - Intronic
1073514466 10:104064505-104064527 GGTCCCCATGGAGGACCCCGCGG + Exonic
1075468734 10:122672142-122672164 GATCCACATGGCTCAGTCCCAGG - Intergenic
1077232568 11:1464594-1464616 GCTCCCCATGGAGCAGACCTAGG - Intergenic
1077333687 11:1994231-1994253 GGAACACAAGGGGCAGCCCCTGG - Intergenic
1078508676 11:11969548-11969570 GCTCCACATGTAGCAGCCAGTGG + Intronic
1081160901 11:39747044-39747066 GCTTCACAAAGAGCAGCCCCAGG + Intergenic
1081569456 11:44280508-44280530 GGTCCACAAGGAGCTGCTCCAGG - Intronic
1084558254 11:69888001-69888023 GGGCGGCATGGAGCAGCGCCCGG + Intergenic
1084640632 11:70423860-70423882 GGTCTACTTTGAGAAGCCCCCGG + Intronic
1085028257 11:73252906-73252928 GGTCCACCTGGAGCTGTCACAGG - Intergenic
1085119318 11:73957163-73957185 CTTCCACATGGAGCCGGCCCAGG + Intronic
1088448760 11:109960567-109960589 GGGCCACATGGGGAAGCACCAGG + Intergenic
1089366305 11:117923044-117923066 GGGCTAAAAGGAGCAGCCCCTGG + Intronic
1089515542 11:119029535-119029557 GGTCCCCTTGGAGCCTCCCCAGG - Exonic
1090979426 11:131704277-131704299 GGTCCCCATGGATGAGCCTCGGG - Intronic
1091158613 11:133398276-133398298 GGACCACATTGGGCAGTCCCAGG - Intronic
1091214883 11:133894640-133894662 GGTCCACATGACACAGTCCCAGG - Intergenic
1202816668 11_KI270721v1_random:49413-49435 GGAACACAAGGGGCAGCCCCTGG - Intergenic
1094850139 12:34378688-34378710 GGCCCACAGGGACCAGCCCAAGG - Intergenic
1094852485 12:34388521-34388543 GGGCCACAGGGGGCAGCCCAAGG - Intergenic
1094852628 12:34389083-34389105 GGTCCACAGGGGCCAGCCCAAGG - Intergenic
1094853295 12:34391905-34391927 GGTCCACGTGGGCCAGCCCAAGG + Intergenic
1094855304 12:34400239-34400261 GGCCCACAGGGACCAGCCCAAGG + Intergenic
1094855780 12:34402176-34402198 GGCCCACATGGGCCAGCCCAAGG + Intergenic
1102012743 12:109628644-109628666 GGGCGACATGGAACAGCCCATGG - Intergenic
1103013134 12:117473194-117473216 TGTCCACAGGGGGCAGCACCAGG - Intronic
1104731260 12:131106708-131106730 TGTCCATAGGCAGCAGCCCCAGG - Intronic
1104965550 12:132507434-132507456 GGTGGACATCGGGCAGCCCCAGG - Intronic
1107293788 13:38888343-38888365 GGGCCACATGGAGAAGCACCAGG + Intergenic
1108817748 13:54312994-54313016 GGCCCACATGGTGCAGCGGCGGG - Intergenic
1113635842 13:111918588-111918610 TGTCCACATGGACCTGCGCCTGG + Intergenic
1113803259 13:113097077-113097099 GGGCCGCAGGGAACAGCCCCGGG + Intronic
1114062227 14:19028084-19028106 GGTGGAGATGGAGGAGCCCCTGG - Intergenic
1114100033 14:19371909-19371931 GGTGGAGATGGAGGAGCCCCTGG + Intergenic
1117775050 14:59175024-59175046 GGTACACACGGAGCACCCTCTGG + Intergenic
1118316004 14:64726554-64726576 GGCCCACCTGGAGCAGCCGGGGG - Intronic
1119001369 14:70884942-70884964 GGTCCACATGGTTCTGCCCGTGG - Intergenic
1120260212 14:82174954-82174976 AGTACATATGGAGCAGCCACTGG + Intergenic
1120812915 14:88823420-88823442 GGTCCTAATGAAGCAGCCCATGG - Intergenic
1121521087 14:94586740-94586762 GGGTGGCATGGAGCAGCCCCTGG + Intronic
1121730159 14:96181153-96181175 GGTACAGAAGGAGCAGCCCAGGG - Intergenic
1122986958 14:105216896-105216918 GGGACACATGGACCAGCCACAGG + Intronic
1123494586 15:20813382-20813404 GGTGGAGATGGAGGAGCCCCTGG + Intergenic
1123551081 15:21382475-21382497 GGTGGAGATGGAGGAGCCCCTGG + Intergenic
1124103300 15:26715088-26715110 GGTCCTCAAGGAGCTGCCCATGG - Intronic
1125728479 15:41880195-41880217 GCTCCAAAGGGTGCAGCCCCAGG - Exonic
1129045747 15:72732754-72732776 GGGCCACATGGGGAAGCACCAGG + Intronic
1129937597 15:79463739-79463761 TTTCCATACGGAGCAGCCCCAGG + Intronic
1130107164 15:80937525-80937547 GTTCCATATGCAGCACCCCCAGG + Intronic
1132116334 15:99138833-99138855 GGTCCGCAGAGAGCAGCCCCAGG - Intronic
1202959423 15_KI270727v1_random:109718-109740 GGTGGAGATGGAGGAGCCCCTGG + Intergenic
1132552414 16:559045-559067 GGTCCATGAGGAACAGCCCCTGG - Intergenic
1132725863 16:1338135-1338157 GGTCCTCTTGATGCAGCCCCAGG + Intronic
1133356120 16:5138207-5138229 GGACCACATGCCCCAGCCCCAGG - Intergenic
1133977430 16:10609362-10609384 GGGCCTCATGGAGCTGACCCTGG + Intergenic
1136882741 16:33913005-33913027 TGTGCTCCTGGAGCAGCCCCTGG - Intergenic
1141155292 16:81592975-81592997 GGTCCCCAGGGTGCAGCCCTTGG - Intronic
1141970307 16:87477392-87477414 CGCGCACATGGGGCAGCCCCGGG + Intronic
1142269514 16:89081873-89081895 GGGCCACAGGGAGCAGCTGCAGG - Intergenic
1142521957 17:511131-511153 GGACCAACTGGAGCAGCCACTGG - Exonic
1144079239 17:11747558-11747580 GGTCCAGCTGGAGGAGCTCCTGG + Exonic
1145992203 17:29085935-29085957 GGTCCACCTAGGGCAGCCCTGGG + Intronic
1146910616 17:36646313-36646335 TGCCCAGATGGAGCGGCCCCAGG - Intergenic
1147179305 17:38674487-38674509 GGTCTCCATGGAGCAGCCTGAGG + Exonic
1148593488 17:48834193-48834215 TGTCCTCATGGAACAGCCCTGGG + Intronic
1148735149 17:49860970-49860992 GGTCCCCATGGAGTAACCCCTGG + Intergenic
1149569982 17:57665562-57665584 GGTCCTCAAGGGGCTGCCCCTGG + Intronic
1149624005 17:58066867-58066889 TCTCCACATGGAGCAGCCCAGGG + Intergenic
1149869821 17:60171361-60171383 CATCCATAGGGAGCAGCCCCAGG - Intergenic
1151757558 17:76083327-76083349 GGTACACATGGAGCAGCAGTGGG + Exonic
1152660749 17:81540854-81540876 GGTACACCTGTAGCAGCCTCTGG + Exonic
1152854800 17:82658629-82658651 GGTGCCCACGGAGCAGGCCCAGG - Exonic
1153535650 18:6098861-6098883 CTTCCACATGGAGATGCCCCCGG - Intronic
1154451985 18:14485899-14485921 GGTGGAGATGGAGGAGCCCCTGG + Intergenic
1155179766 18:23334297-23334319 GCTGCACAAGGAGCAGGCCCAGG - Intronic
1155184614 18:23376421-23376443 GGACAACATGGAGCAGCCTGAGG + Intronic
1155233017 18:23793013-23793035 GGGCCACATGGAGAAGCATCAGG + Intronic
1155780523 18:29826882-29826904 GGACCACAAGCAGCAGACCCTGG + Intergenic
1156182915 18:34626786-34626808 TGTCCACATGTGACAGCCCCAGG - Intronic
1160973499 19:1780733-1780755 GGGCCACGAGGAGGAGCCCCAGG - Exonic
1160987203 19:1844565-1844587 GGCGCTCAGGGAGCAGCCCCAGG - Intronic
1161535506 19:4816613-4816635 GGCACAGATGGAGCAGCTCCAGG - Exonic
1161550801 19:4910981-4911003 GCTCCACGTGGAACAGCTCCTGG - Exonic
1161849763 19:6732241-6732263 GGTGCGGATGGAGCAGCCTCCGG - Exonic
1161945730 19:7435404-7435426 GGGCCACATGGGGAAGCACCAGG + Intronic
1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG + Intronic
1163557009 19:17998645-17998667 GGTGGGCATGGAGCAGCCCGGGG + Exonic
1163840193 19:19603128-19603150 GGGCCACATGGGGAAGCACCTGG - Intronic
1164672768 19:30082361-30082383 GGGCCACGTGGGGCAGCACCAGG + Intergenic
1164699940 19:30278171-30278193 GGATCACATGGAGAAGCACCAGG + Intronic
1165766087 19:38352140-38352162 GGGACACATGTAGCTGCCCCAGG - Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167618061 19:50547065-50547087 GGTCCCCATGCACCTGCCCCCGG - Intronic
1168413855 19:56156777-56156799 GGGGAGCATGGAGCAGCCCCGGG - Intronic
925003341 2:423611-423633 GGTGCACACGGAGCTGTCCCTGG + Intergenic
925183329 2:1830886-1830908 GGTGCAGAGGGAGCAGCTCCAGG - Intronic
927841958 2:26450383-26450405 GATCCATATGGAGCAGCTCCTGG + Intronic
929040335 2:37738390-37738412 GGTCCACACGGGGAAGCACCAGG + Intronic
932794553 2:74683016-74683038 GGGCCACATGGGGAAGCACCAGG - Intronic
933713722 2:85345345-85345367 GCTCCTCAGGGAGCAGCTCCCGG + Intronic
933839587 2:86275709-86275731 GGGCCACATGGGGAAGCACCAGG - Intronic
935636892 2:105255897-105255919 GGGCCACATGGAGAGGCACCAGG - Intergenic
937888081 2:126914143-126914165 TGTCCCCAGGGAGCAGACCCAGG - Intergenic
938012698 2:127841557-127841579 TGTCCCCAGGCAGCAGCCCCAGG - Intergenic
938340242 2:130531359-130531381 GGGCCACATGGGGCAGCCCCAGG + Intergenic
938340295 2:130531576-130531598 GGGCCACATGGAGAGGCACCAGG - Intergenic
938349541 2:130589172-130589194 GGGCCACATGGAGAGGCACCAGG + Intergenic
938349594 2:130589389-130589411 GGGCCACATGGGGCAGCCCCAGG - Intergenic
938479592 2:131648269-131648291 GGTGGAGATGGAGGAGCCCCTGG - Intergenic
938663345 2:133509447-133509469 GGCCCACATGCAGCAGGCCCAGG - Intronic
939090303 2:137772605-137772627 GGTCCACATGAGGAAGCACCAGG + Intergenic
939964862 2:148600198-148600220 GGTCCAAGTAGAGCAGCTCCAGG + Intergenic
942252545 2:174059781-174059803 GGGCCACATGGGGAAGCACCAGG - Intergenic
943685890 2:190818023-190818045 GGGCCACATGGAGAAGCACCTGG + Intergenic
945630731 2:212272530-212272552 GTTCCATATGAAGTAGCCCCAGG + Intronic
946054299 2:216887455-216887477 TGTCCACAGGGAGCAGGGCCAGG - Intergenic
946329287 2:219000624-219000646 GCTCTTCGTGGAGCAGCCCCAGG - Intergenic
946361439 2:219221281-219221303 GCTCCACAAGCAGCAGGCCCAGG - Exonic
1168908200 20:1423563-1423585 GGCCCACATGGGCCAGGCCCAGG + Intergenic
1169096010 20:2899383-2899405 GGACCACATGGGGAAGCACCAGG + Intronic
1170116819 20:12869334-12869356 GGGCCACATTGAGGAACCCCAGG + Intergenic
1171182389 20:23100350-23100372 GGTCCACGAGACGCAGCCCCTGG - Intergenic
1171359039 20:24573788-24573810 GTTCCACATAGGGCTGCCCCAGG + Intronic
1171418225 20:24998242-24998264 GGACCACAGGGAGCCACCCCTGG - Intergenic
1172126218 20:32626808-32626830 GGTCCTCTTGGAGCAGGCCTTGG - Intergenic
1172242929 20:33425332-33425354 GCTCCACACTGAGAAGCCCCAGG - Intronic
1172523119 20:35582137-35582159 GCTCGAGGTGGAGCAGCCCCAGG - Intergenic
1173251692 20:41366970-41366992 GTTCCAAAGGGAGCAGCCCCAGG + Intergenic
1174485943 20:50861369-50861391 GCTCCACACGGTGCAGGCCCTGG - Intronic
1175234643 20:57501652-57501674 GGGCCGGATGGAGAAGCCCCAGG + Intronic
1175757743 20:61540126-61540148 GGTCCTCCTGGAGCAGGGCCTGG + Intronic
1175780577 20:61679814-61679836 ATTCCACCTGGAGCAGACCCCGG + Intronic
1176168096 20:63685074-63685096 GGGCAACATGGTGCAACCCCAGG - Intronic
1176289166 21:5035160-5035182 CGTCCACACCGAGGAGCCCCCGG + Intronic
1176382806 21:6121441-6121463 AGTCCCCCTGCAGCAGCCCCAGG - Exonic
1176444037 21:6802401-6802423 GGTGGAGATGGAGGAGCCCCTGG - Intergenic
1178052543 21:28763877-28763899 GGACCACATGGAGCAGACTAGGG + Intergenic
1179489071 21:41728501-41728523 GGTATGCAGGGAGCAGCCCCAGG - Intergenic
1179740663 21:43416798-43416820 AGTCCCCCTGCAGCAGCCCCAGG + Exonic
1179800500 21:43809604-43809626 GGTAAGCAGGGAGCAGCCCCCGG + Intergenic
1179868069 21:44228444-44228466 CGTCCACACCGAGGAGCCCCCGG - Intronic
1180480718 22:15750710-15750732 GGTGGAGATGGAGGAGCCCCTGG - Intergenic
1180975411 22:19845309-19845331 GGTCCACCTGCAGCACCCACAGG - Intronic
1181179039 22:21054525-21054547 TGCCCACAGGGAGCTGCCCCTGG - Intronic
1181617337 22:24064034-24064056 GGGAGACATGGAGCAGGCCCTGG + Exonic
1181844282 22:25694143-25694165 GGGCCACATACAGCAGCCACTGG - Intronic
1183184112 22:36282116-36282138 GGTCCAGAAGGAGCAGGCCCTGG - Exonic
1183587829 22:38763100-38763122 GGTGCCCATGAACCAGCCCCTGG + Intronic
1184047619 22:41981319-41981341 TGCCAAGATGGAGCAGCCCCTGG + Intronic
1184449334 22:44573687-44573709 GGTGGACACGGAGAAGCCCCTGG - Intergenic
1184654144 22:45932679-45932701 TGTCCACATGGACCAGGCGCTGG - Intronic
949870479 3:8583733-8583755 GGGCCACATGGGGAAGCCCCAGG - Intergenic
950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG + Intronic
950153208 3:10704081-10704103 GGGCCACATGGGGAAGCCCTAGG - Intronic
950176787 3:10880646-10880668 GGACTAGATGGAGCAGCCCTGGG - Intronic
952750699 3:36822539-36822561 AGGCCACATAGAGGAGCCCCAGG - Intergenic
954462422 3:50634900-50634922 TGCCCCCATGGAGCAGCCTCTGG - Intronic
956384506 3:68702554-68702576 TGTCCACATGGAGCTTCCACGGG + Intergenic
956510174 3:69985134-69985156 GGGCCACATGGGGAAGCACCAGG + Intergenic
960126568 3:114005153-114005175 GGTCCACATGGAGCAGCCCCTGG - Intronic
960263386 3:115593378-115593400 GGGCCACATGGGGAAGCACCAGG + Intergenic
961866170 3:129954928-129954950 GGTCCACATTCTGCAACCCCTGG - Intergenic
966911190 3:184561424-184561446 GGGCCACATGGGGGCGCCCCCGG + Intronic
968284354 3:197499326-197499348 GTTCCACGTGGAGCAGCGCTTGG + Intergenic
968452802 4:683125-683147 GGACCACATGGTGCAACCCCAGG + Intronic
969311252 4:6354073-6354095 GGTTCAGATGGAGGAACCCCAGG - Intronic
969867755 4:10086599-10086621 GGCCAGCCTGGAGCAGCCCCCGG - Intronic
970422095 4:15914883-15914905 GGGCCACATGGGGAAGCACCAGG + Intergenic
976848732 4:89520177-89520199 ACTCCACAGGGAGCAGACCCTGG - Intergenic
980963404 4:139498522-139498544 GGGCCACATGGGGAAGCACCAGG - Intronic
981081562 4:140643378-140643400 GGTGGCCATGGAGCTGCCCCAGG - Intronic
982172888 4:152678836-152678858 GGACCACATGGAGAACACCCAGG + Intronic
983816011 4:172127392-172127414 GGCCCACATGCAACAGCCGCAGG + Intronic
984957311 4:185058307-185058329 GTTCCAGAGGGAGCAGCCTCTGG - Intergenic
990348817 5:54895304-54895326 CTTCCCCATGAAGCAGCCCCAGG + Intergenic
991395259 5:66198321-66198343 GGCCCACAAGGAGCAGTGCCAGG + Intergenic
991616583 5:68503045-68503067 AGTCCATATGGACCAGCTCCTGG + Intergenic
998260981 5:140631870-140631892 GGGCCCCTTGGAGCAGCACCAGG + Exonic
998857280 5:146405597-146405619 GGACCACATGGGGAAGCACCAGG + Intergenic
1001024190 5:168209569-168209591 GGTGCACTTGGAGTAGCCACAGG - Intronic
1002111106 5:176913539-176913561 AGTCCACATGGGGTAGCCCATGG - Intronic
1003016700 6:2473872-2473894 GCTCCACATCAAGCAGACCCAGG - Intergenic
1003442921 6:6159904-6159926 GGCCCACCTGGAACAGCTCCAGG - Intronic
1004086919 6:12458646-12458668 TGGCCCCATGGAGCAGCCCCTGG + Intergenic
1005418595 6:25626919-25626941 GGGCCACATGGAGAAGCAGCAGG + Intergenic
1007881261 6:45169969-45169991 GATCCACAGGGCACAGCCCCAGG + Intronic
1010055457 6:71558896-71558918 GGACCACATGCAGAAGCACCAGG + Intergenic
1011628499 6:89302499-89302521 GGTCCGCATTGAGCTGGCCCGGG - Intronic
1016352214 6:143180166-143180188 GGTCCACATGTTGCAGGCCATGG - Intronic
1017112688 6:150947768-150947790 TGGCCACATAGAGCAGCCCAAGG + Intronic
1017206373 6:151808008-151808030 GATCCCCCTGGAGCGGCCCCTGG + Exonic
1017308793 6:152952700-152952722 GGTCAACATGGTGAAACCCCAGG + Intergenic
1017946294 6:159099006-159099028 GGTCTCCATGGAGCAGGGCCCGG - Intergenic
1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG + Intronic
1018917951 6:168149164-168149186 GGGGAACATGGAGCAGCCGCTGG + Intergenic
1019811639 7:3169289-3169311 GGGCCACACAAAGCAGCCCCGGG - Intronic
1020838469 7:13184661-13184683 GGGCCACATGGGGAAGCCCCAGG + Intergenic
1022523208 7:31020938-31020960 GTTCCACCTGGAGCTGCCTCTGG - Intergenic
1022962962 7:35447619-35447641 GGCCAACATGGTGAAGCCCCGGG - Intergenic
1023602250 7:41891644-41891666 GGTGCAGATGGAGCAGCACAAGG - Intergenic
1023810394 7:43906728-43906750 GGTCCTCTCGGAGCAGCCCGGGG + Exonic
1023999486 7:45181300-45181322 AGGCCACATGGAGAAGCCCACGG - Intronic
1024934460 7:54698553-54698575 CATCCACCTGGAGCAGCACCTGG - Intergenic
1026947868 7:74327830-74327852 GCTCCCCATGGAGAAGCCCGTGG - Intronic
1033529904 7:142251351-142251373 AGTCCACTTGTAGCAGCCACAGG + Intergenic
1034343068 7:150370175-150370197 GCTGAACATGGGGCAGCCCCTGG + Intronic
1038428520 8:27481243-27481265 GGGCCACACAGAGCAGCACCAGG + Intergenic
1041967334 8:63694448-63694470 TTTCCACATGCTGCAGCCCCTGG - Intergenic
1042191855 8:66195036-66195058 GGTCCGCTGGGAGCAGCCCAAGG + Intergenic
1044517371 8:93155052-93155074 GGTGCACATGGAGAAGCACCAGG + Intronic
1045098793 8:98825525-98825547 GGCCGCCATGGAGCAGCCGCCGG - Intronic
1047497169 8:125416701-125416723 GCCCCCCATGGACCAGCCCCTGG - Intergenic
1049316275 8:141970250-141970272 GGGCCACAGGGAGGAGGCCCTGG - Intergenic
1049483660 8:142840149-142840171 CTGCCACATGAAGCAGCCCCAGG + Intronic
1049554549 8:143275458-143275480 GCTCCTCATGGGGCTGCCCCAGG - Intronic
1049627789 8:143633813-143633835 GGTCCACATGGGCCAGGCACTGG + Intergenic
1050203938 9:3177825-3177847 GGGTCACATGGAGAAGCACCTGG - Intergenic
1050426724 9:5519050-5519072 GGGCCACATGGGGAAGCACCAGG + Intronic
1053514314 9:38717024-38717046 GGTCTAAATGGAACAGCCCCCGG + Intergenic
1054472025 9:65546425-65546447 TGTCCACTTGCAGGAGCCCCAGG + Intergenic
1057268033 9:93631686-93631708 AGGCCCCATGGGGCAGCCCCAGG - Intronic
1057335276 9:94150382-94150404 GGGCCACATGGGGAAGCCCCAGG + Intergenic
1057719324 9:97519491-97519513 GGCCCACCTGCAGCAGCTCCTGG - Intronic
1058679755 9:107430657-107430679 GGTTCTCATAGTGCAGCCCCTGG - Intergenic
1059561441 9:115338570-115338592 GGACAACATGGAGAATCCCCCGG - Intronic
1060520740 9:124292574-124292596 GGACCAAGTGGAACAGCCCCGGG - Intronic
1060664056 9:125422494-125422516 GGGCCCCATGGAGAAGCTCCAGG + Intergenic
1060939443 9:127535208-127535230 GGCCCTCACGGAGCAGGCCCTGG + Intronic
1061130595 9:128705798-128705820 GCTCCACATGCAGCTGCCTCCGG - Exonic
1061208905 9:129179428-129179450 GGTCCAGATAGAGCGCCCCCAGG - Intergenic
1061272825 9:129553308-129553330 GGACCAGATGGAGCAACCCCTGG + Intergenic
1061873848 9:133534435-133534457 TGTCCAGACGGAGCAGCCGCTGG - Intronic
1062049391 9:134439269-134439291 GGTCCCCAGGAAGCAGCCACTGG - Intronic
1062217468 9:135397049-135397071 GGTCCACAGGGACCACCCCCAGG + Intergenic
1062392060 9:136337800-136337822 GGTGGTCATGGCGCAGCCCCGGG - Intronic
1062610286 9:137370417-137370439 TGTCCTCATGGCCCAGCCCCGGG - Intronic
1203525162 Un_GL000213v1:82126-82148 GGTGGAGATGGAGGAGCCCCTGG + Intergenic
1186649241 X:11541160-11541182 GGGCCACATGGGGAAGCACCAGG + Intronic
1189988670 X:46575041-46575063 GGTCCTCATAGCGCAGCCTCAGG - Exonic
1193984107 X:88219478-88219500 GGTCCAAATGGAACAGCAGCCGG - Intergenic
1195239591 X:102937723-102937745 GGTGCCCAGGGAGCAGGCCCAGG + Exonic
1195298117 X:103500330-103500352 GGTGCCCAGGGAGCAGGCCCAGG - Exonic
1199659817 X:150037809-150037831 GGGCCACATGGGGAAGCACCAGG - Intergenic
1200145310 X:153923320-153923342 GGTCCCCATGCAACAGCCCCTGG - Intronic
1201323966 Y:12733699-12733721 GGTCAACATGGTGAAACCCCTGG - Intronic