ID: 960132123

View in Genome Browser
Species Human (GRCh38)
Location 3:114068381-114068403
Sequence GTTGGATTTTTAACAACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960132123 Original CRISPR GTTGGATTTTTAACAACTTC AGG Intronic
900340571 1:2186768-2186790 GTTTGCTTGTTAACCACTTCTGG - Intronic
902041584 1:13496506-13496528 GTTGGAGTGTTAGCAACTTGAGG - Intronic
902090133 1:13896592-13896614 GTAGGATTTTTAAAAATTACAGG - Intergenic
902465625 1:16616230-16616252 GTCTAATGTTTAACAACTTCTGG - Intergenic
909179675 1:72406038-72406060 TTTGCATTTTGAAGAACTTCAGG + Intergenic
911032099 1:93500215-93500237 GTTGGATTTTTTGTCACTTCAGG - Intronic
911635564 1:100231747-100231769 AATTGATTTTTAACAACTTTTGG - Intronic
911640504 1:100283470-100283492 TTTGGATTTTTAAAAAATTTTGG - Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
913676076 1:121141815-121141837 GTTGGATTTTTATTACCTTCAGG + Intergenic
914027969 1:143929759-143929781 GTTGGATTTTTATTACCTTCAGG + Intergenic
915801573 1:158799041-158799063 ATTGGTGTTTTAATAACTTCAGG - Intergenic
918472575 1:184889355-184889377 ATTGGATTTTTATCTAGTTCTGG - Intronic
920463446 1:206160653-206160675 GTTGGATTTTTATTAACTTCAGG + Intergenic
921996134 1:221420238-221420260 AGTGGATTTTTAACAACCTTTGG - Intergenic
924027387 1:239849026-239849048 TATGGATTTTTAACAATTTATGG + Intronic
924178710 1:241419461-241419483 ATTGGTTTTTTAAAAATTTCAGG - Intergenic
1063928754 10:11007969-11007991 GTTGGATTATTACCAGCTCCCGG + Intronic
1064680168 10:17803395-17803417 GTTGGATTTTTAAAAAAGTTTGG + Intergenic
1066401845 10:35084401-35084423 GTTGGATCTGTAGAAACTTCCGG - Intronic
1067916578 10:50406422-50406444 GATGGATTTTCAGCAAGTTCTGG + Intronic
1070352609 10:75607922-75607944 AATGGATTTTTAACCACTCCAGG - Intronic
1071745195 10:88410572-88410594 GTTGGAGTTTTAACAAAGTTAGG - Intronic
1072047177 10:91668705-91668727 GTTCTATTTTTAACTACTTTAGG + Intergenic
1074535166 10:114323822-114323844 GGTAGATTTTTAACAGCTCCTGG + Intronic
1074902617 10:117832203-117832225 TTTGGATTTTTCAAAAATTCAGG + Intergenic
1075165017 10:120060044-120060066 GTTGTATTTTTAAAAACTCAAGG - Intergenic
1075356798 10:121785699-121785721 TTTAGATTTTTAGCAACTGCTGG + Intronic
1075477119 10:122745547-122745569 GTTGGGTGGTTAACATCTTCCGG - Intergenic
1077748143 11:4932096-4932118 GTTCCATTTTGAACAACTTCTGG + Intronic
1078283006 11:9921368-9921390 TTTGTATATTTAACAAGTTCTGG - Intronic
1078913200 11:15752463-15752485 TTATGATTTTAAACAACTTCTGG + Intergenic
1079372768 11:19865714-19865736 GTTCTAGTTTTAACATCTTCTGG + Intronic
1079678999 11:23269026-23269048 TTTTGTTTATTAACAACTTCTGG - Intergenic
1080236475 11:30074586-30074608 GTTCTATTTTTAACTTCTTCAGG + Intergenic
1081273545 11:41118320-41118342 GTTGGATGTCTGACAACTTTTGG - Intronic
1081320164 11:41682356-41682378 GTTGTATTTTTAAAAACTTCTGG + Intergenic
1081699843 11:45146229-45146251 TTTGGATTTTTAACCCTTTCAGG - Intronic
1083512593 11:63225582-63225604 GTTGGATTATTAATACCTTGAGG + Intronic
1085431141 11:76449816-76449838 GTTGGATTTTAATCACCTTGAGG + Intronic
1085734348 11:79026234-79026256 GTTACATTTTTAACTATTTCTGG - Intronic
1086857201 11:91879067-91879089 GTTGTATTTTTCACACTTTCTGG + Intergenic
1092245967 12:6864375-6864397 ATTACATTTTTAACAAGTTCTGG - Intronic
1092402897 12:8192313-8192335 GTTGGATTTTTTACAGTTTTGGG + Intergenic
1093124250 12:15308779-15308801 GTTGGTTGTTTAAAAAATTCTGG + Intronic
1093187010 12:16031532-16031554 TATGCATTTTTAACAACCTCTGG + Intronic
1096299193 12:50411003-50411025 TTCTGATTTTTGACAACTTCGGG + Intronic
1097350712 12:58545687-58545709 GTTTGATTATTGACAACTCCAGG + Intronic
1097490437 12:60262268-60262290 TTTGAATTTTGAACAACTTTTGG - Intergenic
1098661226 12:73096422-73096444 ATTGGATTTTTAATAAGTTTGGG - Intergenic
1099059808 12:77893193-77893215 TTTGAATTTTTAACAACCTCAGG + Intronic
1099193474 12:79585553-79585575 GTTTAATTTTTAAAAACTTGTGG - Exonic
1101284818 12:103300504-103300526 TTTGCATTTTTAATAAATTCAGG + Intronic
1102836642 12:116068758-116068780 GTTAGAATCTTAACAATTTCAGG - Intronic
1106527825 13:30558785-30558807 TTTGCATTTCTAACAAGTTCAGG - Intronic
1109081634 13:57909968-57909990 CCTGGATTCTTAACAACTTAGGG - Intergenic
1109104219 13:58229352-58229374 GTTGGTTTCATAACAACATCTGG - Intergenic
1110186384 13:72680267-72680289 GTTGAATTTTTAAAACCTTTAGG - Intergenic
1112773241 13:102814870-102814892 TTTGTATTTTTAACAAAGTCAGG - Intronic
1113250719 13:108449531-108449553 GTTGGATTGTTGACAGCCTCCGG + Intergenic
1115179379 14:30604555-30604577 TTTGCATTTCTAACAAGTTCTGG + Intronic
1116592809 14:46801172-46801194 TTTTAATTTATAACAACTTCAGG + Intergenic
1118674122 14:68164450-68164472 GTTTGTTTTTTAAGGACTTCAGG - Intronic
1120085339 14:80265770-80265792 TTTGGATTTTTAAAAAATTTTGG + Intronic
1120510218 14:85404314-85404336 ACTGGATTTTCAGCAACTTCAGG - Intergenic
1120800511 14:88683140-88683162 ATTAGATTTTTTACAAATTCTGG - Intronic
1120815234 14:88849938-88849960 GTTATAGTTGTAACAACTTCAGG - Intronic
1121065172 14:90956740-90956762 TTTGGGTTTATACCAACTTCTGG + Intronic
1125053002 15:35323156-35323178 ATTGGATTTTTAAAAACTTAAGG + Intronic
1126307363 15:47275376-47275398 GTTGCATTTTTTACAAATTGAGG + Intronic
1127329489 15:57924488-57924510 TTTGTATTTTAAATAACTTCAGG + Intergenic
1127832974 15:62767059-62767081 ATTGGATTTTTAACCACCTTGGG + Intronic
1128038236 15:64545915-64545937 GTTGGATCATTTCCAACTTCTGG + Intronic
1133820094 16:9228272-9228294 GTTTGTTTTTTAAAAAATTCTGG + Intergenic
1133891242 16:9881222-9881244 GTTGCATCTTGAATAACTTCTGG - Intronic
1137002721 16:35244564-35244586 GTTGGATTTCTTACAAATTGAGG + Intergenic
1138666823 16:58576996-58577018 GTTGGATGTATCACTACTTCTGG + Intronic
1144081009 17:11763885-11763907 GTTTGAGTTTGAACAACTGCTGG + Intronic
1145186502 17:20799174-20799196 GTTAGATTTTTATCTACTTTTGG + Intergenic
1147878203 17:43636677-43636699 GGAGGATTTTTACCAACTTGAGG + Intergenic
1148677824 17:49455362-49455384 GTTGGATTTCCAACAACATCTGG - Intronic
1153566082 18:6418832-6418854 GTTGGATTTTTAAAAATTCAAGG - Intergenic
1154433029 18:14322954-14322976 GTTGGATTTTTAACTCCTATGGG + Intergenic
1155212406 18:23613470-23613492 TTTGGCTTTTTAAAAACTCCTGG - Intronic
1155212525 18:23614360-23614382 TTTGGCTTTTTAAAAACTCCTGG - Intronic
1155354408 18:24937484-24937506 GTCGGGTTTTGAATAACTTCAGG - Intergenic
1157453613 18:47806754-47806776 GTTGTATATTCAACAACTTCTGG + Intergenic
1158042697 18:53115575-53115597 CTTGTATTTTTTACAACTACTGG - Intronic
1159734254 18:72074672-72074694 GTTTAATTTTAAACAATTTCTGG - Intergenic
1161198998 19:3004010-3004032 GTTTGATTTTTAAAAGATTCAGG + Intronic
1163178267 19:15580874-15580896 GGTGAAAATTTAACAACTTCTGG - Intergenic
1166754521 19:45182168-45182190 TTTGTATTTTTAATAACTACAGG - Intronic
926177529 2:10609125-10609147 GCTGGATTTTAAACTTCTTCAGG - Intronic
926493888 2:13559677-13559699 GTTGTATTATTAACAGCTTCAGG + Intergenic
927856476 2:26530796-26530818 TTGGGATTTTTAAAAGCTTCTGG - Intronic
928954240 2:36845482-36845504 GGTGGAATTTTAACTAGTTCAGG + Exonic
931297745 2:60945857-60945879 GCTGCATTTTTACCAAATTCTGG - Intronic
933024410 2:77236992-77237014 GTTGTATCTTTGACAACTTTTGG + Intronic
933031303 2:77332301-77332323 GTTGGGTATTTTAGAACTTCTGG + Intronic
933428230 2:82140783-82140805 GTTGAATTTTTAAAAACTTATGG - Intergenic
938923034 2:136012695-136012717 GTTAGATTTTGAACAACTTGAGG + Intergenic
941282126 2:163565485-163565507 ATGGGATTTTTAATAACTGCTGG - Intergenic
941386243 2:164856057-164856079 GTTGCATTTTTTACAAATTGAGG - Intergenic
941848670 2:170157845-170157867 CCTGGATTTTTAATAACTTAAGG + Intergenic
942778712 2:179615379-179615401 CATGCATTTTTAACAAGTTCTGG - Intronic
942861595 2:180619579-180619601 GTTAAATTTTTAATAACTTATGG + Intergenic
943075462 2:183188867-183188889 GATGGACTTTTAACTTCTTCAGG - Intergenic
943869452 2:192975222-192975244 TTTGTCTTTTTAACAAGTTCTGG - Intergenic
943872377 2:193016883-193016905 TTTGGTATTTTAACAGCTTCAGG - Intergenic
944326834 2:198415691-198415713 GTTGGATATTTAAGTTCTTCTGG + Intronic
945105380 2:206307771-206307793 TTTTGATTCTGAACAACTTCAGG + Exonic
946794973 2:223340804-223340826 TTTGGATGGTTAAAAACTTCGGG - Intergenic
946824719 2:223665520-223665542 GTTGGTTGTTTGACCACTTCTGG - Intergenic
947987876 2:234464572-234464594 GTTGGACTTTTAATAGATTCGGG - Intergenic
948024029 2:234762579-234762601 ATTAAATTTTTAACAATTTCTGG + Intergenic
1169767461 20:9162946-9162968 TTTGTATTTTTACCAATTTCTGG + Intronic
1169854984 20:10092631-10092653 TTTGCATTTCTAACAAGTTCTGG + Intergenic
1172052611 20:32130341-32130363 TTTTGTTTTTTAACAACTTTTGG + Intronic
1174795356 20:53517742-53517764 GTTGTTTTTTTAACGTCTTCAGG - Intergenic
1175588469 20:60166870-60166892 GTGGAATTTTAAATAACTTCTGG + Intergenic
1179348549 21:40584751-40584773 GATGGATTTTTGACAATTTCAGG - Intronic
1181691564 22:24565187-24565209 ATTTGCTTTTTAACAATTTCAGG + Intronic
949392138 3:3574015-3574037 CTTGGATTTTTAGAAACTGCTGG - Intergenic
949841052 3:8320534-8320556 GTTGGATTTTTAAACATTTTTGG - Intergenic
951019921 3:17771624-17771646 TTTGTATTTTTAACAAGTCCCGG - Intronic
951026551 3:17836954-17836976 GTTGCATTTTTAGTAATTTCCGG + Intronic
952147856 3:30552887-30552909 GTTGCATTATTATAAACTTCGGG - Intergenic
955766857 3:62353940-62353962 GTATGACTTTTAATAACTTCCGG - Intergenic
957782904 3:84842572-84842594 GTTGTATTTTTTACAAATTGAGG + Intergenic
958830484 3:99082482-99082504 GTTGGATTATCAACTACTGCAGG + Intergenic
959589017 3:108055264-108055286 CTTGGATTTTTAACTATTTGAGG + Intronic
960132123 3:114068381-114068403 GTTGGATTTTTAACAACTTCAGG + Intronic
960953922 3:123018011-123018033 GTTGCATTCTTAACGAGTTCTGG + Intronic
963210360 3:142682803-142682825 CTAAGATTTTTAATAACTTCAGG - Intronic
965642539 3:170845483-170845505 GTTGGGTTTTTAAACACTTAGGG - Intronic
969777752 4:9371317-9371339 GTTGGATTTTTTACAGCTTTGGG - Intergenic
970190862 4:13515513-13515535 GGGGGATATTTAACAACTGCAGG + Intergenic
975350006 4:73334596-73334618 GTTGTATTTTTAACTCCTTGAGG + Intergenic
975539013 4:75484851-75484873 GTTTGGTTTTTAACAGCTTATGG - Intronic
977465144 4:97374489-97374511 GTATGCTTTTCAACAACTTCTGG - Intronic
979286622 4:118932975-118932997 AATGGATTTTTAGCAAGTTCTGG - Intronic
979687443 4:123526427-123526449 TTTGGATTATTACCAACTTTTGG + Intergenic
981316404 4:143344011-143344033 CTTGGAATTTTAATAAGTTCAGG - Intronic
981967373 4:150621304-150621326 GTTGTATTTTTAAAAACTGTGGG + Intronic
983539135 4:168889823-168889845 TCTGCATTTCTAACAACTTCAGG + Intronic
984439482 4:179748344-179748366 GGTGGATTTTTAAGACCATCAGG - Intergenic
984458882 4:180007951-180007973 GAAGGATTTAGAACAACTTCAGG - Intergenic
987056365 5:14196919-14196941 GCTGGATGATTAACAACTTCAGG + Intronic
988776087 5:34479197-34479219 AATGGATTTTTACCAAGTTCTGG - Intergenic
988853252 5:35199814-35199836 TTTGAATTTTTAATACCTTCGGG - Intronic
991724140 5:69519260-69519282 CTTGGATTTTTAGCATCTTCAGG + Intronic
992265084 5:75010303-75010325 GTAGGAATTTTAACAAGATCTGG - Intergenic
993436305 5:87899917-87899939 GCTGGACTTAAAACAACTTCAGG + Intergenic
994019866 5:95010652-95010674 GTTGGCATTTTAAACACTTCTGG + Intronic
995222064 5:109659958-109659980 ATTGTATTTTGAATAACTTCTGG - Intergenic
996076059 5:119195812-119195834 GTTTGATTTTTAAAAAAGTCAGG - Intronic
996169087 5:120266489-120266511 GTTGGCTTTTTACCCATTTCTGG + Intergenic
997421216 5:133768210-133768232 GTTGGATTCGTCACAACTCCGGG - Intergenic
998019951 5:138760934-138760956 GTTGGATATATAATAAGTTCTGG + Intronic
1003002025 6:2345096-2345118 ATTTGAGTTTTAACAAGTTCTGG + Intergenic
1003868929 6:10386461-10386483 GTTGGATTTTTAAATACATGTGG + Intergenic
1004612764 6:17260756-17260778 GTTGGATTTTTTTGAACTTCTGG - Intergenic
1004922837 6:20393160-20393182 GTTGCATTTTTTACAAATTGGGG - Intergenic
1005076061 6:21909030-21909052 TTTTGATTTTTAAACACTTCTGG + Intergenic
1005437297 6:25828222-25828244 GTTGGATTTTTCATAAGGTCTGG + Intronic
1005610610 6:27520344-27520366 TTTGGATTTGTCACAACTTAAGG + Intergenic
1006397669 6:33797639-33797661 GTTGGATTTTTAAAATATTTTGG - Intronic
1006860169 6:37166919-37166941 GTTCGATTTTTAACCATTTGGGG - Intergenic
1008370958 6:50729891-50729913 GTTGGAAATAAAACAACTTCTGG - Intronic
1009343125 6:62583908-62583930 TTTGCAATTTAAACAACTTCAGG - Intergenic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1011259880 6:85459742-85459764 CTGGTATTTTTAACACCTTCTGG + Intronic
1012180686 6:96148852-96148874 GTTAGACTTTTAACTACTTGAGG + Intronic
1012798954 6:103801177-103801199 GTTCGATTTTTAATACCTTTAGG + Intergenic
1013871568 6:114768483-114768505 GTTCGTTTTTTAACCACTGCTGG + Intergenic
1015431382 6:133133694-133133716 GTTGCCTTTTTAAAAACTCCAGG + Intergenic
1020619123 7:10496960-10496982 GTGGGAATTTCAGCAACTTCAGG + Intergenic
1020826810 7:13039133-13039155 ATGGAATTTTTAACAAGTTCTGG + Intergenic
1021005983 7:15395832-15395854 GTTTGTTTTTTGACAACCTCTGG + Intronic
1021066126 7:16175002-16175024 GTTGGTTTTTGAGCAACATCTGG + Intronic
1022313886 7:29226027-29226049 TTTGAATTTATAACAATTTCTGG + Intronic
1022657125 7:32329875-32329897 GATGGATTACTAACAGCTTCAGG + Intergenic
1023036949 7:36139620-36139642 GTTGGATTTTTCATTGCTTCTGG - Intergenic
1024492278 7:49998954-49998976 TTTGGATTTTGAACCATTTCAGG - Intronic
1027368842 7:77486554-77486576 ATTTCATTTTTAACAACTCCTGG - Intergenic
1028386707 7:90262578-90262600 GTTGGTTCTCTAACAAGTTCTGG + Intronic
1028829326 7:95310186-95310208 TTTGGATTTTTAAAAAGTTGAGG - Intronic
1030191694 7:106816988-106817010 GTTTGATTTTCAGCAATTTCAGG - Intergenic
1036275207 8:7345275-7345297 GTTGGATTTTTTACAGTTTTGGG - Intergenic
1036841473 8:12125829-12125851 GTTGGATTTTTTACAGTTTTGGG + Intergenic
1037502588 8:19499895-19499917 CTTGGATTTCTAGCAACTGCCGG - Intronic
1038772947 8:30501013-30501035 TTTGCATTTTTAACAAGTTCAGG - Intronic
1040856160 8:51950148-51950170 ATTGGATTGTTCCCAACTTCTGG - Intergenic
1041380911 8:57253723-57253745 TGTGCATTTCTAACAACTTCTGG + Intergenic
1041545378 8:59036474-59036496 TTTGAATTTTTAACAATTTCAGG + Intronic
1046002893 8:108443325-108443347 CGTGGATTTTTAACAAATGCTGG - Intergenic
1046864788 8:119135416-119135438 GATGTGTATTTAACAACTTCTGG - Intergenic
1050754152 9:8979138-8979160 TTTTGAATTTAAACAACTTCAGG - Intronic
1051002028 9:12294038-12294060 GTTTAATTTTTAACTACTGCAGG - Intergenic
1051218500 9:14824053-14824075 GTAGGATTCTTAACTACTTTTGG + Exonic
1051347620 9:16166447-16166469 TCTTGATTTTTAAAAACTTCTGG + Intergenic
1051488235 9:17631823-17631845 GTTGGCTTATTGATAACTTCAGG + Intronic
1051995736 9:23215179-23215201 GTTGGATTATTAAAAACTACTGG + Intergenic
1052047820 9:23814712-23814734 GTTGTATATTTAACACATTCTGG + Intronic
1052463254 9:28794780-28794802 GTTAAATGTTTAACAAATTCAGG + Intergenic
1052648469 9:31269572-31269594 GTTGAATGTTTAAGAACATCAGG - Intergenic
1052661763 9:31442017-31442039 GTTTTATTTTTAACTTCTTCAGG - Intergenic
1055091343 9:72366542-72366564 TTTTGTTTTTTAACAAATTCGGG + Intergenic
1056853088 9:90100809-90100831 GCTGGATTTTTAACCACCACTGG + Intergenic
1060299499 9:122366721-122366743 GGAGGAGTTTTAACCACTTCTGG - Intergenic
1060707463 9:125817804-125817826 GTTAGATTTTTAAAAAATTGCGG + Intronic
1061437314 9:130572999-130573021 GTTGGGTTTTTAAAAAATTTGGG - Intergenic
1186379176 X:9038988-9039010 AATTGATTTTTAACAACTTTGGG - Intronic
1187198350 X:17109940-17109962 GTTGAATATTTCACAAATTCAGG - Intronic
1188461971 X:30438191-30438213 ATTTGATTTTTAACCACATCAGG + Intergenic
1188691172 X:33131023-33131045 GCTGGATTCTTAAGCACTTCCGG - Intronic
1189829541 X:44956821-44956843 GTTGGCTTTTTAAAAATTACGGG + Intronic
1192394199 X:70761847-70761869 GTTTGATTTTTAAATACTTGAGG - Intronic
1194945489 X:100061606-100061628 TTGGGATTTTTAACATCTTGAGG + Intergenic
1195113583 X:101672326-101672348 CTTGGAATTTTAATAACTACTGG - Intergenic
1196277500 X:113784543-113784565 GTTGTATATTTTACAGCTTCTGG - Intergenic
1196371296 X:114982484-114982506 ATTGCATTTTTAACATTTTCAGG - Intergenic
1197313387 X:124933574-124933596 GTCGAAATTTTAACAAATTCTGG - Intronic
1197328615 X:125125570-125125592 TTTGGATTTTTCACCTCTTCTGG + Intergenic
1197360571 X:125497563-125497585 GAAGGATTTTTAACAACATTTGG + Intergenic
1199654029 X:149976970-149976992 GCTGGAGGTTTAACAATTTCTGG - Intergenic
1201378458 Y:13346567-13346589 ATTGAATTTGTAACAAATTCAGG - Intronic