ID: 960140479

View in Genome Browser
Species Human (GRCh38)
Location 3:114147515-114147537
Sequence CGTGCCATGCTGGTAGTGAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960140468_960140479 26 Left 960140468 3:114147466-114147488 CCCAGACGGCCGTGATCATGAGG 0: 1
1: 0
2: 1
3: 4
4: 55
Right 960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG 0: 1
1: 0
2: 0
3: 3
4: 61
960140470_960140479 25 Left 960140470 3:114147467-114147489 CCAGACGGCCGTGATCATGAGGG 0: 1
1: 0
2: 0
3: 6
4: 36
Right 960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG 0: 1
1: 0
2: 0
3: 3
4: 61
960140475_960140479 -5 Left 960140475 3:114147497-114147519 CCGACAGGAGCTCTGTCCCGTGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG 0: 1
1: 0
2: 0
3: 3
4: 61
960140474_960140479 2 Left 960140474 3:114147490-114147512 CCACGCGCCGACAGGAGCTCTGT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG 0: 1
1: 0
2: 0
3: 3
4: 61
960140472_960140479 17 Left 960140472 3:114147475-114147497 CCGTGATCATGAGGGCCACGCGC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960140479 Original CRISPR CGTGCCATGCTGGTAGTGAA CGG Exonic
902785045 1:18727822-18727844 TGTGGGATGCTGGTAGTGGAGGG + Intronic
910352102 1:86309545-86309567 GGTGCTGTGCTGGTAATGAAGGG - Intergenic
910426735 1:87126170-87126192 AAAGCCATGCTGCTAGTGAATGG - Intronic
915341642 1:155179708-155179730 AGTGCCAGGCAGGTGGTGAATGG - Exonic
923898747 1:238302817-238302839 CATGACATGCTGGGACTGAAAGG + Intergenic
1076532612 10:131154834-131154856 CGTGCTGTGCTGGAACTGAAGGG + Intronic
1077462890 11:2719636-2719658 CGAGCCTTGCTGGTGGTGGAAGG + Intronic
1078914931 11:15770282-15770304 GGTGACATGCTTGAAGTGAATGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1091394548 12:145827-145849 CGTTCCATGCTGGCTGTGAGCGG + Intronic
1096180638 12:49548756-49548778 TGTGCTAGGCTGGCAGTGAAGGG + Intronic
1098231302 12:68374405-68374427 CGTGCCATGGTGTTTGTGACTGG + Intergenic
1102884527 12:116511506-116511528 CGTGCCCTGCTGAAAGTCAAGGG - Intergenic
1105816817 13:24043727-24043749 CATGGCCTGCTGGTCGTGAAAGG + Intronic
1106106343 13:26736704-26736726 CATGCCATGCTGGTGGTTAGAGG + Intergenic
1108515294 13:51195852-51195874 GGTGGCATGCAGGTAGTGACAGG - Intergenic
1114033516 14:18597524-18597546 CATCCCATGCTGATAGTGATGGG - Intergenic
1114078303 14:19176724-19176746 CATCCCATGCTGATAGTGATGGG - Intergenic
1114125185 14:19717827-19717849 CATCCCATGCTGATAGTGATGGG + Intergenic
1118152491 14:63204683-63204705 CTTACCATGCTGGTAAAGAAAGG - Exonic
1123441393 15:20294743-20294765 CGCGCCATGGGGGAAGTGAAAGG + Intergenic
1136538313 16:30913469-30913491 CGTGCCATGGTAGTAGAGCAGGG + Intergenic
1141044782 16:80706345-80706367 CGCTCAATGCTGGCAGTGAAGGG + Intronic
1146655868 17:34634870-34634892 GGTGGCATGCTGGTACTGCAGGG - Exonic
1148694020 17:49548431-49548453 GGGGCCATGCTGGAAGAGAAAGG - Intergenic
1163031892 19:14550265-14550287 CGTGCCTGGCTGGTTGTGAGTGG + Intronic
1163182541 19:15614761-15614783 CCTGCCAGGCTGGCAGTGGAGGG + Intergenic
1163711803 19:18851585-18851607 AGTGCCATGCTGGTGGGGACAGG - Intronic
925124071 2:1441297-1441319 CGTACCATGTTGGAAGAGAATGG + Intronic
927219349 2:20692849-20692871 GGTGTCATGCTGAGAGTGAAAGG + Intronic
931245604 2:60490134-60490156 GGTTCCATTCTGCTAGTGAAAGG + Intronic
936980483 2:118260583-118260605 CATGCCATGCTTTTAGTGGAAGG + Intergenic
937975522 2:127580202-127580224 CGTGCCAGGCTGGTGGGGGACGG - Intronic
945087643 2:206149062-206149084 TGTGCCATGCCAGTAATGAAGGG - Exonic
945753370 2:213815669-213815691 TGTGCCATTATGGTAGTTAAAGG - Intronic
947742888 2:232492920-232492942 TATGCCATGCTGGTAGAGGAGGG - Intergenic
1170979188 20:21195276-21195298 CATGCCATGGTGGTAGTGAGGGG + Intronic
1175542013 20:59753923-59753945 CGTCCCATCCTGGCAGTGGAAGG - Intronic
1180457630 22:15524583-15524605 CATCCCATGCTGATAGTGATGGG - Intergenic
1185378973 22:50498046-50498068 GTTGCCATGCTGGGAGTGCAGGG + Intergenic
960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG + Exonic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
962519083 3:136181501-136181523 TGTTCCACGGTGGTAGTGAAAGG - Intronic
965862858 3:173168346-173168368 CTTGTCATGATGCTAGTGAAAGG + Intergenic
972824714 4:42744452-42744474 GGTGCCATGCTAGTAGCTAATGG + Intergenic
978597914 4:110398906-110398928 AGGGCCATGCGGGTAATGAATGG + Intronic
980041552 4:127946441-127946463 CTTTCCATGCTGGTAGTCATTGG - Intronic
986871857 5:12058072-12058094 AGTACCATGGTGGTAGAGAAAGG + Intergenic
989096739 5:37788815-37788837 CCTGGAATGCTGGTAGTGAGGGG - Intergenic
1001496287 5:172189453-172189475 CCTGCGATGCTGGTAGTGGTCGG + Intergenic
1004825099 6:19411415-19411437 CCTGCCATGCTGGGGTTGAAGGG + Intergenic
1017682720 6:156880247-156880269 AATGGAATGCTGGTAGTGAAAGG + Intronic
1025237352 7:57243849-57243871 GCTGCCATCCTGGTAGAGAAGGG - Intergenic
1036498867 8:9295368-9295390 CGCCCCATGATGGTAGTGAAGGG + Intergenic
1040692779 8:49959827-49959849 TGTGCCATGCAGATAGGGAAAGG - Intronic
1042227855 8:66528631-66528653 AGTGCCAGGCTGCTAGTCAATGG - Intergenic
1050124300 9:2340510-2340532 ACTGCAATGCTGGTAGTAAATGG + Intergenic
1056602980 9:88061086-88061108 CGTGCCATACTGGGAGGAAAGGG - Intergenic
1060259354 9:122060452-122060474 CCTGCCATGCTGGTAGAGCATGG + Intronic
1061226073 9:129281688-129281710 CGGGCCACGCTGGGAGTGGAGGG + Intergenic
1061836918 9:133335631-133335653 CGCACCATGCCCGTAGTGAAGGG + Intronic
1195491530 X:105475981-105476003 TGTGCCCTGAGGGTAGTGAATGG - Intronic
1196718584 X:118832836-118832858 TCTGCCATGCTAGGAGTGAATGG - Intergenic
1199472989 X:148215471-148215493 CGTGCCAGGAAGATAGTGAAAGG + Intergenic
1199569753 X:149255560-149255582 GTTGCCTTGCTGTTAGTGAAAGG - Intergenic