ID: 960143285

View in Genome Browser
Species Human (GRCh38)
Location 3:114171928-114171950
Sequence TGTGGGGCAGAGAACTCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960143285_960143289 -7 Left 960143285 3:114171928-114171950 CCTGTGGAGTTCTCTGCCCCACA 0: 1
1: 0
2: 4
3: 15
4: 191
Right 960143289 3:114171944-114171966 CCCCACAGGTGTAGTTCAGGTGG 0: 1
1: 0
2: 7
3: 6
4: 93
960143285_960143292 5 Left 960143285 3:114171928-114171950 CCTGTGGAGTTCTCTGCCCCACA 0: 1
1: 0
2: 4
3: 15
4: 191
Right 960143292 3:114171956-114171978 AGTTCAGGTGGCCACTCAGCTGG 0: 1
1: 0
2: 2
3: 9
4: 157
960143285_960143295 30 Left 960143285 3:114171928-114171950 CCTGTGGAGTTCTCTGCCCCACA 0: 1
1: 0
2: 4
3: 15
4: 191
Right 960143295 3:114171981-114172003 CAGAGATGCCATAGCCCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 204
960143285_960143287 -10 Left 960143285 3:114171928-114171950 CCTGTGGAGTTCTCTGCCCCACA 0: 1
1: 0
2: 4
3: 15
4: 191
Right 960143287 3:114171941-114171963 CTGCCCCACAGGTGTAGTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 101
960143285_960143294 29 Left 960143285 3:114171928-114171950 CCTGTGGAGTTCTCTGCCCCACA 0: 1
1: 0
2: 4
3: 15
4: 191
Right 960143294 3:114171980-114172002 TCAGAGATGCCATAGCCCAGAGG 0: 1
1: 0
2: 0
3: 14
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960143285 Original CRISPR TGTGGGGCAGAGAACTCCAC AGG (reversed) Exonic
900357625 1:2272391-2272413 AGAGGGGCAGAGCCCTCCACAGG + Intronic
900420986 1:2555871-2555893 TGTGGGGCAGGGAAGCCCAGTGG + Intronic
900713532 1:4129804-4129826 CGTGGGGCAGAGGAATCAACAGG - Intergenic
900929217 1:5725864-5725886 AGGGGGGCAGAGAAGTCCAGCGG + Intergenic
902032468 1:13433188-13433210 AGTGTGGAAGAGAACCCCACTGG + Intergenic
904443002 1:30543959-30543981 GGTGTGCCAGAGAACTCCTCTGG - Intergenic
904962159 1:34342174-34342196 TGTGGGGCAGAGACATCCACAGG + Intergenic
905498862 1:38419858-38419880 TGTGGAGCAGAGACCTAGACTGG - Intergenic
906791620 1:48663304-48663326 TGTGTGGCAGGGAACCCCAGAGG + Intronic
907251897 1:53145211-53145233 TCTGGAGCAGAGAACTCCCTGGG + Intergenic
907911538 1:58831484-58831506 TTTGGTGCAGAAAACTCCAATGG - Intergenic
910692776 1:89981805-89981827 TGTGTGTCAGAAAACTCCTCTGG + Intergenic
913159535 1:116132745-116132767 TGTGGGGCTGATCCCTCCACAGG - Intronic
915146840 1:153800530-153800552 TGCGTGGCAGAGAACAGCACGGG + Intergenic
916246603 1:162694424-162694446 GGTGGGGGAAAGAACTCCACAGG - Intronic
916522634 1:165578889-165578911 TTTGGGACAGAGTTCTCCACTGG + Intergenic
916632571 1:166632485-166632507 TTTGGGGCAGAGAATTCTTCTGG - Intergenic
919699057 1:200612476-200612498 TGTGGGGCAGAGTTCTCTATTGG - Intronic
920313365 1:205061363-205061385 TGTGAGGCGGAGAACTCCAAGGG + Exonic
921912618 1:220567003-220567025 GGTGGGGAAGAAAACTTCACTGG - Intronic
922163088 1:223092718-223092740 TCTGGGTCAGAGAGCTCCAAAGG - Intergenic
922404675 1:225299537-225299559 TGTGTGGCAGAAACCTCAACTGG - Intronic
922637869 1:227194142-227194164 ACTGGGGCAGAGAACAACACAGG + Intronic
1066235137 10:33478706-33478728 TCTGGTGCAGATAACTCCAGAGG - Intergenic
1070678160 10:78429232-78429254 TGTGGGGCAGAAAACTAAAGAGG - Intergenic
1072634047 10:97165869-97165891 GGTGGGGCAGACAGCTCCTCAGG - Intronic
1074370367 10:112895759-112895781 TGTGTAGCAGAGAACTGAACTGG + Intergenic
1076075895 10:127533638-127533660 TGTTGGGCAGTGCACTCCAGCGG + Intergenic
1076695327 10:132244541-132244563 TGAGGGGCAGAGACCTGCCCTGG - Intronic
1077259162 11:1606526-1606548 TGTGGGGGAGAGAAGCCCAAGGG + Intergenic
1078442773 11:11381084-11381106 TGTGGGACAGTGACCTCCCCAGG - Intronic
1079175331 11:18135039-18135061 GGTGGGGCAGAGAACAGAACTGG + Intronic
1084004453 11:66315658-66315680 TGCGTGGCAGAGACCACCACAGG + Exonic
1084013036 11:66363245-66363267 TGTGGGGAAGAAATCACCACCGG - Exonic
1084731416 11:71076028-71076050 CGTGGGACAAAGAACACCACAGG + Intronic
1086781555 11:90912444-90912466 GGTGGGGCAGTTAACTCCATAGG + Intergenic
1089515864 11:119030952-119030974 TGTGGGGCGGGGAACTCCACTGG - Intergenic
1090774419 11:129950523-129950545 TGTGAGGGTGAGGACTCCACAGG + Intronic
1091713486 12:2759785-2759807 TGTGGGGCAAGGAAATCCCCTGG - Intergenic
1091893320 12:4080432-4080454 TGTTTGGCTGAGTACTCCACAGG + Intergenic
1096756759 12:53806072-53806094 TTAGGGGCAGAGAACTCTCCTGG + Intergenic
1097134437 12:56839894-56839916 TGAGGGACAGAAAACCCCACAGG - Intergenic
1100341133 12:93680161-93680183 AGAGGGGCAGAGAACTGAACTGG + Intronic
1103732403 12:123036682-123036704 TCTGGGTCAGAGACCTCCAAGGG - Intronic
1104252523 12:127108988-127109010 TCTGGGTCAGAGACCTCCAAAGG + Intergenic
1107711732 13:43157176-43157198 TGTCTGAGAGAGAACTCCACAGG + Intergenic
1109705868 13:66092275-66092297 TGTGGGGCAGAGCAGGCCATTGG - Intergenic
1110437637 13:75493236-75493258 TGTGGGGCAGTGACTCCCACTGG - Intergenic
1111695915 13:91623493-91623515 TCTAGGTCAGAGAACTCCATGGG + Intronic
1115920093 14:38363229-38363251 TCTGGGTCAGAGACCTCCAAAGG - Intergenic
1117830107 14:59741696-59741718 AGTGGGGCAGAGAACACCATTGG - Intronic
1119740762 14:77012391-77012413 TGTGGGGAGGAGAGGTCCACGGG - Intergenic
1121026576 14:90620667-90620689 TGTGGGGCAGGCACCTCCTCTGG - Intronic
1122979735 14:105186045-105186067 TGTGGGGCACAGAAGTCCACTGG + Intergenic
1128448197 15:67783347-67783369 TTTGGAGCACAGGACTCCACAGG - Intronic
1128618342 15:69127951-69127973 TGTTGGGCTGTAAACTCCACTGG + Intergenic
1131543607 15:93297230-93297252 TCTGGGGCTGAAAACTCCACTGG + Intergenic
1131791212 15:95967659-95967681 TGTGGGTCAGAGATTTCCTCTGG + Intergenic
1140629962 16:76839855-76839877 TGATGGGGAGAGAAATCCACAGG - Intergenic
1141265873 16:82496712-82496734 TGTGGGGCACCAAACACCACAGG + Intergenic
1146453346 17:32991659-32991681 TGTGGGGCAGAGATGTGCAAGGG + Intronic
1147704931 17:42420067-42420089 GGCGGGGCAGAGAACACCAAGGG - Intronic
1150138805 17:62711708-62711730 TGTGGGGGAGAGAGCTTCATCGG + Intronic
1150571569 17:66391430-66391452 TGTGGAGCAGATGACACCACTGG - Intronic
1152587171 17:81194288-81194310 GGTGGGGAAGAGACCCCCACAGG + Intronic
1153365026 18:4246472-4246494 TGGGGTGCAGAGAACTCAGCAGG + Intronic
1154022271 18:10674631-10674653 TGTGTGCCAGATAACTGCACTGG + Intronic
1155791263 18:29973510-29973532 TTTGGGTCAGAGAGCTCCAATGG - Intergenic
1158188025 18:54793676-54793698 TGTTGGGCTGAAAACACCACTGG + Intronic
1159212501 18:65343789-65343811 AGTGGGGCAGAGAGCACCTCTGG - Intergenic
1160392799 18:78547884-78547906 TGTGGGGCAGAGCACGGCCCCGG + Intergenic
1162430658 19:10626109-10626131 GGTGAGGCAGAAAATTCCACAGG + Intronic
1162812046 19:13170106-13170128 GGTGGGGCAGAGAATTTCCCAGG - Intergenic
1164394092 19:27848930-27848952 TTTGGGGCAGAGATTTCCTCAGG + Intergenic
1164498317 19:28790929-28790951 AGTGGGGCAGGGAACAGCACTGG - Intergenic
1164679052 19:30121887-30121909 GGTGGGGCAGAGATCCCCACAGG - Intergenic
1165454430 19:35902535-35902557 TGTGGTCCAGAGAAGTCCAGAGG - Exonic
1165853723 19:38867299-38867321 TGTGGGGAAGAATACTCCGCAGG - Intergenic
1168609975 19:57791238-57791260 TTTGGTGCAGAGAACTCTTCTGG + Intronic
926086413 2:10023052-10023074 TGTGCTGCTGAGACCTCCACTGG - Intergenic
926275473 2:11400084-11400106 TGTAGGGGAGAGACCTCTACAGG + Intergenic
927246112 2:20958330-20958352 GGGTGGGGAGAGAACTCCACAGG - Intergenic
929056810 2:37885445-37885467 TGTGGGGCAGGGAGCACCTCAGG - Intergenic
932612618 2:73210985-73211007 TGTGAGGCAGGGAGCTCCAGTGG - Exonic
932855845 2:75233232-75233254 GCTGGGGCAGAGAACTACACAGG - Intergenic
937034378 2:118768831-118768853 TGTAGGGGAGGGACCTCCACAGG - Intergenic
937441515 2:121919756-121919778 TGTGGGTCAGAGGAGTCCCCAGG + Intergenic
937984180 2:127631152-127631174 CGTGGGACAGAGAAGGCCACAGG + Intronic
938069589 2:128301286-128301308 TGTTGGGCAGAGATCCCCAGGGG + Intronic
938959561 2:136329034-136329056 AGTGGGGCAGGGAAATCCACTGG + Intergenic
942058595 2:172207333-172207355 TGTGGGAGAGGGAAGTCCACTGG + Intergenic
942401629 2:175609388-175609410 TGTGGGTCTGAGAACTCCTGGGG - Intergenic
946420347 2:219561256-219561278 TGGGGGGCACAGAACCCCAGTGG - Intronic
946448668 2:219761392-219761414 TTTGGGTCAGAGACCTCCAAAGG + Intergenic
946747833 2:222862741-222862763 TGTGGGGCAGAGTGGTCCATTGG + Intronic
947572806 2:231249227-231249249 TGTGGGGCAGGGAAATCCTGCGG - Intronic
1170849330 20:19990133-19990155 TGTGCGGCAGAGGAATCCGCAGG + Exonic
1171131615 20:22658858-22658880 TGTGGGGCAGAGAAGATCCCTGG + Intergenic
1173978150 20:47202847-47202869 TGTGGGACAGACAACTGCAGTGG - Intergenic
1175004902 20:55671589-55671611 TGTGGAGCAAAGAAGCCCACTGG + Intergenic
1175317517 20:58059368-58059390 TGCAGGGCAGAGAACTTCAGAGG + Intergenic
1175719426 20:61276727-61276749 TGTGGCTCTAAGAACTCCACGGG + Intronic
1177871395 21:26577329-26577351 TGTGGGTCAGGGAACTCAAAAGG - Intergenic
1181632585 22:24159056-24159078 TGGGGGGAAGAGAAGCCCACAGG - Intronic
1181971133 22:26691010-26691032 TGGAGGGCAGAAAACTCAACTGG - Intergenic
1183075942 22:35426739-35426761 TGTGAGGCAGGGAAAACCACAGG - Intergenic
1183259890 22:36787938-36787960 TGTGGTGCAAATAACCCCACAGG + Intergenic
1185195737 22:49468191-49468213 TGGGGGAAAGAGATCTCCACAGG + Intronic
1185285284 22:49997230-49997252 GGTGGGGCAGAGACCACCACAGG + Intronic
949895750 3:8766680-8766702 TGGGGGGCAGAGGAGTCCAAGGG - Intronic
957169256 3:76716820-76716842 TGTGGGGCAGAGCTTGCCACTGG - Intronic
959612371 3:108309646-108309668 TTTGTGGCAGAGTACTACACAGG + Intronic
960143285 3:114171928-114171950 TGTGGGGCAGAGAACTCCACAGG - Exonic
960342820 3:116496706-116496728 TGTGAGCCAGAGAACACCAAGGG - Intronic
962149350 3:132876457-132876479 AGTGGGGCAAAGAACTCCAGGGG + Intergenic
968470033 4:776073-776095 TGTGGAGTAGAGAAACCCACTGG + Intergenic
969041700 4:4302674-4302696 TGTGGGGCAGAGTCATTCACAGG - Exonic
970198888 4:13581695-13581717 TGTGGAGCAGAGAATTGCAGTGG - Intronic
974083239 4:57233962-57233984 TGTGGGACAGATATCACCACTGG + Intergenic
974368999 4:60989399-60989421 TAAGGGGCAGAGAACCTCACAGG + Intergenic
975163989 4:71156145-71156167 TCTGTGGCATAGAATTCCACAGG + Intergenic
975261325 4:72303120-72303142 TGTGGGTCAGAGGGCTCCAAGGG - Intronic
975908370 4:79242449-79242471 TGGGTGGCAGAGAAGTTCACTGG - Intronic
976950351 4:90821070-90821092 GGTGGGGAATAGAAATCCACAGG - Intronic
977356740 4:95955298-95955320 TCTGGGGCAGGCAAGTCCACTGG - Intergenic
978063292 4:104364850-104364872 CCTGGGGCAGAGGCCTCCACGGG - Intergenic
979103608 4:116655441-116655463 TGTGTGGCACAGACCTCCACTGG + Intergenic
979361006 4:119765040-119765062 TGTGGGGAAGAGAACACTAAGGG + Intergenic
982520460 4:156410116-156410138 CTTGGGGCAGAGAACTACATGGG - Intergenic
982615205 4:157632945-157632967 TGTGGTGCAGAGAGCTTCTCTGG + Intergenic
982812780 4:159847038-159847060 TGTTGAGCAGAGTACGCCACAGG - Intergenic
986514810 5:8550136-8550158 TGTGTGGCAGAGAACTGGAGTGG - Intergenic
987217509 5:15752534-15752556 GGTGGGTCAGAGAAATCCAATGG - Intronic
987275186 5:16354912-16354934 TCTGGGTCAGAGAGCTCCAGAGG + Intergenic
988625649 5:32871679-32871701 GGTGGGCCAGGGACCTCCACTGG + Intergenic
989770779 5:45142696-45142718 TGTTGGGGAAAGAACTCCAAGGG - Intergenic
989923124 5:49834576-49834598 TCAGGGGCAGATATCTCCACTGG - Intergenic
993685589 5:90933702-90933724 TGGAGGGCAGAGAACTTCCCGGG - Intronic
994497995 5:100536908-100536930 TGTGGGCCAGGGAACCACACAGG + Intronic
996536847 5:124586220-124586242 TATGTGGCAGAGAACTACCCTGG - Intergenic
996954271 5:129164385-129164407 TGACTGGCAGAGAGCTCCACTGG - Intergenic
997205150 5:132043821-132043843 TGTTGGCCAGAGAACACCAGTGG + Intergenic
998583187 5:143402601-143402623 TGTCGGAGAGAGAACTCAACAGG - Intronic
1001477274 5:172059589-172059611 TCTGGGTCAGAGAACTGCAAAGG - Intronic
1003411961 6:5873149-5873171 GGTTGGGCAGAAAGCTCCACAGG - Intergenic
1003717965 6:8667842-8667864 TATGGGGCAGAGAACTAGGCAGG + Intergenic
1007034684 6:38662392-38662414 TGTGGGGCTGGGAAGTACACAGG + Intergenic
1008485517 6:52030748-52030770 TCTGGGACAGAGAGCTCCAAAGG + Intronic
1010528782 6:76941334-76941356 TGTGGTGCAGAGAACCTCTCTGG + Intergenic
1015176053 6:130310695-130310717 TGTAGGGCATAGAAATACACAGG - Intronic
1015478751 6:133683165-133683187 TCTGGGGTAGATAGCTCCACAGG - Intergenic
1016097232 6:140053164-140053186 GGTGGAGCAGATAACTCCAAAGG + Intergenic
1016844502 6:148557717-148557739 GGTGGGGCAGAGATCTGCAGGGG - Intergenic
1018067731 6:160135385-160135407 TGAAGGGCAAAGAACTCCACAGG + Intronic
1018229167 6:161659527-161659549 TGTGGGGCAGATAAGGCCAGGGG + Intronic
1018263062 6:161989703-161989725 TGTGGGGCAGATCAATCCCCAGG - Intronic
1018368172 6:163143705-163143727 TGTGTGGCTGAGAAATCAACAGG + Intronic
1019276151 7:177071-177093 TGTTGGGAAAAGAAATCCACTGG + Intergenic
1020812147 7:12861485-12861507 ACTGGGGCAGAGGACTCCTCAGG + Intergenic
1023958804 7:44909893-44909915 TGCGAGGCAGAGAACTTCAGTGG + Intergenic
1024161004 7:46675943-46675965 TTTAGGGCACAGAACTACACAGG + Intronic
1024475102 7:49801267-49801289 CGTGGGGCACACAACTCAACTGG + Intronic
1026491738 7:70869558-70869580 AATAGGGCTGAGAACTCCACAGG - Intergenic
1026666880 7:72348437-72348459 TGTGGGGCAGAGAACTGGAGAGG + Intronic
1027591971 7:80129188-80129210 TGTGGGACAGAGATCTCATCAGG + Intergenic
1029052083 7:97700057-97700079 TGTGGGCCAGAGAACACCTTTGG - Intergenic
1029115161 7:98232974-98232996 TGTGGGGCAGAGAGAGCCTCAGG + Intronic
1030369838 7:108686400-108686422 TGTGGGGCAGAGAGAACCAGTGG + Intergenic
1030607973 7:111658711-111658733 TGTGGGCCAGAGTTATCCACAGG + Intergenic
1032219352 7:129982251-129982273 TGTGAGAGAGAGAATTCCACGGG + Intergenic
1032516640 7:132511047-132511069 TGAGGGTCTGTGAACTCCACAGG + Intronic
1034718123 7:153262420-153262442 TCTGGGTCAGAGAACTCCAAAGG + Intergenic
1036208475 8:6823035-6823057 TCTGGAGCAGAGAACTTCTCAGG - Intronic
1036564095 8:9923486-9923508 TGTGGGGCAGAGAGGTGCAATGG - Intergenic
1038313658 8:26464978-26465000 GGTGGGGCAGGAAACTCCAGAGG - Intronic
1039532765 8:38278328-38278350 TGTGGAGCAGATAACTGCAGTGG - Exonic
1039615391 8:38951216-38951238 TGTTCGGCACAGAACTGCACAGG - Intronic
1043139073 8:76564898-76564920 AGAGGGTCAGAGAACTACACAGG - Intergenic
1043301871 8:78744259-78744281 TGTAGGCCAGAGAACACCAGCGG + Intronic
1044282133 8:90368323-90368345 TGTGGAGCAGAGCATCCCACTGG - Intergenic
1046980708 8:120333542-120333564 TGTGGAGCAGTGAAATCCAATGG + Intronic
1047750069 8:127873734-127873756 TGTGGGGCAAAGGCCTCCTCTGG - Intergenic
1048166265 8:132064153-132064175 TGTGGGGCAGTGCACTGGACAGG + Intronic
1049406728 8:142454945-142454967 GGAGGGGCAGAGGTCTCCACCGG - Intronic
1049925304 9:401460-401482 TCTGGGTCAGAGAGCTCCAAGGG + Intronic
1049975570 9:858393-858415 TGTGAGTCAAAGAACTCCAGGGG - Intronic
1051897063 9:21997865-21997887 TGAGGGTCAGAGAACCCCTCAGG - Intronic
1052378611 9:27745090-27745112 TGAAGAGCAGAGAACTTCACTGG - Intergenic
1052740290 9:32385815-32385837 TGTGGTGCAGAGAACTCCTAGGG - Intronic
1052865293 9:33461265-33461287 TGGGGGGCAGAGAAGCCCACTGG - Intergenic
1055208535 9:73762301-73762323 TGTAGGCCAGAGAACACCAGTGG - Intergenic
1055932334 9:81572435-81572457 TGTGGAGCAGAATCCTCCACAGG - Intergenic
1057242483 9:93423620-93423642 TGTGGGTCAGAGAGCTCCCAAGG + Intergenic
1057817168 9:98304237-98304259 TGGGGGGAAGGGAACTCCAAGGG + Intronic
1059677083 9:116549761-116549783 TGTGGGGAAGGGCACTCCAGTGG - Intronic
1060745650 9:126129184-126129206 TGTGGGGTAGAGAACTGGGCAGG - Intergenic
1060851392 9:126879889-126879911 TATGGAGGAGAGATCTCCACTGG - Exonic
1062153294 9:135032467-135032489 TGTGTGGGACAGAACTCCCCAGG - Intergenic
1062374249 9:136254813-136254835 TGTCGGGCAGAGAGCTCTCCAGG + Intergenic
1062434371 9:136540214-136540236 TGCTGGGAAGTGAACTCCACAGG + Intronic
1186852568 X:13594734-13594756 TGTGTGGCAGAGAACTCCATGGG - Intronic
1188335941 X:28933287-28933309 AATGGGGGAGAGAACTCCAGTGG - Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189326986 X:40118699-40118721 TGTGGGGCAGAGGACAGCATTGG - Intronic
1189578767 X:42383564-42383586 TGTGGGGCAGAGGGCTCTGCTGG + Intergenic
1192678697 X:73228563-73228585 TGTGGGTCAGAAAGCTCCAAAGG - Intergenic
1193192873 X:78593296-78593318 TGTGGTGCAGAGAGCTTCTCTGG - Intergenic
1195086544 X:101418686-101418708 CCTGGGGCTGAGAACTCCCCTGG - Intronic
1199062111 X:143369613-143369635 TATTGGGGAGAAAACTCCACTGG - Intergenic
1200235082 X:154464251-154464273 TGAGGGGCAGAGCAGTTCACCGG - Exonic
1200829993 Y:7680151-7680173 TGTGGGGCAGGGTATTCCCCAGG - Intergenic