ID: 960148985

View in Genome Browser
Species Human (GRCh38)
Location 3:114232179-114232201
Sequence AACTGTTGGTAGCAGTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960148981_960148985 3 Left 960148981 3:114232153-114232175 CCAGATGGGTGTGGTTTGAGCAT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG 0: 1
1: 1
2: 1
3: 21
4: 115
960148977_960148985 20 Left 960148977 3:114232136-114232158 CCAGGCAGCAGGTGGCTCCAGAT 0: 1
1: 1
2: 3
3: 34
4: 286
Right 960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG 0: 1
1: 1
2: 1
3: 21
4: 115
960148976_960148985 21 Left 960148976 3:114232135-114232157 CCCAGGCAGCAGGTGGCTCCAGA 0: 2
1: 0
2: 5
3: 71
4: 415
Right 960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG 0: 1
1: 1
2: 1
3: 21
4: 115
960148974_960148985 28 Left 960148974 3:114232128-114232150 CCTTGGGCCCAGGCAGCAGGTGG 0: 1
1: 4
2: 6
3: 79
4: 535
Right 960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG 0: 1
1: 1
2: 1
3: 21
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960148985 Original CRISPR AACTGTTGGTAGCAGTAGGG TGG Intergenic
903288165 1:22290000-22290022 GACTGTGGGTACCAGGAGGGAGG - Intergenic
903604721 1:24567293-24567315 AAGTGTTGTTATCAGTAGGGAGG - Intronic
906612033 1:47210145-47210167 AAGTGTTGGTAGAAGGAGGCCGG - Intergenic
907195272 1:52681451-52681473 TACTGTGGGAAGCAGTAGGTTGG - Intergenic
913429701 1:118777064-118777086 TACTGTAGGCAGCAGTAGGGAGG + Intergenic
914337563 1:146729559-146729581 AACAGTTGGCAGCAGGAGGATGG - Intergenic
915123464 1:153647433-153647455 AACTGTAGTGAGCAGTAGGTGGG - Intergenic
917406581 1:174713074-174713096 AAGTGCTGGGAGCAGAAGGGTGG - Intronic
918148098 1:181775459-181775481 AACTCTTGGTAGCAGCATGTAGG - Intronic
918959977 1:191262062-191262084 AACTATTGGTAGCTGTTGGGTGG - Intergenic
921945524 1:220883610-220883632 AACTGTTAATCACAGTAGGGTGG - Intronic
922031276 1:221802013-221802035 ATCAGGAGGTAGCAGTAGGGTGG + Intergenic
922364690 1:224852648-224852670 AACTGTAGGTAACGGTAGGCCGG - Intergenic
1065298097 10:24295755-24295777 AAGGATTGGTAGCAATAGGGAGG - Intronic
1068023636 10:51616504-51616526 AGGTGGTGGTAGCAGCAGGGTGG + Intronic
1068023774 10:51617391-51617413 CACTGGTGGTAGCAGCAGGGTGG + Intronic
1069030352 10:63589504-63589526 AACTGGTGGTGGCAGTGAGGGGG - Intronic
1072435041 10:95407093-95407115 CACTGATTGTAGCAGGAGGGTGG - Intronic
1074381684 10:112985791-112985813 AAATGCTGGTAGAAGTTGGGAGG + Intronic
1077714711 11:4569406-4569428 AACTGAGGGCAGCAGGAGGGCGG + Intergenic
1078446527 11:11409113-11409135 ATCTGTTGGTAGCATTTGGAAGG - Intronic
1078872191 11:15357959-15357981 GTCTGTTGGTAGCAGCAGAGGGG + Intergenic
1082636899 11:55607259-55607281 AGCTGTTGGTAGAAGTGGGTAGG - Intergenic
1082749527 11:57001586-57001608 AAAGGTTGCCAGCAGTAGGGAGG - Intergenic
1083474331 11:62906225-62906247 AGGGGTTGGTAGCAGTAGAGGGG + Intergenic
1097709329 12:62900993-62901015 AAGTGGTGGTGGCAGTAAGGGGG - Intronic
1099491154 12:83290281-83290303 AATTGTTGGTACCAGTGGGATGG + Intergenic
1100869618 12:98895739-98895761 AACTGTTGGTAGTAGTACAATGG - Intronic
1104952621 12:132448634-132448656 AACTTTTGGAAGCCGGAGGGAGG - Intergenic
1105400068 13:20083805-20083827 AAATGTTGGTAGAAGTTGGCTGG + Intronic
1107419296 13:40231881-40231903 AACTGTTTGTTGCAGTTGTGAGG + Intergenic
1108869735 13:54968839-54968861 TCCAGTTGGTGGCAGTAGGGAGG - Intergenic
1116046917 14:39754739-39754761 AAATAATGGTAGCAGTAGGATGG + Intergenic
1117615512 14:57530049-57530071 AATTGGTGGTAGGAGAAGGGTGG + Intergenic
1118657728 14:67970227-67970249 AATTAATGGTAGCAGTAGGGTGG + Intronic
1118678448 14:68214108-68214130 AACTGTTGTTTGCAGGAGGAGGG + Intronic
1119052971 14:71388811-71388833 AAATGTAGGTAGCACTAGGGAGG - Intronic
1119920752 14:78443889-78443911 AACAGTTAGTAGCATTAGGTTGG + Intronic
1120743398 14:88132216-88132238 GACTGTTGGTTGGCGTAGGGGGG - Intergenic
1121688898 14:95860612-95860634 AACTATTGTTTGCAGTGGGGTGG + Intergenic
1123540523 15:21285250-21285272 AACAGCTGGCAGCAGCAGGGAGG + Intergenic
1128167475 15:65478825-65478847 AAATGTTGGAAGCAGAAGGTGGG - Intronic
1128745889 15:70113845-70113867 ACCTGCTGGTAGCAGCAGAGTGG - Intergenic
1202948837 15_KI270727v1_random:12392-12414 AACAGCTGGCAGCAGCAGGGAGG + Intergenic
1137027461 16:35492302-35492324 AACTGTTGGGAGGCGGAGGGTGG - Intergenic
1139151991 16:64393331-64393353 AACTCTTAGTAGCAGAAGGTAGG - Intergenic
1139996718 16:70987769-70987791 AACAGTTGGCAGCAGGAGGATGG + Intronic
1143923325 17:10348305-10348327 AACTGCTGGAAGCAGTGGAGAGG - Intronic
1144074250 17:11702634-11702656 AACTGTTGGTAGCAGGTAAGAGG + Intronic
1144238002 17:13281283-13281305 AATAGTTGGTTGCAGTAGGGTGG - Intergenic
1144877391 17:18407270-18407292 AACTGTTGGTACCTGTGGGGAGG - Intergenic
1145154837 17:20537133-20537155 AACTGTTGGTACCTGTGGGGAGG + Intergenic
1147467039 17:40618219-40618241 AACCTCTGGCAGCAGTAGGGTGG + Intergenic
1147953785 17:44121438-44121460 TCCTGTTGGTGGCAGTAGGGGGG - Intronic
1150846997 17:68669207-68669229 AATTGTTGGGAGAAGGAGGGAGG + Intergenic
1155786860 18:29913137-29913159 AAAAGTTGTTAACAGTAGGGAGG + Intergenic
1159174293 18:64813943-64813965 CACTGTTGGCAGGAGTAGGGCGG - Intergenic
1163692935 19:18746916-18746938 AACAGCTGGGACCAGTAGGGCGG - Intronic
929044043 2:37773452-37773474 AGATGCTGGTAGCAGGAGGGAGG + Intergenic
930847465 2:55921630-55921652 AACTATTTGTAGCAGTGGGAGGG + Intronic
932736194 2:74256338-74256360 CACTTTTGGTAGCTGTGGGGAGG + Intronic
933022346 2:77209491-77209513 AATTCTTGGTTGCAGTAGTGGGG + Intronic
933351025 2:81152291-81152313 TACTTTTGGTATCATTAGGGAGG + Intergenic
936175412 2:110215676-110215698 ACCTGTTGGAAGCAGTAGAGTGG - Intergenic
940710156 2:157153354-157153376 AACTGTTGATTTCTGTAGGGAGG - Intergenic
940969362 2:159878360-159878382 AACTGTTGGTGGAAGAAGGCGGG - Exonic
1169953251 20:11072112-11072134 AACTGTTGTAAGCATTAGAGTGG - Intergenic
1172043757 20:32064437-32064459 AACTGTTGTTAGAAGAAGGGGGG + Intronic
1172075390 20:32292423-32292445 AATTGTTTGTAGAAGTTGGGGGG - Intronic
1177533088 21:22388580-22388602 AGATGTTGGTAGCGGTAGAGTGG + Intergenic
1178132635 21:29590721-29590743 AACTACTAGTAGCAGTTGGGAGG + Intronic
1178448667 21:32670761-32670783 AATTGCTGGTAACAGTTGGGAGG + Intronic
1181793676 22:25287515-25287537 GACTGGGGGCAGCAGTAGGGAGG + Intergenic
1184010813 22:41746744-41746766 AACAGTAGGTGGCAGCAGGGAGG + Intronic
1203296167 22_KI270736v1_random:44848-44870 AGATGCTGGTAGCAGGAGGGAGG + Intergenic
950667214 3:14504972-14504994 AGCTGTGGGTACCAGGAGGGAGG + Intronic
952868503 3:37875146-37875168 AACTGTTTGTAGCACTGGGTTGG + Intronic
954156710 3:48689036-48689058 ATCTGTGGATAGTAGTAGGGAGG - Intronic
955130784 3:56165553-56165575 AACAGCTGTCAGCAGTAGGGTGG - Intronic
955226556 3:57065043-57065065 AACTGTAGGGAGAAGTAGGGTGG + Intronic
955581345 3:60426410-60426432 GAATGTTTGTAGCAGTAGGGAGG - Intronic
958181180 3:90063051-90063073 AAGGGTTGGTAGCAGAAGCGAGG - Intergenic
958271548 3:91506053-91506075 TAGTGTTGGTTGCATTAGGGAGG + Intergenic
960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG + Intergenic
963639537 3:147841385-147841407 AACTGTAAGTAACAGCAGGGTGG + Intergenic
963778255 3:149462137-149462159 AACTGTTTGTATGAGTAGGAGGG - Intergenic
966226056 3:177599264-177599286 AACTGGTGGAAGCAGAGGGGAGG + Intergenic
967236014 3:187384295-187384317 AACTATCTGTAACAGTAGGGTGG - Intergenic
969848199 4:9936152-9936174 AACTGATGGTATCAGGAGGTGGG + Intronic
972689457 4:41382463-41382485 TACTGTAGGCAGCAGTAGGGAGG + Intronic
973639062 4:52885594-52885616 AACAGGCGGTAGCAGGAGGGAGG + Intronic
979784430 4:124697814-124697836 AAGTGTTGCTAGAAGTGGGGTGG + Intronic
982997119 4:162363521-162363543 AATTGCTGGTAGCAGAAGAGTGG + Intergenic
983219995 4:165034799-165034821 AACTGTTCATAGCAGTAGTCGGG - Intronic
986610857 5:9565652-9565674 GACTGTTGGTGGCAGCAGTGTGG + Intergenic
987004380 5:13694749-13694771 AAATGTTGTTAGCAAAAGGGTGG - Intronic
987317101 5:16733938-16733960 TCCTGCTGGTAGCAGGAGGGAGG - Intronic
988797505 5:34665823-34665845 AACTGTGGGTGGCAGTGGGGTGG - Intronic
990297645 5:54419743-54419765 AACTGTTAGTAACAGTAAGAAGG - Intergenic
991280133 5:64904089-64904111 AACTGTTTGTAGAAGCATGGTGG - Intronic
996804900 5:127443582-127443604 AAGGGGTGGTAGAAGTAGGGAGG - Intronic
998666597 5:144305218-144305240 AACTGTTTCTTGGAGTAGGGTGG + Intronic
999580514 5:153033360-153033382 AACCGGTCGCAGCAGTAGGGTGG - Intergenic
1001081412 5:168670344-168670366 ACCTGCTGGTAGTAGTGGGGTGG - Intronic
1001278910 5:170371919-170371941 ACTAGTTGGTATCAGTAGGGGGG - Intronic
1002926119 6:1606619-1606641 AACTGTGGGCTGCAGTGGGGAGG - Intergenic
1004525831 6:16406866-16406888 AACTGGACATAGCAGTAGGGTGG + Intronic
1008983569 6:57515041-57515063 TAGTGTTGGTTGCATTAGGGAGG - Intronic
1009171624 6:60407935-60407957 TAGTGTTGGTTGCATTAGGGAGG - Intergenic
1009443300 6:63708777-63708799 CCCTTTTGGTAGCAGTAGGCAGG - Intronic
1010186277 6:73146838-73146860 AAGTGTTTGTAGCAAAAGGGAGG - Intronic
1018065115 6:160119111-160119133 AAATGATGGCAGCAGCAGGGAGG - Intergenic
1018433043 6:163737848-163737870 AACTGTGGGCAGCAGGTGGGGGG + Intergenic
1020066553 7:5192312-5192334 AAATGGTAGTAGTAGTAGGGTGG + Intronic
1021345332 7:19520487-19520509 AACTGTTGTTCATAGTAGGGAGG + Intergenic
1022570080 7:31444097-31444119 AACTCTTGAAAGCAGTAGGATGG - Intergenic
1026164026 7:67894210-67894232 AACAGTAGGTAGCAGTAGGGAGG - Intergenic
1028532005 7:91848653-91848675 AACAGGTGGTAGCAGTTGGAGGG - Intronic
1028905366 7:96148307-96148329 AGCTGTTCTGAGCAGTAGGGCGG - Intronic
1030204003 7:106934819-106934841 TATTGTTTGTAGCAGTAGGGGGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034470836 7:151253565-151253587 AACTGCTGGTGGCAGGAGAGCGG + Intronic
1036477905 8:9110403-9110425 AACTGTTGGTGGCAGGAGAATGG - Intronic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1044519350 8:93179684-93179706 ATCTTTTGGGAGCACTAGGGAGG - Intergenic
1044947355 8:97401996-97402018 AACTATTGGTAGCTGTTGGGTGG - Intergenic
1046698866 8:117377136-117377158 ATCTGTTGGTAGCTATAGGAGGG - Intergenic
1047670595 8:127142070-127142092 AACTGTTGGGTGTAGTAGGGTGG + Intergenic
1048173407 8:132129776-132129798 ACCTGGTGGAAGCTGTAGGGTGG + Exonic
1050334689 9:4579284-4579306 AACTGTTGGAAGCACAGGGGTGG - Intronic
1051342862 9:16127850-16127872 AGCTGTGGGCAGGAGTAGGGTGG + Intergenic
1052705504 9:31989447-31989469 AAAAATTGGTACCAGTAGGGTGG - Intergenic
1053025009 9:34722205-34722227 GAGTGATGGTAGCAGTAGAGAGG + Intergenic
1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG + Exonic
1056449836 9:86706346-86706368 TACTGCTGGTGGCATTAGGGGGG + Intergenic
1057181312 9:93032267-93032289 CTCTGTGGGAAGCAGTAGGGTGG - Intronic
1062151182 9:135019867-135019889 AGCTCTTCATAGCAGTAGGGTGG - Intergenic
1186168823 X:6855971-6855993 AAATGTGGCTAGCAGTTGGGGGG + Intergenic
1200796581 Y:7346363-7346385 AACTTTTGGTGGCTGGAGGGAGG + Intergenic