ID: 960150398

View in Genome Browser
Species Human (GRCh38)
Location 3:114243377-114243399
Sequence CTATTTCTGAACCTTTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960150398_960150401 14 Left 960150398 3:114243377-114243399 CCACTAAAAAGGTTCAGAAATAG No data
Right 960150401 3:114243414-114243436 TATTCTTTCTTGATATAGAAGGG No data
960150398_960150400 13 Left 960150398 3:114243377-114243399 CCACTAAAAAGGTTCAGAAATAG No data
Right 960150400 3:114243413-114243435 TTATTCTTTCTTGATATAGAAGG No data
960150398_960150402 18 Left 960150398 3:114243377-114243399 CCACTAAAAAGGTTCAGAAATAG No data
Right 960150402 3:114243418-114243440 CTTTCTTGATATAGAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960150398 Original CRISPR CTATTTCTGAACCTTTTTAG TGG (reversed) Intergenic
No off target data available for this crispr