ID: 960156297

View in Genome Browser
Species Human (GRCh38)
Location 3:114299968-114299990
Sequence CTCTCAGAGCAGTGGCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960156297_960156300 12 Left 960156297 3:114299968-114299990 CCCTTAAGCCACTGCTCTGAGAG 0: 1
1: 0
2: 1
3: 28
4: 182
Right 960156300 3:114300003-114300025 ACTATGATTTTGATGCATCGTGG 0: 1
1: 0
2: 0
3: 1
4: 59
960156297_960156301 13 Left 960156297 3:114299968-114299990 CCCTTAAGCCACTGCTCTGAGAG 0: 1
1: 0
2: 1
3: 28
4: 182
Right 960156301 3:114300004-114300026 CTATGATTTTGATGCATCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960156297 Original CRISPR CTCTCAGAGCAGTGGCTTAA GGG (reversed) Intronic
900856417 1:5188779-5188801 GTGTCAGAGCAGTGGGTGAAAGG - Intergenic
901864574 1:12096054-12096076 CTCTCAGAGATGAGGCTTATTGG + Intronic
903218054 1:21854058-21854080 CTCTCTGAGCAGGCGCTGAAGGG + Intronic
903818526 1:26083038-26083060 CCCTCAGAGCAGTGGGGTTAGGG + Intergenic
904776654 1:32912866-32912888 CTCTGAGAGCAGAGGCCTTACGG + Intergenic
905892162 1:41524369-41524391 GTCTCAGATCAGTGGATAAACGG + Intronic
907142996 1:52205628-52205650 CTCCCAGAGCACTGGGTTACAGG + Intronic
911171432 1:94774412-94774434 CCCTCAGAGCAGTGTCTGAGTGG + Intergenic
912488470 1:110047735-110047757 CTCTCAGACCTGTGTCTGAATGG + Intronic
914699279 1:150116779-150116801 CTCTCAGAGGAATCACTTAAGGG - Intronic
916274663 1:162980688-162980710 CACTCTGAGCAGTGACTTAGTGG + Intergenic
917660643 1:177173791-177173813 ATTTCAGAGCAGTGCCTCAAGGG - Intronic
919434131 1:197535671-197535693 TTCTCAGAGAAGTGGTTTTAAGG - Intronic
920086340 1:203420549-203420571 CTCTTGGAGCAGTGACTTAGAGG - Intergenic
921584212 1:216928817-216928839 CACTCAGAGTAGTGTCTTCAAGG - Intronic
922602119 1:226864420-226864442 TTCTGAGTGCAGTGGCTTATGGG + Intergenic
922984536 1:229856108-229856130 CTCTCAAGGCAGTGGCTTTGGGG - Intergenic
923288094 1:232516583-232516605 CTCTCAGAGCTGTTCCATAATGG - Intronic
923913117 1:238471825-238471847 CTTTCAAGTCAGTGGCTTAAGGG + Intergenic
924173897 1:241369696-241369718 CTCTCTCTGCAGTGGCTCAACGG - Intergenic
1063249619 10:4259681-4259703 CCCTCAGAGCAGTGGCCATATGG + Intergenic
1063630360 10:7727989-7728011 GTGTCTGAGCAGTAGCTTAAGGG - Intronic
1067472391 10:46546550-46546572 CTCCCAGAGCAGGGCCTGAAAGG + Intergenic
1067500549 10:46800950-46800972 CTGTCAGAGCAATGTTTTAAAGG + Intergenic
1067573460 10:47388527-47388549 CTCTCAGCATGGTGGCTTAAAGG - Intergenic
1067594036 10:47538952-47538974 CTGTCAGAGCAATGTTTTAAAGG - Intronic
1067641146 10:48047065-48047087 CTGTCAGAGCAATGTTTTAAAGG - Intergenic
1070327182 10:75396704-75396726 CTCTCAGAGCTGTGACTCCACGG + Intergenic
1072139296 10:92575239-92575261 CTCTCAGAGGAGCTGCTTCAAGG - Intergenic
1072652706 10:97308039-97308061 CTGTCAGAAGAGTGGATTAAAGG + Intergenic
1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG + Intronic
1074756780 10:116629634-116629656 CTCTGAGAGCAGTGGCCAAATGG + Intronic
1074802069 10:117009937-117009959 CTCTCTGAGCACTGTCTTCACGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075588960 10:123677714-123677736 CTCTCACAGCTGGGGCTTCACGG + Intronic
1075984889 10:126776462-126776484 TTCTCAAGGCAGTGGCTTAGGGG - Intergenic
1076328094 10:129644171-129644193 CTCCCAGAGCAGTGCTTTAGGGG + Intronic
1077533967 11:3110225-3110247 CTCCCAGAGCAGTGGGGTGAAGG - Intronic
1078059538 11:8034213-8034235 CTGTCAGAGCAGGTGCTTAGGGG - Intronic
1080335623 11:31192466-31192488 GTCAAAGAGCAGTGGCTTACTGG - Intronic
1081570643 11:44288706-44288728 CTCTCAGAAGAGCTGCTTAAAGG - Intronic
1081766856 11:45617272-45617294 CTCTCAGGGCAGTGTCTGATTGG - Intergenic
1087132007 11:94676736-94676758 ATCTCAAAGCAGGGGCTTATAGG + Intergenic
1087940578 11:104092090-104092112 CTCTCTGAGCCATGGCTTAGGGG - Intronic
1088864754 11:113836929-113836951 CACATAGAGCAGTGGCTTCATGG - Intronic
1088932664 11:114367662-114367684 TTCTCAGAGCAGTAGATAAAAGG - Intergenic
1089295712 11:117466307-117466329 CTCTTAGTGCAGTGTCTTCAAGG - Intronic
1089764234 11:120751481-120751503 CTCTCAGAGCACAGGCTTATGGG - Intronic
1092436865 12:8455187-8455209 CTTTCATGGCAGTGGCTTACAGG - Intergenic
1094569738 12:31631244-31631266 CTCTCAAGGCAGTGGCTTAGGGG - Intergenic
1105816683 13:24042589-24042611 TTCTCAGAGCACTGGCTCATGGG + Intronic
1106200581 13:27533450-27533472 CTCACAGAACTGTGGCTAAAGGG - Intergenic
1106895417 13:34294993-34295015 CTCTCAGTGCAGTAGCTTGGGGG + Intergenic
1110184302 13:72655540-72655562 CACTTAGAGCAGTGCCTGAAAGG - Intergenic
1110883626 13:80604746-80604768 CTGTCAGAGGAGTTGCTTGAAGG - Intergenic
1112830276 13:103441080-103441102 CTCTCAGAGCAGTGTTTTTAGGG - Intergenic
1112928097 13:104702216-104702238 CTCTCAAAGCAGTGTTTTTATGG + Intergenic
1115087230 14:29532233-29532255 CTCTCAGTGGATAGGCTTAAAGG - Intergenic
1115337075 14:32252705-32252727 CACTCCAAGCAGTGACTTAAAGG + Intergenic
1118914776 14:70093767-70093789 CTCTCTGAGCAGTGGCAGAATGG - Intronic
1119432833 14:74579437-74579459 CTCTCAGTGCAGTAGGTTAAAGG + Intronic
1119689446 14:76659888-76659910 CTGTCAGAGCAGTCGAATAATGG - Intergenic
1120143903 14:80958389-80958411 ATCTGAGAGTGGTGGCTTAAGGG - Intronic
1121274216 14:92656878-92656900 CTCTCTGAGCTGTGGCTTCTTGG - Intronic
1122636114 14:103130440-103130462 CTCTGAGAGCGGTGGCTACAGGG - Intronic
1125388782 15:39169238-39169260 CACTTAGAGCAGTGCCTAAATGG - Intergenic
1127229177 15:56970134-56970156 ATCTCAGAGCACTGGGGTAAAGG + Intronic
1130857237 15:87851255-87851277 TTCGCAGAGAAGTGGCTTGAGGG - Intergenic
1131075590 15:89493270-89493292 CGCTGAGGGCAGTGGCTTCAGGG - Intronic
1132127589 15:99241813-99241835 CCCTCAGGGCAGTGGCTTTTAGG + Intronic
1132997246 16:2829738-2829760 CTCTAAGGGCAGTGCCTTGAGGG + Intergenic
1134086770 16:11362681-11362703 CTCTCAGAGCCATTTCTTAATGG - Intronic
1136771883 16:32847461-32847483 ATCTCAGAGCCTTGGCTGAAAGG + Intergenic
1141769914 16:86083557-86083579 CTCACAGAGCAGGGGCTTCATGG - Intergenic
1203074303 16_KI270728v1_random:1109550-1109572 ATCTCAGAGCCTTGGCTGAAAGG + Intergenic
1142502325 17:339998-340020 CCCTCAGAGCAGAGGCACAAAGG + Intronic
1143837307 17:9702542-9702564 ATTTCAGAGCAGTGGATGAAGGG + Intronic
1144431856 17:15199323-15199345 CTCTCAGAGCTCTGTCTTAGAGG - Intergenic
1144799427 17:17914773-17914795 TTCTCAGAGCAGGGGCTTGGAGG + Intronic
1146457301 17:33017838-33017860 CTCTCAGAGCTGTGCCGTGAGGG - Intronic
1148046312 17:44747205-44747227 CTCTGGGAGCAGCTGCTTAATGG - Intronic
1150247362 17:63686612-63686634 CTCTCAAGGCAGTGGCACAAGGG - Intronic
1150722976 17:67628987-67629009 ATCTCAGAGCAGAGGCATAAGGG + Intronic
1151238000 17:72735541-72735563 AACTCAGTGCAGTGGCTCAAGGG - Intronic
1151686874 17:75652652-75652674 ATATCAGAGGAGTGGCTTATGGG + Intronic
1154064284 18:11092075-11092097 CACTCAGAGAGGTGGCTAAAAGG + Intronic
1156453219 18:37278437-37278459 CTCTCAGACCAGGGGCTGGAGGG + Intronic
1157695929 18:49723677-49723699 CTCTCACAGCCGTGGCTCAAAGG + Intergenic
1158941008 18:62405928-62405950 CTCTCAGCGCTGAGGATTAATGG - Intergenic
1160303033 18:77703824-77703846 TTCTCAGAGCAGAGGCTTCTCGG + Intergenic
1161214202 19:3085164-3085186 CACTCACAGCAGTGCCTTCATGG - Intergenic
1163400908 19:17091874-17091896 CTCTCAGAGATGGGGCTGAAGGG - Intronic
1166087155 19:40484416-40484438 TTCACAGTACAGTGGCTTAATGG + Intronic
927158480 2:20236155-20236177 TGCTCAGGGCAGTGGCTGAAGGG + Intergenic
927377693 2:22437403-22437425 CTCTCAAAGCACTGGATTACAGG - Intergenic
928329768 2:30348702-30348724 CTTTCAGCGTGGTGGCTTAATGG - Intergenic
929052813 2:37852570-37852592 CTGTCACAGAAGTGGCTTTATGG - Intergenic
929863626 2:45699760-45699782 CTTAGAGAGCAGTGGCTTAGAGG + Intronic
933471210 2:82727531-82727553 ATCTCAGAGCAGTAGTTTTATGG + Intergenic
934980498 2:98835906-98835928 CTTTCTGAGCAGTGGGTTCAGGG - Intronic
937076753 2:119112865-119112887 CTCTCAAAGGGGTGGCTCAAGGG - Intergenic
937302295 2:120850671-120850693 CAGTCAGAGCAGAGGCTTGAGGG + Intronic
937846874 2:126588326-126588348 CACTCAGAGGAGTGGATTGAGGG - Intergenic
938170909 2:129076015-129076037 CTGCCAGAGCAGGAGCTTAAAGG - Intergenic
938597424 2:132802125-132802147 CTCTCAGATCAGGTGCTGAACGG - Intronic
939095501 2:137828957-137828979 CTCTCAAGGCAGTGGCTTAGGGG - Intergenic
940361179 2:152797810-152797832 CTCTCAGGGCAGTGGCTTAGGGG - Intergenic
940372627 2:152919942-152919964 TTCTCAAAGCAGTGCATTAAGGG + Intergenic
940988746 2:160076255-160076277 CTCACAGTGCAGTGGTTAAAAGG + Intergenic
941720974 2:168812571-168812593 CTCTCAAGGCAGTGGCTTAGGGG + Intronic
944134282 2:196381179-196381201 GTCACAGAACAGTGTCTTAAGGG - Intronic
945538652 2:211054343-211054365 CTATCAGACCACTGGCTTCAGGG - Intergenic
946504964 2:220289266-220289288 AACTCAGAGCAGTGGATTCATGG - Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
948069084 2:235105355-235105377 CTCTGAAGGCAGTGGCTTAGAGG + Intergenic
948236733 2:236396840-236396862 CTCTCAGAGCAGGTGGATAATGG + Intronic
948762275 2:240199516-240199538 CTCTGAGAGCTGTGGCTACACGG + Intergenic
1170698503 20:18682256-18682278 CCCTCAGAGTAGTGGCCTGATGG - Intronic
1171294308 20:24004259-24004281 CTCTCAAGGCAGTGGCTTAGGGG - Intergenic
1171361938 20:24592432-24592454 CTCTCTGAGCAATGTCTTGACGG - Intronic
1177523757 21:22266322-22266344 CTCTCAAGGCAGTGGCTTGGGGG + Intergenic
1177793245 21:25743192-25743214 CTCTCAGACCATTTGCTTTAAGG - Intronic
1178053125 21:28769343-28769365 CTCTCAGCTCAGTAGCATAAGGG + Intergenic
1179488038 21:41723185-41723207 TCCTCAGAGCAGAGGCTTCAAGG - Intergenic
1182989921 22:34757636-34757658 TTCTCAGAGCAGTGGATTTGGGG - Intergenic
1184805071 22:46789720-46789742 TTCTCAAAGCAGTGGGTGAAAGG + Intronic
952063571 3:29540739-29540761 CACTCAGAGTATTGGCATAAAGG - Intronic
955995207 3:64673301-64673323 CACTCTGAGAAGTGGCTTAATGG + Intronic
960156297 3:114299968-114299990 CTCTCAGAGCAGTGGCTTAAGGG - Intronic
960420497 3:117439614-117439636 CGCTCACAGCAGTGGATTGAAGG - Intergenic
960420634 3:117441009-117441031 CACTCAGAACAGTGGCATATAGG - Intergenic
966961776 3:184946976-184946998 CTCTCAAGGCAGTGGCTTAGAGG + Intronic
966962840 3:184957751-184957773 TTCTCAAGGCAGTGGCTTAGGGG + Intronic
968955564 4:3717133-3717155 CATTCAGAGCAGTGGCCTCATGG - Intergenic
972439278 4:39069994-39070016 CTCTCAGTGCAGTAGCGGAAAGG + Intronic
974274529 4:59701091-59701113 CTCCTAGAGAAGTGGTTTAATGG - Intergenic
979139226 4:117151376-117151398 GCCTCCCAGCAGTGGCTTAAAGG - Intergenic
981126267 4:141110399-141110421 CTCTCAAGGCAGTGGCTTAGGGG - Intronic
982248417 4:153379445-153379467 CTCCCAGAGCACTGGATTACAGG - Intronic
984077491 4:175201458-175201480 CTCCCAGTGCAGTGGCTTAGGGG + Intergenic
985721878 5:1493747-1493769 CTCCCAGAGCAGTGGGTCCATGG + Intronic
986456911 5:7928648-7928670 CTCTCACAGCTGTGGATGAAGGG + Intergenic
987108260 5:14662060-14662082 CAGTCAGAGTAGAGGCTTAATGG - Intergenic
987268860 5:16284368-16284390 CTCTCAGAGGAATGCCTTTAAGG - Intergenic
987670984 5:21008213-21008235 CTCACAAAGCAGAGGCTTAGGGG + Intergenic
988682473 5:33497423-33497445 CTCTCAAGGCAGTGGCTTAGAGG + Intergenic
990455131 5:55978391-55978413 CTCTCAGAGCCGTGGAGCAAAGG - Intronic
993171509 5:84425685-84425707 CTCTCAAGACAGTGGCTTAGGGG - Intergenic
993238276 5:85344683-85344705 GTGTCTGAGCAGTGGCTAAAAGG + Intergenic
993838940 5:92852213-92852235 CTCTCAGTGCGATGTCTTAAAGG - Intergenic
995588327 5:113672272-113672294 CTCTCAAGGCAGTGGCTTAGGGG - Intergenic
999289336 5:150413385-150413407 CTCTCAAGGCAGTGGCTTAGGGG + Intergenic
999540130 5:152562137-152562159 CTTTGAGACCAGTGGATTAAAGG - Intergenic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1000413717 5:160961272-160961294 CTCACAGAGCAGTGCTTTAAGGG + Intergenic
1000551278 5:162668129-162668151 ATCTCAAAGCAGGGGCTTACAGG + Intergenic
1004002482 6:11607849-11607871 ATTTCAGAGCACTGGCTTCAAGG + Intergenic
1004706206 6:18126138-18126160 CTGGCTGAGCAGTGGCTCAAGGG + Intergenic
1005336543 6:24802286-24802308 CTCTCTAGGCAGTGGCTTAGGGG + Intronic
1005531037 6:26705988-26706010 ATCTCTGAACAGTGGCGTAAAGG + Intergenic
1005539759 6:26795648-26795670 ATCTCTGAACAGTGGCGTAAAGG - Intergenic
1005718572 6:28577861-28577883 ATCTCAGAGAAGGGGCTTACAGG - Intronic
1005801970 6:29435236-29435258 CTCACAGAGCAGCAGCTTGAAGG + Intronic
1012606264 6:101161559-101161581 ATCTCAGAGCAGTGGTAAAATGG - Intergenic
1014205808 6:118654153-118654175 CTCTCAAAGCACTGGATTACAGG - Intronic
1014767062 6:125418855-125418877 CTCTCAAGGCAGTGGCTTAGAGG + Intergenic
1015429118 6:133109683-133109705 CTCTCTGAGCAGTGGGCTAGAGG + Intergenic
1017237626 6:152133139-152133161 TTGTAAGAGCAGTGGCTGAAAGG + Intronic
1019269417 7:138654-138676 ATCTCAGAGCTGGGGCTTACAGG + Intergenic
1022402249 7:30050781-30050803 CTCTCTGAGCATTGTTTTAAGGG + Intronic
1022419027 7:30203036-30203058 CTCTCGAGGCAGTGGCTTAGAGG - Intergenic
1022467040 7:30658977-30658999 CTAGCAGAGCAGAGGCTCAAAGG - Intronic
1022853117 7:34286064-34286086 CTCCCTGAGGAGTGGCATAAGGG - Intergenic
1023970703 7:44988639-44988661 ATCTCATAGCAGTGGCAGAATGG - Intergenic
1024851773 7:53726093-53726115 CTCTCAGGGCATAGGGTTAAGGG - Intergenic
1025051042 7:55735058-55735080 TTCTCAAGGCAGTGGCTTAGGGG - Intergenic
1027515485 7:79137179-79137201 CTCTCAGAGAAGGGTCTTACGGG - Intronic
1029453302 7:100654918-100654940 GGCTCAGAGCAGTGGCTTGAGGG + Intronic
1030453777 7:109746703-109746725 CTCTAAATGCAGTGGCATAATGG - Intergenic
1031998512 7:128248655-128248677 TTCTCAAACCAGTTGCTTAAGGG + Intronic
1033444267 7:141406283-141406305 CACTCAGGGCAGTGGCTTCATGG - Intronic
1037424490 8:18740813-18740835 CTCACAGAGCTGAGGTTTAAGGG - Intronic
1037481206 8:19307634-19307656 CTCCCAGAGCACTGGATTACAGG - Intergenic
1037885817 8:22595701-22595723 AGCTCAGAGCAGTGGCTGATGGG + Intronic
1039756332 8:40526993-40527015 CAGTCAGAGTAGTGGATTAATGG + Intergenic
1042516694 8:69666183-69666205 GTCTCAGAGCACTGGCTTCTGGG + Intergenic
1043871865 8:85441980-85442002 CTCTTAGAGCCAAGGCTTAATGG - Intronic
1048819903 8:138370888-138370910 CTATCAGAGCAGTGGTTTTCAGG + Intronic
1049594262 8:143476218-143476240 CTCTCTGAGCTGTGGATGAAGGG - Intronic
1050482131 9:6098126-6098148 CTGTCAGAGCAATGGCAAAAAGG + Intergenic
1050496975 9:6253320-6253342 TTTTCATAGCAGTGGCATAAAGG - Intronic
1051633266 9:19159336-19159358 CTCCCAGAACAGTTTCTTAATGG + Intergenic
1054827974 9:69591773-69591795 CTCTCAAGGCAGTGGCTTAGGGG - Intronic
1057487603 9:95498267-95498289 CTTTCATAGCAGTGGCATTATGG + Intronic
1057718538 9:97514673-97514695 CTGTAAGAGCAGTGGATGAAAGG - Intronic
1057745141 9:97745401-97745423 ATCTGAGAACAGTGGCCTAAAGG + Intergenic
1059382918 9:113942268-113942290 CACACAGAGGAGTGGCTTCATGG + Intronic
1060015974 9:120086778-120086800 CTCTCCTAGAAGTGGCTTCAAGG - Intergenic
1062182529 9:135198312-135198334 GGCTCAGAGCAGTGGCTGCAAGG - Intergenic
1185521705 X:745134-745156 CTCTAAGAGCAGAGCCTTCACGG + Intergenic
1186207197 X:7213257-7213279 CTCTCAAGGCAGTGGCTTAGGGG + Intergenic
1186336130 X:8590588-8590610 CTCTGGGGGCTGTGGCTTAATGG - Intronic
1186899921 X:14043175-14043197 CTCTTAAGGCAGTGGCTTAGGGG + Intergenic
1186900576 X:14051030-14051052 CACTGAGACCATTGGCTTAAAGG + Intergenic
1188921185 X:35979682-35979704 CTCACAAGGCAGTGGCTTAGAGG + Intronic
1189436611 X:40998377-40998399 CTCTCTGGACAGTGCCTTAAAGG + Intergenic
1192471947 X:71406802-71406824 CTGTCAGAGCTGTGGCATACAGG - Intronic
1194128225 X:90046369-90046391 CTCTCAAGGCAGTGGCTTAGGGG - Intergenic
1194824812 X:98548869-98548891 CTTTCATAGCAGTGGGTTAGGGG - Intergenic
1195065220 X:101233696-101233718 CCCTCAGGCCAGTGGCTTACAGG + Intronic
1200110732 X:153739666-153739688 CTTTCAGGGCAGTTCCTTAAAGG + Intronic
1201579014 Y:15491846-15491868 CTCTCAAGGCAGTGGCTTAGAGG + Intergenic