ID: 960156776

View in Genome Browser
Species Human (GRCh38)
Location 3:114304662-114304684
Sequence CAGCACTTCCTCCATTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960156771_960156776 20 Left 960156771 3:114304619-114304641 CCAGGTCCTGTAGTATATAACCT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 960156776 3:114304662-114304684 CAGCACTTCCTCCATTAGCATGG 0: 1
1: 0
2: 0
3: 14
4: 179
960156772_960156776 14 Left 960156772 3:114304625-114304647 CCTGTAGTATATAACCTTTCTAT 0: 1
1: 0
2: 0
3: 17
4: 216
Right 960156776 3:114304662-114304684 CAGCACTTCCTCCATTAGCATGG 0: 1
1: 0
2: 0
3: 14
4: 179
960156773_960156776 0 Left 960156773 3:114304639-114304661 CCTTTCTATTCTCTTAGCAGACC 0: 1
1: 0
2: 0
3: 13
4: 166
Right 960156776 3:114304662-114304684 CAGCACTTCCTCCATTAGCATGG 0: 1
1: 0
2: 0
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960156776 Original CRISPR CAGCACTTCCTCCATTAGCA TGG Intronic
902079457 1:13811410-13811432 CAGCACTGCCTCCAGTTACAAGG - Intronic
903671677 1:25039621-25039643 CAGGACTTCATCCATCACCAGGG + Intergenic
904127730 1:28253526-28253548 CAGCAGCTTCTCCATCAGCATGG - Intergenic
905840981 1:41177831-41177853 GAGAACTTCCCCAATTAGCAAGG + Intronic
906688745 1:47779040-47779062 CAGGCCTCCCTCCTTTAGCATGG + Intronic
907381585 1:54095320-54095342 CAGCACATGTTCCCTTAGCAAGG - Intronic
911061270 1:93750212-93750234 CAGGACTGCCTCCTTCAGCAAGG + Intronic
911205639 1:95089600-95089622 CAGCCATTTCTCCACTAGCAGGG + Intergenic
915026142 1:152831427-152831449 TAGAACTTCCTCCTTTAGCCTGG - Intergenic
917399092 1:174626369-174626391 CAGCACTTCCTTCAAGAACAAGG + Intronic
918248740 1:182683379-182683401 CAGCACCTCCTCCATTTTCCAGG + Intronic
919820397 1:201468742-201468764 CAGCACGCCCTCCTTGAGCACGG + Exonic
920101350 1:203518864-203518886 CTGCACTTCCTCCTTAAACAAGG + Intergenic
924690932 1:246349487-246349509 CAGCACCTCCTCAAATAGCTGGG - Intronic
1063329990 10:5148055-5148077 CAGCATTTCCTCCAGTAGCCAGG + Intergenic
1063907486 10:10796097-10796119 CAGCACTTCTTCCATCTGCTTGG - Intergenic
1065386201 10:25135622-25135644 TATCACTTCATCCATTAGCATGG - Intergenic
1065673459 10:28147832-28147854 CAGCACTTCGTCCATGTGAATGG + Intronic
1065748228 10:28861209-28861231 CAACACTGCCTGCATTAGGAAGG - Intronic
1065795891 10:29308144-29308166 CAGCACGTCTTTCCTTAGCAGGG - Intronic
1065947074 10:30614522-30614544 CAGCATGTCTTCCCTTAGCAGGG + Intronic
1067067692 10:43112951-43112973 CAGGACTGCCTCCGTAAGCAGGG + Exonic
1067761393 10:49050043-49050065 CAGCTCATCTTCCATCAGCAGGG + Intronic
1067845442 10:49716109-49716131 TAGAACTTCCTCCTTTAGCTCGG - Intergenic
1067903220 10:50263580-50263602 TCGAACTTCCTCCATTAGCTCGG - Intergenic
1068702730 10:60037107-60037129 CAGCACTTGATAGATTAGCATGG - Intronic
1070003550 10:72400148-72400170 TACCACTGCCTCTATTAGCAAGG + Intronic
1070115245 10:73522422-73522444 CAGCATTTCCTGCATGAGCAAGG - Intronic
1071345119 10:84685065-84685087 CACCACTTCCCCCCTGAGCAGGG + Intergenic
1071486154 10:86103978-86104000 CCGCACTTCCCTCATAAGCATGG + Intronic
1071740696 10:88355155-88355177 TAGAACTTCCTCCTTTAGCTTGG + Intronic
1073491762 10:103857077-103857099 GGGCACTACCTCCATGAGCAAGG + Intergenic
1073722521 10:106189426-106189448 CAGCAGTACCTACATCAGCATGG - Intergenic
1075643561 10:124082734-124082756 CAGCACTTCCTTCCTTTTCATGG - Intronic
1077251045 11:1560861-1560883 CAGCACCTCCTCCTTTGGCCAGG - Intronic
1077513140 11:2982475-2982497 CAGCACCTCCTATACTAGCAAGG + Intronic
1078971844 11:16422776-16422798 TGTCACTTCCTCTATTAGCATGG - Intronic
1080409693 11:32011894-32011916 CAGACCTTCCTTCATTAGCATGG - Intronic
1081527124 11:43934869-43934891 CAGTTCTTCAGCCATTAGCAGGG - Intronic
1081799621 11:45848819-45848841 CAGCACTCACTCTCTTAGCAGGG - Intronic
1082557028 11:54574804-54574826 CTGAACTTCCTCCTTTAGCTCGG - Intergenic
1085529007 11:77180657-77180679 CAGCCCTTCATCCTTTTGCATGG - Intronic
1088345585 11:108820662-108820684 CATGGCTTCCTCCCTTAGCAAGG - Intronic
1091283346 11:134394610-134394632 CCACTCTTCCTCCATGAGCAAGG - Intronic
1093326855 12:17786285-17786307 CAGCGCTCTCTCCATTATCATGG + Intergenic
1097961289 12:65534140-65534162 CAGCACTACCTGAATGAGCAAGG - Intergenic
1101755737 12:107619339-107619361 CAGGTCTTCCTCCTTTAACAGGG - Intronic
1101992440 12:109498127-109498149 TAGCACATCCTCCATAACCACGG + Intronic
1102268910 12:111513400-111513422 CAGCTACTCCTCCAGTAGCAAGG - Exonic
1102633944 12:114306065-114306087 CTGCTCTTACTCCATTAGCTAGG + Intergenic
1103865314 12:124046950-124046972 CAGCAATTCCTTCATTTCCAGGG - Intronic
1108244381 13:48499977-48499999 CAGCTCTGTCCCCATTAGCACGG - Intronic
1108868275 13:54948499-54948521 CAGCACTTCGTCCATTTAAAAGG + Intergenic
1109020081 13:57079318-57079340 CAGCATTTTCTCCATTTGAAAGG + Intergenic
1111043003 13:82775523-82775545 AAGAACTTCATCTATTAGCATGG - Intergenic
1115507439 14:34105904-34105926 CAGGACTGCCTTCATGAGCATGG + Intronic
1116312871 14:43347620-43347642 CCGCACTGCCTCCATTGGCTGGG + Intergenic
1117767176 14:59095357-59095379 CAACACTTCCTCCATCTGGAGGG + Intergenic
1118678692 14:68216739-68216761 TATCACCTCCTCCATCAGCAGGG + Intronic
1119172025 14:72542966-72542988 CAGCACTTCCTCTATTGACTGGG - Intronic
1119658653 14:76435312-76435334 CAGCAGTGCCCCCATCAGCATGG + Intronic
1121666662 14:95677490-95677512 CAACACTTTCTCTGTTAGCACGG - Intergenic
1123696541 15:22882886-22882908 CAGCAGCTCCTCCATGACCACGG + Exonic
1124132360 15:27002362-27002384 TAGCACTTCCTCCCTCAGCATGG + Intronic
1125062703 15:35443376-35443398 CAGCTCTTACTCCAGGAGCAAGG + Intronic
1125084181 15:35711448-35711470 CAGCTCTTCCGCCATTAGGCAGG - Intergenic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1125608704 15:40956850-40956872 CAGCTCTTCCTCCAGCTGCAGGG + Intergenic
1127066250 15:55242570-55242592 CACCACGTTCTTCATTAGCAAGG + Intronic
1127459081 15:59181537-59181559 CAGCACTTACTTCAAGAGCATGG + Intronic
1127600738 15:60534240-60534262 CAGCACTTCCACCCTTGGAATGG + Intronic
1128164003 15:65445221-65445243 GAGCACAGCCTCCATTAGTAAGG - Exonic
1128854042 15:70992251-70992273 TCGAACTTCCTCCATTAGCTCGG + Intronic
1131421023 15:92305507-92305529 AAGCCCTCCCTCTATTAGCAAGG + Intergenic
1132212434 15:100034365-100034387 CAGCACTGCCTCCCACAGCACGG - Intronic
1133003084 16:2860859-2860881 CAGCAGTTCCTCAATTCCCAGGG + Intergenic
1133623377 16:7547927-7547949 CTGGATTTCCTCCATTACCAAGG - Intronic
1135064213 16:19295771-19295793 CAGCAGTTTCTCCCTTAGCATGG - Intronic
1141218503 16:82047136-82047158 CTGATCTCCCTCCATTAGCAGGG + Intronic
1141753897 16:85978595-85978617 CACCACTTCCTCAATTGTCACGG + Intergenic
1143781747 17:9232836-9232858 CGGCCCTTCCTCCCTTCGCAGGG + Intronic
1148835234 17:50462470-50462492 CACCACTTCATCCAGGAGCAGGG - Exonic
1150956480 17:69865902-69865924 CAGCACTTCTTCCTTTAGAATGG + Intergenic
1151035064 17:70789158-70789180 CACCACTACCTCCATCATCAAGG - Intergenic
1151397163 17:73830927-73830949 CAGCACTTCCTTCCTTTACATGG + Intergenic
1155335295 18:24757336-24757358 CAGCACTTCCCCAATTTGCTGGG + Intergenic
1155604779 18:27592492-27592514 CAGCACTTGCTCTATTGTCATGG - Intergenic
1157443129 18:47725231-47725253 CCACACTGCCTCCAATAGCAGGG + Intergenic
1159827438 18:73231364-73231386 CAATACTTGCACCATTAGCAAGG - Intronic
1159882798 18:73875419-73875441 CACCACTTCCTCCCTCCGCAGGG + Intergenic
1164176594 19:22780827-22780849 CATCAGTTCCTCCTTTTGCAGGG - Intronic
1166146956 19:40844672-40844694 CAGCACTTCCTGAATGAGAAGGG - Exonic
1166154206 19:40898515-40898537 CAGCACTTTCTGGATGAGCAGGG + Intergenic
1166173898 19:41052065-41052087 CAGCACTTTCTGGATGAGCAGGG - Intergenic
1166179197 19:41095037-41095059 CAGCACTTCCTGGATAAGAAGGG + Exonic
1167398547 19:49248519-49248541 CAGAACTTCCTCCATGTGCTGGG - Intergenic
927649023 2:24899621-24899643 CAGCCCTGCCTCCATCAGCTGGG - Intronic
929762089 2:44815106-44815128 CAGCCCTTGCCCCATTAGGAGGG + Intergenic
930283670 2:49401663-49401685 CAGCACTTCTCCCTTTAGAAGGG - Intergenic
931888800 2:66647540-66647562 TAGGACTTCCTCCTTTAGCTCGG + Intergenic
932758982 2:74427255-74427277 CAGCACTGCTTCCATTGGCCTGG + Exonic
935331302 2:101979710-101979732 CAGGACCTCCTCCAGTAGCTGGG - Intergenic
939453742 2:142405884-142405906 CAGAATTTCCTCCATTTGTAAGG - Intergenic
939454964 2:142422187-142422209 TTGCTCTTCCTCCATTAACAGGG - Intergenic
939855848 2:147357689-147357711 CAGCAAAGCCTCCATCAGCACGG + Intergenic
940197351 2:151110144-151110166 TACCACTTCATCCATTAGGATGG - Intergenic
940214230 2:151288384-151288406 CAGCCCTTCCTCCATCTTCAGGG - Intronic
942060612 2:172225523-172225545 AAACAGTTCCTCCTTTAGCAAGG + Intergenic
942523858 2:176832167-176832189 CAGCTCTTCCTCCCTTAGTTTGG - Intergenic
944307831 2:198197431-198197453 TCGCACTTCCTCCTTTAGCTCGG - Intronic
948282187 2:236755541-236755563 CAGCCCTTCCTGCATGATCAAGG + Intergenic
1168853114 20:990007-990029 CTACACTTACTCCATTGGCAGGG + Intronic
1169894128 20:10484367-10484389 CTTCACTTCCTCCTTTAGCTAGG + Intronic
1169966847 20:11227407-11227429 CAGCTCTTCTCCCAATAGCATGG + Intergenic
1170425453 20:16230900-16230922 CATTACTTCCTTCATTTGCATGG - Intergenic
1174879067 20:54257335-54257357 CAACACATCTCCCATTAGCATGG - Intergenic
1176913608 21:14598517-14598539 CAGCACTTCTTCCACAAGCCTGG + Intronic
1178742341 21:35213659-35213681 CACCACTTCCTCCACAAGTATGG - Intronic
1178779820 21:35591383-35591405 AAGCATTTCCACCATTAGCATGG - Intronic
1179179177 21:39030803-39030825 CAGCACTTCATCCCTTGCCATGG - Intergenic
1181483951 22:23218929-23218951 CACCGCTTCCTCCCTGAGCAGGG - Intronic
1183426676 22:37743505-37743527 CAGCACATCCTCCGTAAGCACGG - Intronic
1183749813 22:39713413-39713435 CAGCAATTCCACCTTTAGGAGGG + Intergenic
949412227 3:3778412-3778434 CACCACTCCCTCCACCAGCAGGG - Intronic
950007865 3:9703085-9703107 CAGTCCTTCCTCCATAGGCAGGG - Intergenic
950390226 3:12690773-12690795 CAGCACTTCCACTTTCAGCATGG - Intergenic
952667883 3:35929355-35929377 CCTCACTTCCTCCTTTAGCTTGG + Intergenic
954293023 3:49659738-49659760 CAGCCCTACCTCCAGCAGCATGG - Intronic
956956227 3:74343977-74343999 CAGCACTTGCTCCAACAACATGG + Intronic
957727628 3:84087822-84087844 TTGCACTTCCTCCTTTAGCTCGG - Intergenic
960156776 3:114304662-114304684 CAGCACTTCCTCCATTAGCATGG + Intronic
960243719 3:115376007-115376029 CATCTCTACCTCAATTAGCAAGG - Intergenic
963825273 3:149946117-149946139 TCGCACTTCCTCCTTTAGCTCGG - Intronic
966280984 3:178228452-178228474 CAGCAATTCCTCCTCTAGCTAGG - Intergenic
970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG + Intergenic
972867758 4:43255735-43255757 CCGGACTCCCTCCATTTGCATGG + Intergenic
973187192 4:47344215-47344237 CATCAATTTCTCCATTAGCCAGG - Intronic
977453546 4:97228140-97228162 CAGCACTACCCCCAGTAGCTGGG + Intronic
978187254 4:105871192-105871214 CAGCACTTCTATCATTAGCATGG - Intronic
978768600 4:112430723-112430745 CAGCACTTCCTCCAGAAGTCAGG + Exonic
981526284 4:145709503-145709525 CAGCTCTTGCTGCATTGGCATGG - Intronic
983598681 4:169499343-169499365 TCGAACTTCCTCCTTTAGCAAGG + Intronic
989015410 5:36926027-36926049 CAGTAGTTTCTCCATTACCATGG + Intronic
989784742 5:45313567-45313589 TTGCACTTCCTCCTTTAGCTTGG - Intronic
992281047 5:75176933-75176955 TTGCACTTCCTCCTTTAGCTCGG - Intronic
995451739 5:112309753-112309775 CAGCACTTTCTCCAGCAGAAGGG + Intronic
997225135 5:132204246-132204268 CAAAGCTTCCTCCACTAGCATGG - Intronic
997264696 5:132488379-132488401 AAGAACTTCTTCCATTAGAAAGG + Intronic
997700404 5:135894286-135894308 GATCACTTCCTACATTGGCAAGG - Intronic
1001983462 5:176052937-176052959 TTGCACTTCCTCCTTTAGCTTGG - Intronic
1002234006 5:177791115-177791137 TTGCACTTCCTCCTTTAGCTTGG + Intronic
1005178072 6:23070689-23070711 CAGCACTATTTGCATTAGCAAGG - Intergenic
1005506732 6:26475573-26475595 CAATAGTTCCTCCATTAGCTTGG - Intronic
1006573828 6:35028176-35028198 CAGAACTTCCCCCAAAAGCATGG + Intronic
1007348181 6:41249023-41249045 CTGCATTTCCTCCATTAGACTGG + Intergenic
1008032607 6:46713931-46713953 CAGCACTCCTTCCATTGGCCTGG + Intronic
1008163242 6:48103650-48103672 TAGAACTTCCTCCTTTAGCTCGG - Intergenic
1009250070 6:61287931-61287953 CAGCAAGTCATCCATTAGAATGG - Intergenic
1009602689 6:65822724-65822746 CAGTACTTCCTTCTTTAGCAAGG - Intergenic
1014317338 6:119884272-119884294 AGGCACTTCCTCCACCAGCAGGG + Intergenic
1014723424 6:124947354-124947376 CAGCACTTATACCATGAGCAAGG + Intergenic
1018705674 6:166461815-166461837 CAGCTCTTCCTCCATCATCCTGG + Intronic
1019289011 7:240928-240950 GAGCACGTCCTCCCTGAGCAGGG + Intronic
1023323586 7:39027490-39027512 CAGCCCTTCCTCCCTTTCCATGG - Intronic
1025094736 7:56088292-56088314 CAGCACTTCCTGCAATACCAGGG - Intronic
1025745932 7:64242833-64242855 CAACACCTCTTCTATTAGCAAGG + Intronic
1028645101 7:93086882-93086904 CTTCACTTCCTCCAGCAGCAGGG - Intergenic
1033125855 7:138706572-138706594 CTGAACTTCCTTCATTGGCATGG + Exonic
1033436716 7:141339433-141339455 CTGCACTTACTCCAGTAGCTGGG - Intronic
1033654760 7:143365239-143365261 CAGCTCTTCTTCCAGCAGCAGGG + Intergenic
1034463493 7:151211662-151211684 CAGCACTTCCTTAAGTATCAAGG + Intronic
1036621354 8:10426117-10426139 CAGCACATACTCCATTTCCAAGG + Intronic
1036945747 8:13092837-13092859 CAGCACTTTCTCCATCAGCTTGG + Intronic
1037641102 8:20743876-20743898 CCGAACTTCCTCCTTTAGCTCGG - Intergenic
1037765456 8:21769756-21769778 CAGCACTTTGTCCTTTATCATGG - Intronic
1043751897 8:83947812-83947834 CAGCACTCGCTACACTAGCAAGG - Intergenic
1045304559 8:100947661-100947683 TAGCACTTCTTCCATAAACAAGG + Intronic
1047819262 8:128500800-128500822 GAACACTCCCTCCATTATCATGG + Intergenic
1047993935 8:130315628-130315650 CTGGAGTGCCTCCATTAGCAGGG + Intronic
1049347704 8:142147533-142147555 CTGCACCTCCTCCATGTGCATGG - Intergenic
1051349495 9:16185528-16185550 CAGGACTTCCTCCTTTACCTTGG - Intergenic
1051500499 9:17771437-17771459 CAGCAGTTCCTCCCTGGGCAAGG + Intronic
1052126149 9:24776893-24776915 TAACACTGCCTCCATTAGAATGG - Intergenic
1056538038 9:87547976-87547998 CAGCACTTCCGCCACCAGCTGGG - Intronic
1056591548 9:87969275-87969297 CAGCACCTCCTCCAGGGGCATGG + Exonic
1060824511 9:126680185-126680207 CTGCACTTGCTTCATCAGCACGG - Intronic
1186610872 X:11137065-11137087 CAGCACTTCCACCACTGGCTGGG - Intergenic
1187295959 X:18000861-18000883 AAGCACTGTCTCCATCAGCATGG + Intergenic
1189994068 X:46622296-46622318 CAGAAATGCCTCCATTTGCAGGG + Intronic
1194050041 X:89056866-89056888 TAGGACTTACTCCATTAGAAAGG + Intergenic
1198177364 X:134170198-134170220 AAGCACTTCTTACATTACCATGG - Intergenic
1199936219 X:152576116-152576138 CAGCAGTTCCTCCTCTAGCAGGG - Intergenic
1201599686 Y:15714181-15714203 TTGCACTTCCTCCTTTAGCTCGG - Intergenic
1202105129 Y:21355593-21355615 TTGAACTTCCTCCTTTAGCATGG - Intergenic