ID: 960157178

View in Genome Browser
Species Human (GRCh38)
Location 3:114307928-114307950
Sequence GACCTCAGGAGAAAATCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960157173_960157178 3 Left 960157173 3:114307902-114307924 CCCTCAGAATCCATTCTGTGGAA 0: 1
1: 0
2: 0
3: 21
4: 203
Right 960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 200
960157176_960157178 -7 Left 960157176 3:114307912-114307934 CCATTCTGTGGAAGGTGACCTCA 0: 1
1: 0
2: 2
3: 23
4: 289
Right 960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 200
960157174_960157178 2 Left 960157174 3:114307903-114307925 CCTCAGAATCCATTCTGTGGAAG 0: 1
1: 0
2: 1
3: 18
4: 214
Right 960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960157178 Original CRISPR GACCTCAGGAGAAAATCAGC TGG Exonic
900227919 1:1541289-1541311 GGCCTCAGCAGGAAGTCAGCGGG + Intergenic
901969762 1:12898246-12898268 GACCTCAGGAAGAACTAAGCAGG + Exonic
902015409 1:13303534-13303556 GACCTCAGGAAGAACTAAGCAGG - Intronic
904013537 1:27403939-27403961 GGCCTCAGGAGACAATCTGCTGG - Intergenic
905494986 1:38377906-38377928 GACCTAAAGAGACAAACAGCTGG - Intergenic
908042591 1:60130769-60130791 GAACTCAGGAGAGAAGCATCTGG + Intergenic
908921810 1:69203419-69203441 GAGCTCAGGAAAAAATTAGCTGG + Intergenic
909445495 1:75744091-75744113 AACATCAGGAGAAAATGAACAGG - Intronic
912209646 1:107544132-107544154 GACCTCAGGAAATAAGCAGAGGG - Intergenic
913558615 1:119995857-119995879 GTCCTCAGTATAAAATCAACTGG - Intronic
913639225 1:120794614-120794636 GTCCTCAGTATAAAATCAACTGG + Intergenic
914279224 1:146155344-146155366 GTCCTCAGTATAAAATCAACTGG - Intronic
914540267 1:148606274-148606296 GTCCTCAGTATAAAATCAACTGG - Intronic
914626377 1:149464940-149464962 GTCCTCAGTATAAAATCAACTGG + Intergenic
915274625 1:154779672-154779694 GGCCGCTGGAGAAAAACAGCAGG + Intronic
915718523 1:157966377-157966399 GACCTCAGCAGTAAATCAGCAGG - Intergenic
918446436 1:184621811-184621833 GAACCCAGGTGAAAATCTGCTGG - Exonic
922188972 1:223300238-223300260 GACCTCAGGAACAAATCAGGAGG + Intronic
923519874 1:234727039-234727061 GATCACAGGAGAAATTGAGCAGG - Intergenic
924129320 1:240889353-240889375 GCCCTGAGCAGAAAATAAGCAGG + Intronic
924250526 1:242128474-242128496 CACATCAGGAGAGAGTCAGCAGG - Intronic
1065404162 10:25344863-25344885 GCCCTCACCAGAAAATCTGCTGG - Intronic
1066689847 10:38015220-38015242 GCCATCAAGAGAAAATCAGAAGG - Intronic
1066691609 10:38034241-38034263 GACATTAGGTAAAAATCAGCAGG - Intronic
1067002866 10:42634055-42634077 GCCATCAAGAGAAAATCAGAAGG + Intronic
1067756799 10:49011655-49011677 GCCCTCAGGAGGCAAGCAGCAGG - Intergenic
1071035804 10:81243681-81243703 GACTGCAGGAGAAAATCATAAGG + Intergenic
1071494848 10:86161201-86161223 GACAGCATGAGAAAATAAGCTGG + Intronic
1071815165 10:89225038-89225060 GATCTCAGGAGGAAATCTGCGGG + Intronic
1075073672 10:119336101-119336123 CACCTCAGCACAAAAACAGCTGG - Intronic
1075922081 10:126222018-126222040 GACCTCAGGAGACAGCCATCTGG - Intronic
1076711521 10:132338339-132338361 GCCCTCAGGAGCAAAGGAGCTGG - Intronic
1079510901 11:21208936-21208958 GAGCTTAGCAGAGAATCAGCAGG + Intronic
1079816168 11:25061476-25061498 GATCTAAGGAGAAACACAGCTGG - Intronic
1082727045 11:56748587-56748609 GACCTCAGCTGCAAATCAGAAGG - Intergenic
1084976001 11:72798687-72798709 GACCCCAGGAGAAAGCCACCAGG - Intergenic
1085486041 11:76863457-76863479 CACCTTGGGAGAAAATCATCTGG + Intronic
1085713758 11:78853879-78853901 GACAGCAGGAGAGAAGCAGCGGG + Intronic
1087366308 11:97224067-97224089 GGCTTCAGGAGTAAATCACCTGG - Intergenic
1087533595 11:99415255-99415277 AACCTCAGAAGAAAATCAGATGG - Intronic
1088733627 11:112707032-112707054 GACCTCAGGGGTACATCAGCAGG + Intergenic
1091255911 11:134185334-134185356 AATCTTGGGAGAAAATCAGCAGG - Exonic
1091503888 12:1047063-1047085 GACCTCTGGGGAAAATCCACTGG - Intronic
1092109224 12:5947101-5947123 CAGCTCTGGAGAAATTCAGCAGG - Intergenic
1093394861 12:18668774-18668796 GGCCTGAGGTGAATATCAGCAGG - Intergenic
1095447830 12:42300070-42300092 GACCCCAGCAGAAAAGCAACTGG - Intronic
1097059381 12:56271179-56271201 GATCTCAGGACAGAATCATCTGG + Intergenic
1097467141 12:59940656-59940678 GACCTCAGGAAAATATCATGTGG - Intergenic
1097874838 12:64633511-64633533 GACCTCAGGAGGACCTCAGGAGG - Intronic
1098988886 12:77043293-77043315 AACCTCAGGTGGAAAGCAGCAGG + Intronic
1100501973 12:95183111-95183133 GACATCTGGGGAAAATCAGAAGG + Intronic
1101698087 12:107145568-107145590 GAACTCAGGAGAAGATTAGAGGG - Intergenic
1102224097 12:111215806-111215828 GGCCTCAGAAGAAAGTCAGTTGG - Intronic
1104554967 12:129791187-129791209 GACAAGAGGAGGAAATCAGCAGG + Intronic
1105242931 13:18623737-18623759 GACCTCAGAGGAAAATAAGAGGG + Intergenic
1110539727 13:76694681-76694703 GACCTCAGGGAAAAGTCAGAAGG + Intergenic
1113142118 13:107165464-107165486 AAACTCAGAAGAAAATCACCTGG - Exonic
1113406518 13:110045948-110045970 GGCCTCAGGACAGAATCAGCAGG - Intergenic
1113569053 13:111340098-111340120 GCACTCTGGAGAAAATCAGTGGG - Intronic
1116055109 14:39854179-39854201 GACCTAAGGAGAAAGCCATCTGG + Intergenic
1120429598 14:84398615-84398637 GGCCTCAGGAGAGAAGCTGCAGG + Intergenic
1123488365 15:20760893-20760915 GACCTCAGAGGAAAATAAGAGGG - Intergenic
1123544862 15:21329966-21329988 GACCTCAGAGGAAAATAAGAGGG - Intergenic
1124166319 15:27328869-27328891 CACAGCTGGAGAAAATCAGCGGG - Exonic
1124372143 15:29110064-29110086 GGGCTCTGCAGAAAATCAGCTGG + Intronic
1130732119 15:86507128-86507150 GATCCAAGGAGAAAATCAGAGGG - Intronic
1130920939 15:88344083-88344105 GATCTCATGAGAACAGCAGCAGG + Intergenic
1202953208 15_KI270727v1_random:57237-57259 GACCTCAGAGGAAAATAAGAGGG - Intergenic
1134116949 16:11556186-11556208 GACCTCAGGAGGAAGTGTGCGGG + Intronic
1134250386 16:12569919-12569941 AACCTGAGGAGAAAAGCAGGTGG + Exonic
1134328552 16:13229384-13229406 GACCTCAGGGGAGAGGCAGCTGG + Intronic
1135012806 16:18897865-18897887 CCTCTCAGGAGAAAATCAGTAGG - Intronic
1135319725 16:21485449-21485471 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1135372561 16:21916937-21916959 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1135439224 16:22453766-22453788 CCTCTCAGGAGAAAATCAGTAGG + Intergenic
1136329953 16:29567162-29567184 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1136444582 16:30306866-30306888 CCTCTCAGGAGAAAATCAGTAGG - Intergenic
1137959446 16:52867076-52867098 GACCTAAGGAGAAAAACATATGG + Intergenic
1140137116 16:72216620-72216642 AAACTCAGGAGAGAATTAGCAGG + Intergenic
1140773234 16:78225642-78225664 CTCATCTGGAGAAAATCAGCTGG - Intronic
1141364430 16:83429303-83429325 TACCTCATGAGGAAATCAGGTGG - Intronic
1141496074 16:84410600-84410622 GACCTCAGGAAATACTCACCTGG - Exonic
1142018751 16:87766679-87766701 AAACTCAAGAGAAAATGAGCCGG - Intergenic
1144051003 17:11497093-11497115 GTCCTCAGGAGAGAATCTACAGG - Intronic
1144463248 17:15475423-15475445 GACAACATGAGAAAATCAACAGG - Intronic
1147425817 17:40345424-40345446 GAGATCAGCAGGAAATCAGCCGG - Intronic
1147426142 17:40346769-40346791 GAGGTCAGGAGAGAATCTGCTGG + Intronic
1150958020 17:69883322-69883344 CATCCCAGCAGAAAATCAGCTGG + Intergenic
1154446006 18:14436160-14436182 GACCTCAGAGGAAAATAAGAGGG - Intergenic
1156999129 18:43503398-43503420 GGCATCAGGAGATAAGCAGCAGG + Intergenic
1158105000 18:53875616-53875638 GCCCTCAGGAGAAAATGAGAGGG - Intergenic
1158265195 18:55653845-55653867 GACCACAGCAGAAAATCCACAGG + Intronic
1159263612 18:66049639-66049661 TATGTCAGGAGAAAATCAGTAGG + Intergenic
1159473579 18:68888614-68888636 CTCCTCAGGACAAAATCATCAGG + Intronic
1164431426 19:28192448-28192470 GACCTAGTGAGAAAAACAGCTGG - Intergenic
1164592728 19:29515189-29515211 GACCTCAGGACACAGACAGCAGG - Intergenic
1165884509 19:39068207-39068229 GACTTCAGGAGTAAAACCGCAGG + Intergenic
1166052950 19:40271503-40271525 GAACTCAGGAGAAAGGCACCTGG + Intronic
926291520 2:11534939-11534961 GTGCTCAGGACAGAATCAGCTGG + Intronic
927012018 2:18913946-18913968 CACCCCATGAGAGAATCAGCAGG + Intergenic
928282124 2:29957002-29957024 AAACTCAGTAGAAAATGAGCAGG - Intergenic
929855278 2:45632351-45632373 TACCTCCGGGGAAAAGCAGCAGG - Intergenic
932304479 2:70692141-70692163 GACCTGAGTAGAAACTTAGCAGG + Intronic
938813377 2:134874195-134874217 GACCTCCAGAAAAACTCAGCAGG + Intronic
939548204 2:143580324-143580346 GACCTCTGGAGAAATTTATCTGG - Intronic
940344484 2:152615220-152615242 CACCTCAGCAGAAACTGAGCAGG - Intronic
944681075 2:202077184-202077206 GACCTCAGAAGCCAAACAGCTGG - Intronic
945099020 2:206246747-206246769 GAATTAAAGAGAAAATCAGCCGG - Intergenic
946584070 2:221164113-221164135 CACCTCAGGAGAAAATGAGGAGG - Intergenic
948284810 2:236775407-236775429 GACGTCAAGAGAAAGTAAGCCGG - Intergenic
948648548 2:239424575-239424597 GTCCTCAGGTGGAAACCAGCAGG - Intergenic
948980435 2:241491755-241491777 GACCTCAGGAGGGTACCAGCAGG + Intronic
1173990194 20:47296373-47296395 GAGCCCAGGGGCAAATCAGCTGG + Intronic
1174496210 20:50945228-50945250 GTCCTGAGGAGCAAATCAACAGG - Intronic
1174856610 20:54051435-54051457 GACCTCAGGAGACTGTCATCTGG - Intronic
1175581532 20:60103633-60103655 TTCCTCATGAGAAAATCAGAAGG - Intergenic
1176034761 20:63030792-63030814 GAGCTCACGAGACAGTCAGCAGG - Intergenic
1176449973 21:6853697-6853719 GACCTCAGAGGAAAATAAGAGGG + Intergenic
1176828142 21:13718715-13718737 GACCTCAGAGGAAAATAAGAGGG + Intergenic
1177033352 21:16011063-16011085 GAATTCAGGAAAGAATCAGCTGG + Intergenic
1178108040 21:29342856-29342878 AACTTCAGGAGAAAATTAGATGG - Exonic
1179167562 21:38946728-38946750 GACCTCAGAAGGAAATGAGAAGG + Intergenic
1179932059 21:44577404-44577426 GACCTCAGCAGAAGCTCAGCAGG - Intronic
1181851625 22:25753741-25753763 GACTTCAGGAGTAAAGCTGCAGG - Intronic
1184755207 22:46511958-46511980 GACACCAGGAGAAAAGCAGGAGG - Intronic
949547908 3:5088286-5088308 GTCCTCAGGAGAAAGTCAAGGGG - Intergenic
953589435 3:44237412-44237434 TACTTCAGGAAAAAGTCAGCTGG + Intergenic
954377346 3:50202133-50202155 GATCTCAGGAGAGAGACAGCAGG + Intergenic
954379127 3:50210341-50210363 GATCTCAGGAGAGAGACAGCTGG - Intronic
955933123 3:64077565-64077587 GACCTCAGGGGCATAGCAGCAGG + Intergenic
958178202 3:90023565-90023587 GACACCAGCAGAAAATCAGAGGG + Intergenic
960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG + Exonic
962234864 3:133699268-133699290 GGCCTCAGGAGTGAAACAGCTGG - Intergenic
962440955 3:135415699-135415721 GACTTCAACAGAAAATCTGCAGG - Intergenic
963430809 3:145199866-145199888 GACCTCAGTACAAAAATAGCTGG + Intergenic
963919524 3:150892342-150892364 GCCCTCAGGAGAAAACCATAAGG - Intronic
965598417 3:170430947-170430969 GATCTCAAGAGGAAATCAGAAGG - Intronic
966078637 3:175970896-175970918 GACCTCACCAGAAACTGAGCAGG - Intergenic
967487753 3:190054022-190054044 TACATTAGTAGAAAATCAGCTGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969249010 4:5955030-5955052 GAGCTCAGGAGGAAGACAGCAGG - Intronic
976048775 4:80985029-80985051 AACCTCAGGAGAAAAGCATTTGG + Intergenic
977162441 4:93651969-93651991 GACCTCAGGTGAAAATTATCAGG + Intronic
978718156 4:111871229-111871251 CATCTCAACAGAAAATCAGCTGG + Intergenic
981148084 4:141349306-141349328 GACCTCAGGAGAGAGCTAGCTGG - Intergenic
982070077 4:151686973-151686995 GACCTGAGGAGAGGATGAGCAGG - Intronic
983700153 4:170581845-170581867 CAACTAAGCAGAAAATCAGCAGG + Intergenic
983770513 4:171543268-171543290 GAATTCAAGAGAAAATTAGCAGG - Intergenic
985883214 5:2656608-2656630 GACCACAGGGGAAAAACAGTGGG + Intergenic
986060515 5:4185929-4185951 CATCTCAGGAGGAAATGAGCAGG + Intergenic
987213460 5:15708409-15708431 GAACTCAGGAGTGAATTAGCAGG - Intronic
987348201 5:16997462-16997484 AACCTCAGGAGAGAATTACCAGG - Intergenic
990854014 5:60242355-60242377 GACCTCAGGAAAATAACAGCTGG + Intronic
991555066 5:67886677-67886699 TGCCTCAGGAGAATATCAGAGGG + Intergenic
992091957 5:73325218-73325240 GACCTGAGAAGAACTTCAGCTGG - Intergenic
995068882 5:107894616-107894638 GACTTAAGAAGAAAACCAGCTGG + Intronic
995969716 5:117953412-117953434 GGCCGCAGGAGAAAATGAGGAGG - Intergenic
996525263 5:124472727-124472749 GAATTCAGGAAAAATTCAGCGGG + Intergenic
998146794 5:139733761-139733783 GGCCTCAGGATAAAACCTGCCGG - Intergenic
998817335 5:146027793-146027815 GACCTCAGTAGAAAGGCAACTGG - Intronic
1002433408 5:179217389-179217411 CACTGCAGGAGAAAATCAGAAGG + Intronic
1002980022 6:2126940-2126962 GAAGTCAGAAGAAAATCTGCTGG - Intronic
1005217330 6:23546481-23546503 GATCTCAGGAGAGAACCAACTGG + Intergenic
1007083680 6:39127565-39127587 TACCTCAGAAGAAATCCAGCTGG + Intergenic
1007465725 6:42049759-42049781 GCCCTCAGCACAAAATCACCAGG + Intronic
1008420553 6:51294231-51294253 GACATTAAGTGAAAATCAGCAGG - Intergenic
1010010906 6:71047168-71047190 TACCTAAGGACAAAAGCAGCTGG - Intergenic
1010970925 6:82262515-82262537 GACTTCAGTAGAAAATTAGGTGG + Intergenic
1012508610 6:99976997-99977019 GAAGTCAAAAGAAAATCAGCAGG - Intronic
1015038658 6:128689628-128689650 GATTTCAGGAGAAAATCAGAGGG + Intergenic
1017742493 6:157419144-157419166 AACCTCAGGAGGAAGACAGCAGG - Intronic
1019852680 7:3575168-3575190 GCCCTCACCAGAAACTCAGCTGG - Intronic
1019921014 7:4163350-4163372 GAAGTCAGGAGAAAATCAAGAGG + Intronic
1021033089 7:15762952-15762974 GACTTCAGGGGACAATCTGCAGG + Intergenic
1021480372 7:21108742-21108764 GATCTCATGAAAAAATCAACAGG + Intergenic
1021938319 7:25653368-25653390 CCCCACAGGGGAAAATCAGCAGG + Intergenic
1022438119 7:30409383-30409405 GACCTTATGAGACAACCAGCTGG - Intronic
1024033441 7:45484869-45484891 GAGCTCAGGATAAACTCTGCAGG - Intergenic
1026502095 7:70951700-70951722 TACTTCAGGAGAAAAAGAGCAGG + Intergenic
1028089274 7:86677454-86677476 GACCTCAGCAGAAAGCCAACAGG - Intronic
1029455349 7:100667781-100667803 GAACTAAGAAGAAAATCAGGAGG - Intergenic
1030835602 7:114280737-114280759 TACCTCATGAGAAATTCAGAAGG + Intronic
1031448583 7:121885561-121885583 GAAGTTAGGAGAAAATAAGCTGG - Intronic
1031514557 7:122686040-122686062 GACCACAGGTGAAATTCAGAAGG - Intronic
1033292355 7:140097597-140097619 GAACTCAGGAGTAGATCATCAGG - Exonic
1033755376 7:144394979-144395001 GAAGTCAGGAGAAAACCAGAAGG - Intergenic
1036029663 8:4955020-4955042 GATGTCCCGAGAAAATCAGCTGG - Intronic
1036695798 8:10974361-10974383 AAACTCAGGAGAGAATTAGCTGG - Intronic
1037059317 8:14486732-14486754 GAGCCCAGGAGTAAATTAGCTGG - Intronic
1038131258 8:24733999-24734021 GAACTAAGGAGAACATCAGCAGG + Intergenic
1038834533 8:31104590-31104612 AACCACAGGAGAAAATCTTCAGG - Intronic
1042521084 8:69711426-69711448 GAGCGCAGGAGAAAAGCAGGTGG + Intronic
1042791542 8:72612836-72612858 TACAGCATGAGAAAATCAGCAGG + Intronic
1045401180 8:101819851-101819873 GAGCACAGGAGCAAATGAGCTGG + Intronic
1046581736 8:116101695-116101717 GACATGAGGAGGAAATGAGCCGG - Intergenic
1046909256 8:119607759-119607781 GATCTCAGGAAAAAAACACCTGG + Intronic
1049657751 8:143806231-143806253 AACCCCAGGAGAGAATCACCTGG - Intronic
1051341637 9:16117441-16117463 GACCTCTGCAAAAAATCAGATGG - Intergenic
1052386155 9:27825702-27825724 GAACTCAGGAGAAAATAAGAAGG + Intergenic
1055184043 9:73428609-73428631 GACCTCAATAGAAAATTTGCTGG + Intergenic
1055912993 9:81373044-81373066 CATCCCAGGAGACAATCAGCTGG + Intergenic
1056409817 9:86313877-86313899 GAACACAGGAGAAAATAAGTAGG + Intronic
1061366871 9:130176795-130176817 GGCCTCAGGAGGAAAGCAGCCGG + Intronic
1061621310 9:131812975-131812997 CACTTCAGGGGAAAAGCAGCTGG - Intergenic
1062172789 9:135144744-135144766 GGCCTCAGAACAAGATCAGCAGG + Intergenic
1203519209 Un_GL000213v1:30820-30842 GACCTCAGAGGAAAATAAGAGGG - Intergenic
1185568069 X:1111915-1111937 GACCCCAGGAGAGAAGCTGCCGG - Intergenic
1185760124 X:2684235-2684257 GACATCAGGAGAGCATCTGCTGG + Intergenic
1186060359 X:5698830-5698852 GCTCTCAGGAGAAACTCAGATGG - Intergenic
1187547961 X:20270544-20270566 AACCTCAGTAGAAAATCTGAAGG + Intergenic
1190625057 X:52329304-52329326 GACCTTGGGAGTAAATAAGCTGG - Intergenic
1194083345 X:89495990-89496012 GACCTCAGTACAATAACAGCTGG - Intergenic
1194406942 X:93508226-93508248 GATCTCAGAGGAAAAGCAGCTGG - Intergenic
1195333710 X:103829466-103829488 TACTTCAAGGGAAAATCAGCAGG - Intronic
1197215622 X:123863736-123863758 GACCTCAGGTGAAAAAGTGCTGG + Intronic
1198279655 X:135129115-135129137 GTCATCATGAGAAAATCACCTGG + Intergenic
1198291302 X:135243399-135243421 GTCATCATGAGAAAATCACCTGG - Intergenic
1199912027 X:152297000-152297022 GTCCTCAACAGAAAAGCAGCTGG - Intronic