ID: 960161232

View in Genome Browser
Species Human (GRCh38)
Location 3:114352128-114352150
Sequence CTACCTCAGCCGAAGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960161232 Original CRISPR CTACCTCAGCCGAAGCTCTG GGG (reversed) Intronic
900988397 1:6086442-6086464 CTGCCTCTGCCAGAGCTCTGTGG + Intronic
903913322 1:26744843-26744865 CTCTCTCACCCTAAGCTCTGAGG - Intronic
906877126 1:49551795-49551817 CTACCACAGCTGATGCTCTCTGG - Intronic
906951951 1:50341927-50341949 CATCCTCAGCTGCAGCTCTGTGG + Intergenic
907441155 1:54479311-54479333 CTGCCTCAGCCTAAGCCCTTTGG + Intergenic
910226133 1:84938490-84938512 CTAACACAGCTGCAGCTCTGAGG + Intronic
916542367 1:165769146-165769168 CTACCTCAGCCCAACTTCTGTGG + Intronic
918110655 1:181452557-181452579 CTACCTCAGCCAGGGCTCTCAGG + Intronic
921409771 1:214823376-214823398 ATACCACAGCTGAAGCTCTCTGG - Intergenic
921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG + Intergenic
921840572 1:219823715-219823737 ATACCTCATCAGAACCTCTGAGG - Intronic
922657945 1:227402142-227402164 CTACCACAGCTGACGCTCTCTGG + Intergenic
1066145472 10:32553822-32553844 CTACCACAGCTGATGCTCTCTGG - Intronic
1067859064 10:49825869-49825891 CTAACTCAGCAGTATCTCTGAGG + Intronic
1072928010 10:99633791-99633813 CTACCACAGCTGATGCTCTCTGG + Intergenic
1073072946 10:100806236-100806258 CTTCCTCAGCCAGATCTCTGAGG + Intronic
1074365683 10:112855710-112855732 CAACTTCAGCCCAAGCTCTGTGG - Intergenic
1075661533 10:124200331-124200353 CAACCTCACCCATAGCTCTGAGG + Intergenic
1079009989 11:16820120-16820142 CTACCTAATCAGAAACTCTGGGG + Intronic
1079791686 11:24747548-24747570 CTACCACAGCTGATGCTCTCTGG - Intronic
1085747856 11:79129876-79129898 CTACCACAGCTGAGGCTCTCTGG + Intronic
1086825396 11:91489703-91489725 CTACCACAGCTGATGCTCTCTGG - Intergenic
1089603841 11:119630341-119630363 CTCCCTCAGCCCCTGCTCTGTGG - Intronic
1089952869 11:122546478-122546500 CTACCACAGCTGATGCTCTCTGG - Intergenic
1090753065 11:129764136-129764158 CTACCACAGCTGATGCTCTCTGG + Intergenic
1090894985 11:130964211-130964233 CTACCACAGCTGATGCTCTCTGG - Intergenic
1091437184 12:481792-481814 CTGCCTCAGCCTCAGCTGTGGGG + Intronic
1091699969 12:2652774-2652796 CCAGCTCAGCCCAGGCTCTGGGG + Intronic
1092247326 12:6871057-6871079 CTACCCCAACCCAAGCTCTGCGG - Exonic
1092283146 12:7112639-7112661 CTACATAAGCCAAAGCTCTCTGG + Intergenic
1093488696 12:19681178-19681200 CTACCACAGCTGATGCTCTCTGG - Intronic
1093994987 12:25631285-25631307 CTACCACAGCTGATGCTCTCTGG + Intronic
1093995933 12:25642789-25642811 CTACCTTAGCTGATGCTCAGTGG + Intronic
1094447320 12:30546025-30546047 CTACCACAGCTGATGCTCTCTGG - Intergenic
1094686341 12:32719793-32719815 CTACCTCAGGGGATGCTGTGAGG - Intronic
1095665216 12:44789132-44789154 CTACCACAGCTGATGCTCTCTGG + Intronic
1095932110 12:47637331-47637353 CTACCACAGCTGATGCTCTCTGG + Intergenic
1096888564 12:54743493-54743515 CTACCACAGCTGATGCTCTCTGG - Intergenic
1097397689 12:59095420-59095442 CTACCTCAGCTGATGCCATGAGG - Intergenic
1100203565 12:92325251-92325273 CTACCACAGCTGATGCTCTTTGG - Intergenic
1102916713 12:116759861-116759883 CTACCACAGCTGATGCTCTCTGG - Intronic
1105445935 13:20457085-20457107 CCACCTCAGCCCAGCCTCTGTGG + Intronic
1105908292 13:24835315-24835337 CTACCACAGCTGATGCTCTCTGG + Intronic
1107755969 13:43622757-43622779 CTACCACAGCTGACGCTCTCTGG - Intronic
1108469756 13:50756216-50756238 CTACCACAGCTGATGCTCTCTGG - Intronic
1108817133 13:54305544-54305566 CTACCACAGCTGATGCTCTCTGG + Intergenic
1111204192 13:84983147-84983169 CTACCAGAGCAGAAGCTCAGGGG + Intergenic
1111748195 13:92296266-92296288 CTACCACAGCTGATGCTCTCTGG - Intronic
1114692285 14:24595271-24595293 CTACCACAGCTGATGCTCTCTGG - Intergenic
1115299284 14:31865786-31865808 CTACCACAGCTGATGCTCTCTGG + Intergenic
1115680353 14:35730875-35730897 CTACCACAGCTGATGCTCTCTGG + Intronic
1115692869 14:35863558-35863580 CTACCTCAGTGGTAGCTTTGGGG + Intronic
1116049003 14:39781023-39781045 CTACCACAGCTGATGCTCTCTGG - Intergenic
1116346747 14:43803433-43803455 CTACCACAGCTGATGCTCTCTGG + Intergenic
1117690855 14:58303739-58303761 CTACTTCATCAGAAACTCTGGGG + Intronic
1119583755 14:75812283-75812305 CTACCTCCACCTAAGCTTTGGGG - Intronic
1121516572 14:94556233-94556255 CTACCACAGCTGATGCTCTCTGG - Intergenic
1122412776 14:101534452-101534474 CTTCCTCTGCCCAAGCTCTCAGG - Intergenic
1122468230 14:101948745-101948767 CTAAGTCAGCCGAGGCCCTGGGG - Intergenic
1124176197 15:27426452-27426474 CTAACTCAGCCAAAGCCATGAGG + Intronic
1129097568 15:73225304-73225326 CTACCACAGCTGATGCTCTCTGG - Intronic
1131951633 15:97687868-97687890 CTACATCACCCTAAGCTCAGTGG + Intergenic
1133312631 16:4860046-4860068 CTGCCTCTTCCGAAGCTGTGGGG - Intronic
1133760260 16:8792949-8792971 CTCCCTCATCCGCACCTCTGTGG - Intronic
1134492712 16:14707693-14707715 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1134498093 16:14746815-14746837 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1134823812 16:17268414-17268436 CTACCTAAGCCAAAGCTCTTTGG + Intronic
1135313800 16:21426329-21426351 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135366724 16:21858609-21858631 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135445091 16:22512549-22512571 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1136002220 16:27303500-27303522 TTACCTCTGACCAAGCTCTGTGG + Intergenic
1136193813 16:28637088-28637110 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1136249240 16:28993059-28993081 CTACCTCAGCCCAAGCAGCGGGG + Intergenic
1136310464 16:29405032-29405054 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136323912 16:29506820-29506842 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136438597 16:30246803-30246825 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1139858148 16:69997418-69997440 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1141181468 16:81755858-81755880 CTATCTCTGCAGAAGTTCTGAGG + Intronic
1142194384 16:88732798-88732820 CCACCACAGCCACAGCTCTGGGG + Intronic
1144941962 17:18948192-18948214 CAACCTCACCCAAAGCTCAGTGG + Intergenic
1152061159 17:78076317-78076339 CTGCCTCAGCTGCAGCTGTGGGG + Intronic
1152286801 17:79417305-79417327 GTGCCTCAGCTGAAGCTCTCAGG + Intronic
1154119594 18:11640690-11640712 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1155906527 18:31458740-31458762 TTCCCTCAGGCGAGGCTCTGTGG - Intronic
1158659458 18:59372937-59372959 CTCCCTCACCTGAAGCTCTTGGG + Intergenic
1160219725 18:76965885-76965907 CTACCACAGCTGATGCTCTCTGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161372829 19:3923208-3923230 CCACCTCAACCCAAGCTCTCTGG + Intronic
1161978673 19:7619631-7619653 CTGCTCCAGCCGAACCTCTGTGG + Exonic
1166604220 19:44126540-44126562 CTACCACAGCTGATGCTCTCTGG - Intronic
1168180933 19:54662831-54662853 CTGCCTCAGCCCTAGCTCTGGGG + Exonic
925343349 2:3151648-3151670 CTACCACAGCTGATGCTCTCTGG + Intergenic
928461173 2:31474214-31474236 CTACCACAGCCCTAGCTCTCTGG + Intergenic
930153036 2:48077732-48077754 CTATCTCAGCCATAACTCTGGGG - Intergenic
930476242 2:51886214-51886236 GTACCTGAGCCGAAGTTCTAGGG - Intergenic
931184752 2:59939248-59939270 CAACCTCAGCCTAAACTCAGTGG + Intergenic
933224963 2:79737494-79737516 TTACCTGATCAGAAGCTCTGTGG + Intronic
936705294 2:115065447-115065469 CAACCTTAGCAGAAGATCTGAGG + Intronic
937511081 2:122595515-122595537 CAACCTCACCCTAACCTCTGGGG - Intergenic
937924001 2:127153959-127153981 CTATCCCAGCAGAGGCTCTGAGG + Intergenic
938117042 2:128609134-128609156 CTGCCTCCACGGAAGCTCTGTGG - Intergenic
938300183 2:130205151-130205173 CTACCTAAGTAGAAGCTCTTTGG - Intergenic
938456538 2:131469345-131469367 CTACCTAAGTAGAAGCTCTTTGG + Intronic
944432043 2:199644541-199644563 CTACCACAGCTGATGCTCTCTGG - Intergenic
1169401353 20:5283129-5283151 CTACCACAGCTGATGCTCTCTGG + Intergenic
1170720981 20:18879133-18879155 CTACCACAGCTGATGCTCTCAGG - Intergenic
1171567353 20:26208153-26208175 CTCCCTCAGCCGCCCCTCTGCGG - Intergenic
1173233362 20:41220429-41220451 CTACTACAGCCGAAGCTTTGGGG + Intronic
1174983687 20:55425114-55425136 CTATTTCAGGCGAACCTCTGGGG + Intergenic
1176197702 20:63844943-63844965 CTCCCCCAGCCGAGGCTCAGAGG + Intergenic
1177140552 21:17353257-17353279 CTACCACAGCTGATGCTCTCTGG + Intergenic
1177195546 21:17900690-17900712 CTACCACAGCTGATGCTCTCTGG - Intergenic
1179574762 21:42301165-42301187 CTCCCTCAACCGGGGCTCTGGGG + Intergenic
1181020780 22:20101081-20101103 CCTCCTCAGCATAAGCTCTGTGG + Intronic
1183335218 22:37242494-37242516 GTAGCTCAGCCGAAGCCCAGAGG + Intronic
1184198013 22:42945139-42945161 CTACCTCATGCTAAGCACTGGGG - Intronic
1184797292 22:46739536-46739558 CTCCCTCAGCTGCCGCTCTGAGG + Intergenic
1185263210 22:49882564-49882586 GTAACTGAGCCGAAGCTCGGAGG - Intronic
1185376018 22:50482886-50482908 CCACCTCAGCCATAGCTGTGGGG - Exonic
950610195 3:14121917-14121939 CTTCCTCAGCTCCAGCTCTGTGG + Exonic
953723919 3:45381392-45381414 CTACCACAGCTGATGCTCTCTGG - Intergenic
954077437 3:48191102-48191124 CTATCTCAGCCCCAGCTTTGCGG - Intergenic
954535497 3:51356532-51356554 CTCCATCAGCCCCAGCTCTGGGG + Intronic
955759113 3:62259142-62259164 CCACCTGAGCCCATGCTCTGAGG + Intronic
956950301 3:74274294-74274316 CTACCACAGCTGATGCTCTCTGG + Intronic
958013843 3:87914834-87914856 CTACCACAGCTGATGCTCTCTGG + Intergenic
958480751 3:94643254-94643276 CTACCACAGCTGAAGCTCTCCGG - Intergenic
959350037 3:105250387-105250409 CTCCCTCAGCTGTAGCTCTGGGG - Intergenic
960161232 3:114352128-114352150 CTACCTCAGCCGAAGCTCTGGGG - Intronic
960568096 3:119156531-119156553 CTGCCTCTGCCTAAACTCTGTGG - Intronic
962065982 3:131981192-131981214 CTACCACAGCTGATGCTCTCTGG - Intronic
964601220 3:158503387-158503409 CTACCACAGCTGATGCTCTCTGG - Intronic
966020385 3:175202619-175202641 CTACCACAGCTGATGCTCTCTGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
969513975 4:7636300-7636322 CTGCCTCACCCGCATCTCTGCGG + Intronic
970549282 4:17163422-17163444 CTACCACAGCTGATGCTCTCTGG - Intergenic
970996128 4:22269110-22269132 CTACCACAGCTGATGCTCTCTGG + Intergenic
971452543 4:26813611-26813633 GTACCTTATCTGAAGCTCTGTGG - Intergenic
975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG + Intergenic
976856516 4:89610414-89610436 ATACCACAGCTGATGCTCTGTGG + Intergenic
979499097 4:121418626-121418648 CTACCACAGCTGATGCTCTCTGG - Intergenic
980523559 4:133961052-133961074 CTACCACAGCTGATGCTCTCTGG + Intergenic
981346677 4:143684147-143684169 CTACCACAGCTGATGCTCTCTGG + Intronic
981400944 4:144313404-144313426 CTACCACAGCTGATGCTCTCTGG - Intergenic
981461145 4:145014580-145014602 CTACCACAGCTGATGCTCTCTGG + Intronic
984721728 4:182978599-182978621 CTACCACAGCTGATGCTCTCTGG + Intergenic
985217716 4:187671738-187671760 CTACCACAGCTGATGCTCTCTGG - Intergenic
986870267 5:12036956-12036978 CTACCACAGCTGATGCTCTCTGG + Intergenic
987006008 5:13709953-13709975 CTACCACAGCTGATGCTCTCTGG + Intronic
988846884 5:35136339-35136361 CTTCCTCAGCCTCAGCACTGTGG + Intronic
990572817 5:57095576-57095598 CTACCACAGCTGATGCTCTCTGG + Intergenic
990776187 5:59308761-59308783 CTACCACAGCTGATGCTCTCTGG - Intronic
991117414 5:62970201-62970223 CTACCACAGCTGATGCTCTCTGG + Intergenic
993250301 5:85513104-85513126 CTACTTCAGCTGATGCTCTCTGG - Intergenic
994222147 5:97208514-97208536 CTACCACAGCTGAGGCTCTCTGG - Intergenic
996155396 5:120093178-120093200 CTACCTCTGTAGGAGCTCTGAGG - Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
999208458 5:149867490-149867512 CTACCCAACCAGAAGCTCTGGGG - Intronic
999484778 5:151984826-151984848 CTACCACAGCTGATGCTCTCTGG - Intergenic
1002343021 5:178529052-178529074 GGACCTCAGCCGTAGCTCTGCGG - Intronic
1004508760 6:16267630-16267652 TCACCGCAGCCGAAGGTCTGTGG + Intronic
1004806037 6:19205042-19205064 CTACCGCAGCTGATGCTGTGAGG - Intergenic
1004891737 6:20107466-20107488 CTGCCTCAGCCTAGGCACTGGGG - Intronic
1008256168 6:49302987-49303009 CTACCACAGCTGATGCTCTCTGG + Intergenic
1009798551 6:68503085-68503107 CTACCACAGCTGATGCTCTCTGG + Intergenic
1010007363 6:71010528-71010550 CTGCCTCAGCTGTAGCTCTAGGG + Intergenic
1011133108 6:84072575-84072597 CTACCACAGCTGATGCTCTCTGG - Intronic
1011466392 6:87661640-87661662 CTACCTCAGCCCAGTCACTGGGG - Intronic
1011893268 6:92193911-92193933 CTACCACAGCTGATGCTGTGTGG - Intergenic
1012225113 6:96694550-96694572 CTACCACAGCTGATGCTCTCTGG + Intergenic
1015425747 6:133065118-133065140 CCACCTGAGCTGAAGCACTGAGG + Intergenic
1020193148 7:6016015-6016037 CTGCCTCTGCTGAACCTCTGGGG - Intronic
1020254907 7:6497624-6497646 CTACCTCAGCCGCCGAGCTGTGG - Intronic
1020634940 7:10685186-10685208 CTACCACAGCTGATGCTCTCAGG + Intergenic
1023748942 7:43351365-43351387 CTACTACAGCCGAAACTCTCTGG - Intronic
1025772828 7:64528813-64528835 CTACCACAGCTGATGCTCTCTGG + Intronic
1027417612 7:77990061-77990083 CTACCACAGCTGATGCTCTCTGG - Intergenic
1028182923 7:87747483-87747505 CTACCACAGCTGATGCTCTCTGG - Intronic
1030205069 7:106944486-106944508 CTACCACAGCCCAGGATCTGGGG - Intergenic
1030262174 7:107577711-107577733 CTACCTAATCAGAATCTCTGAGG - Exonic
1030382800 7:108831908-108831930 CTGCCTCAGAAGAAGCTATGTGG - Intergenic
1032150717 7:129427257-129427279 CTTCCTCAGCCCATCCTCTGTGG - Exonic
1033816687 7:145082584-145082606 CTACCACAGCTGATGCTCTCTGG - Intergenic
1035662542 8:1359026-1359048 CTGCCGAATCCGAAGCTCTGGGG - Intergenic
1039641500 8:39227820-39227842 CTACCACAGCTGATGCTCTCTGG + Intronic
1040869700 8:52087988-52088010 CTACATCAGCCTGAGCTGTGGGG + Intergenic
1041364209 8:57083767-57083789 CTACCACAGCTGATGCTCTCTGG + Intergenic
1041570512 8:59332922-59332944 CTACCACAGCTGATGCTCTCTGG - Intergenic
1043040825 8:75259821-75259843 CTACCACAGCTGATGCTCTCTGG + Intergenic
1043941648 8:86203018-86203040 CCACCTCAGCCAAAGTGCTGGGG + Intergenic
1044813930 8:96091342-96091364 CTACCTCGGCTGATGCTGTGTGG - Intergenic
1045076675 8:98576969-98576991 CTAGCTCAGCAGCAGCTATGGGG - Intronic
1046074451 8:109299743-109299765 CTACCACAGCTGATGCTCTCTGG + Intronic
1047307139 8:123662061-123662083 CTTCCTTACCCGAAGCCCTGGGG - Intergenic
1047502553 8:125453500-125453522 CAACCTGAGCAGAAGCTCAGTGG + Intergenic
1048187938 8:132261465-132261487 CTTCCTCATCCTCAGCTCTGGGG + Intronic
1049724295 8:144138378-144138400 CAACCTCAGCCAACGCCCTGCGG + Exonic
1050763953 9:9109470-9109492 CTACCTCAGCAGTAGTTGTGAGG + Intronic
1051858636 9:21599019-21599041 CTTTCTAAGCTGAAGCTCTGTGG - Intergenic
1058642797 9:107103520-107103542 CTACCCAAGCCGAATCTCTAAGG + Intergenic
1060421042 9:123469773-123469795 CTACCTCACGCGATGCTGTGAGG - Intronic
1062453658 9:136625998-136626020 CAACCTTAGCCTCAGCTCTGCGG + Intergenic
1186384165 X:9092203-9092225 CTACCTCAGCGGAATTTCTAGGG - Intronic
1187131983 X:16512061-16512083 CTACTGAAGCCGAAGCTTTGGGG - Intergenic
1187237890 X:17485429-17485451 TGACCTCAGCCTCAGCTCTGGGG - Intronic
1189603217 X:42648971-42648993 CTACCACAGCTGATGCTCTCTGG + Intergenic
1189692839 X:43635030-43635052 CTACCTCACCCAGAGCTCGGAGG + Intergenic
1189879147 X:45471213-45471235 CTACCACAGCTGATGCTCTCTGG - Intergenic
1192069031 X:67917915-67917937 CTACCACAGCTGATGCTCTCTGG - Intergenic
1192968149 X:76202179-76202201 CTACCACAGCTGATGCTCTCTGG - Intergenic
1193578551 X:83232984-83233006 CTACCACAGCTGATGCTCTCTGG + Intergenic
1193746725 X:85290911-85290933 CTTGCTCAGCAGAAGCTCTTTGG + Intronic
1194155381 X:90381343-90381365 CTACCTCAGTCAAATTTCTGGGG - Intergenic
1194701458 X:97119553-97119575 CTACCACAGCTGATGCTCTATGG - Intronic
1195675844 X:107506778-107506800 CCACCTCAGCCGCGGCTCTAGGG + Intergenic
1196119576 X:112035548-112035570 CTAACTCAGCAGATGCTCTTTGG + Intronic
1196119984 X:112039530-112039552 CTAACTCAGCAGATGCTCTCTGG + Intronic
1196948236 X:120850090-120850112 CTACCACAGCTGATGCTCTCTGG - Intergenic
1197675256 X:129323110-129323132 CTAGCTCAGCAGGAGCTATGGGG - Intergenic
1199057822 X:143318908-143318930 CTACCACAGCTGATGCTCTCTGG - Intergenic
1200501733 Y:3958276-3958298 CTACCTCAGTCAAATTTCTGGGG - Intergenic
1200699150 Y:6387273-6387295 TTACATCAGCCCCAGCTCTGGGG + Intergenic
1201034962 Y:9777426-9777448 TTACATCAGCCCCAGCTCTGGGG - Intergenic
1201408484 Y:13673335-13673357 CTACCACAGCTGATGCTCTCTGG + Intergenic