ID: 960162803

View in Genome Browser
Species Human (GRCh38)
Location 3:114368675-114368697
Sequence CTGGAGGCCTTGGACTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 118}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960162803_960162808 -3 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162808 3:114368695-114368717 CAGGTCAAGAACTCCTGCTCTGG 0: 1
1: 0
2: 2
3: 24
4: 236
960162803_960162814 15 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162814 3:114368713-114368735 TCTGGAGCAGGGCTGGAAGTGGG 0: 1
1: 0
2: 7
3: 51
4: 419
960162803_960162816 17 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162816 3:114368715-114368737 TGGAGCAGGGCTGGAAGTGGGGG 0: 1
1: 1
2: 15
3: 84
4: 917
960162803_960162809 3 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162809 3:114368701-114368723 AAGAACTCCTGCTCTGGAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 239
960162803_960162813 14 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162813 3:114368712-114368734 CTCTGGAGCAGGGCTGGAAGTGG 0: 1
1: 0
2: 4
3: 76
4: 466
960162803_960162815 16 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162815 3:114368714-114368736 CTGGAGCAGGGCTGGAAGTGGGG 0: 1
1: 0
2: 12
3: 78
4: 695
960162803_960162810 4 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162810 3:114368702-114368724 AGAACTCCTGCTCTGGAGCAGGG 0: 1
1: 0
2: 7
3: 36
4: 306
960162803_960162811 8 Left 960162803 3:114368675-114368697 CCAGTAGAGTCCAAGGCCTCCAG 0: 1
1: 0
2: 3
3: 18
4: 118
Right 960162811 3:114368706-114368728 CTCCTGCTCTGGAGCAGGGCTGG 0: 1
1: 1
2: 9
3: 60
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960162803 Original CRISPR CTGGAGGCCTTGGACTCTAC TGG (reversed) Intronic
902790884 1:18767156-18767178 GTGGGGGCCTTGGTCACTACAGG - Intergenic
904790825 1:33019343-33019365 CTGGAGACCTTTGATTCTATGGG - Intronic
905849808 1:41265309-41265331 CTGGGGGCCCTGGACTCTCCCGG + Intergenic
907795508 1:57712330-57712352 CTCGATGCTTTGGACTTTACTGG + Intronic
908863899 1:68523901-68523923 TTGAAGGCTTTGGACTCTATAGG - Intergenic
910084227 1:83380109-83380131 ATGGAGTCCTTGGACTCTTCAGG + Intergenic
916444762 1:164862022-164862044 CTGGAGGCCTTGGAATGTTTGGG + Intronic
918047714 1:180951534-180951556 CTGGAGGGCTGGGACTCTTTGGG + Exonic
923003692 1:230028334-230028356 CTGGAGGCCTTGAAAGCTAGAGG - Intergenic
924534479 1:244922908-244922930 GTGGAGGCCGTGGACTGTAGCGG + Intergenic
1065779559 10:29154324-29154346 CTGGATGCTTTGAACTCTAGAGG + Intergenic
1070890550 10:79939925-79939947 CTGGAGGCCTCTGACTCTTCAGG + Intronic
1073291176 10:102414024-102414046 CTGGAGGCCTTGGCCTCACCTGG - Exonic
1076531617 10:131148963-131148985 CTGGAGGCCTTGGCCACAGCTGG + Intronic
1080048761 11:27836875-27836897 CTGGTTGCCTTCGACTCTATGGG - Intergenic
1083452280 11:62753964-62753986 GTGGAGCCGTTGGACGCTACCGG - Exonic
1084629811 11:70340620-70340642 CTGCAGGCCTAGGACTCTACAGG - Intronic
1084630416 11:70344717-70344739 CTGCAGGCCTAGGACTCTACAGG - Intronic
1085587502 11:77724253-77724275 CTAGAGTCCTTGGGCACTACTGG + Intronic
1090081228 11:123614159-123614181 CTGGAAACCTGGGACTCTAAGGG + Intronic
1090606910 11:128431221-128431243 CTGGAGGTCTTGGACTCATCTGG - Intergenic
1090651593 11:128811038-128811060 CTGGATGCTTTGGACTCAACAGG + Exonic
1096074711 12:48795819-48795841 CTGGAAGCTTTGGGCTCTCCTGG - Intergenic
1096276673 12:50215344-50215366 CTGAAGGGCTGGGAGTCTACGGG + Intronic
1098781031 12:74686750-74686772 CTTGTGGCCCTGGACTCAACAGG - Intergenic
1103798263 12:123520000-123520022 CTGGAGGCCTTGGACCCACAGGG - Intronic
1104641868 12:130472124-130472146 GGGGAGGCCTTGGATTCTACTGG + Intronic
1106111746 13:26783613-26783635 CTGAAGGCCTTGGAGCCTTCTGG - Intergenic
1106356344 13:28987121-28987143 CTGGACCCCTCGGACTCTCCTGG + Intronic
1110861117 13:80345383-80345405 CCGGAGGCCTTGTATTCAACTGG + Intergenic
1119442886 14:74640586-74640608 CTGGAGGGAATGGGCTCTACTGG + Intergenic
1121178106 14:91906254-91906276 CAGGAAGCTTTGGACCCTACTGG - Intronic
1122183685 14:99972622-99972644 TTGGGGGCCTTGCACTTTACTGG - Intronic
1122465942 14:101933550-101933572 CTGGGGGCCTTGGGCCCTGCTGG - Intergenic
1122632725 14:103114303-103114325 CTGGGGGCCTGGGCCTCTCCAGG + Intergenic
1123107823 14:105851166-105851188 GTGGGGGCCTTGCACTCCACAGG - Intergenic
1127396475 15:58547449-58547471 CTGCAGTCCTTGGACGCTAGCGG - Intronic
1128532769 15:68465784-68465806 CTGAAGGCCTGGGACTGAACTGG - Intergenic
1129152245 15:73696458-73696480 CTGGGTGCCGTGGACTCTTCTGG + Intronic
1132343170 15:101090775-101090797 GTGGAGGCCTCAGACTTTACAGG + Intergenic
1133650876 16:7813683-7813705 CTGGATGCCTTTACCTCTACTGG - Intergenic
1134158924 16:11868593-11868615 CTGGAGCGCTTGCACTCTTCAGG - Exonic
1139357115 16:66372963-66372985 CTGGATGCCTGGGACACTGCAGG + Intronic
1140719894 16:77762049-77762071 TTGGAGGCCTTGTACGCTACTGG - Intergenic
1145940515 17:28741156-28741178 CTCAAGGCCTTGGACCTTACAGG - Exonic
1148798469 17:50208925-50208947 CTGGAGGCCTGGGATTCTGGGGG + Intergenic
1150124822 17:62628945-62628967 CTGGAGGCCCCAGACTCTCCAGG - Intronic
1151174082 17:72272786-72272808 ATGGAGGTCTTGGATTCTCCTGG - Intergenic
1152624897 17:81383696-81383718 GTGGAGCCCTGGGACTCCACAGG - Intergenic
1157277065 18:46318560-46318582 CTGGAGGCCCTGGAGTCTGCAGG - Intergenic
1157585268 18:48797049-48797071 CAGGAGGCCTTGGAGTCCACAGG - Intronic
1158546768 18:58404098-58404120 TTTGTGGCCTTGGACTCTGCTGG + Intergenic
1161995311 19:7707928-7707950 CTGGAGGCTTTGGTCTCTCAGGG - Intergenic
1162104812 19:8364012-8364034 CTGGAGGCCTGGTAGTCTGCGGG - Intronic
1162142264 19:8592022-8592044 CTGGGGGCCGTGGACTCCATGGG - Exonic
1162724465 19:12681609-12681631 CTGGAGGCCTTCGGCACCACCGG - Exonic
1162966086 19:14156784-14156806 ATGAAGGCCTAGGACTCTGCAGG + Intronic
1163911955 19:20203522-20203544 CTGCAGACCTTGGCCTGTACAGG + Intergenic
1163971075 19:20795754-20795776 CTGCAGACTTTGGACTTTACTGG - Intronic
1164466166 19:28489360-28489382 CTTCAGGGCTTGGACTCTAGGGG - Intergenic
1165825410 19:38702911-38702933 CTGGAGGCCCAGGACACCACAGG - Intronic
928118309 2:28563802-28563824 CTGGAGACCCTGTATTCTACTGG - Intronic
928392006 2:30917417-30917439 CTGAAGGGCTTGGGCTCTGCAGG + Intronic
935723031 2:105996614-105996636 GTGGAGGCTTTGAACTCTCCGGG + Intergenic
937137177 2:119563741-119563763 CTGGAGGCCTCAGAGTCTAATGG + Intronic
939716841 2:145594538-145594560 TGTGAGGCCTTGGACTCTAGAGG - Intergenic
940326916 2:152435093-152435115 CTGGAGGCATTGGACTCATATGG + Intronic
947063281 2:226191031-226191053 CCGGAGGCCTTGGCCTACACTGG + Intergenic
948262697 2:236615761-236615783 CTGAAGGACTTGGACTGCACAGG + Intergenic
948728247 2:239947605-239947627 CTGGAGGCCTGGGGCTCGGCGGG - Intronic
948838120 2:240636048-240636070 CAGGAGGGCCTGCACTCTACAGG + Intergenic
1168927600 20:1595589-1595611 CTGGGAGCCTTGGACAGTACTGG + Intronic
1169826077 20:9770177-9770199 GAGGAGGGCTTGGACTCTGCAGG + Intronic
1170419801 20:16181344-16181366 CTGTTGGACTTAGACTCTACAGG - Intergenic
1173605388 20:44327393-44327415 CTGGAGGCCTTGCCCTGTGCTGG - Intergenic
1174327922 20:49794234-49794256 CTGTAGGCCTTGGAATTTTCTGG + Intergenic
1176206911 20:63894297-63894319 CGGGAAGCCTTGGATGCTACTGG + Intergenic
1176294712 21:5065303-5065325 CTGGGGGCCCTGGATTCTATGGG + Intergenic
1178703168 21:34851297-34851319 CTGGAGGCCTCGGCCTCTAAGGG + Intronic
1179862338 21:44196823-44196845 CTGGGGGCCCTGGATTCTATGGG - Intergenic
1180196176 21:46195694-46195716 CTGGAGGCCTTCGCCTGTATGGG - Exonic
1180248546 21:46564325-46564347 GTGGAGGCCCTGAACTCTTCTGG - Intronic
1181666331 22:24400681-24400703 CTGGAATCCTTGGACACTGCTGG - Intronic
1181757958 22:25038807-25038829 CTGGAAGCCTGGGACACTCCGGG + Exonic
1183412106 22:37660895-37660917 CTGTAGTCCTTGGCCTCTCCTGG + Intronic
1185235967 22:49713262-49713284 CAGGAGGCCTGGGACTCTGCAGG - Intergenic
949106763 3:208797-208819 CTGGAGACCTTGAATTATACAGG + Intronic
950328745 3:12138894-12138916 CTGCAGACCTTGGACTCTGCAGG - Intronic
950727280 3:14924525-14924547 CTGGAGGCCATGGGCTCCGCAGG + Intronic
954564862 3:51590894-51590916 CTGGAGGCCATGGGCTCTTCAGG + Intronic
960162803 3:114368675-114368697 CTGGAGGCCTTGGACTCTACTGG - Intronic
962463399 3:135635468-135635490 CCGAATGCCTTGAACTCTACAGG + Intergenic
968645667 4:1739526-1739548 CAGGTGGCCTTGGCCTCGACAGG + Intronic
969401610 4:6959428-6959450 CTGAAGCCCTTGGTCTCTGCTGG + Intronic
969841943 4:9889188-9889210 CAGGAGGCCTTGGACATTCCTGG - Intronic
979890085 4:126081494-126081516 CTGGAAGTCTTGTACTCTCCTGG - Intergenic
983087768 4:163468513-163468535 CTGGAGGCCTGGGCCTCAAGGGG + Intergenic
985652515 5:1113484-1113506 CTGTAGGCCTGGGACCCTCCTGG + Intergenic
987333456 5:16877098-16877120 TTGATGGCCTTGGACTCTCCAGG + Intronic
988702504 5:33689453-33689475 CTGGAGGACTAGGACTCAGCTGG - Intronic
990637335 5:57743629-57743651 CTGGAGGCCTTGGTGTGTCCTGG + Intergenic
990667915 5:58094528-58094550 TTGGAGGCCATGGGCTCTTCTGG + Intergenic
992080752 5:73233151-73233173 TTGGAGGCCTTGGCCTGTGCAGG + Intergenic
998151609 5:139760540-139760562 CTGGAATCCTGGGACTCTCCTGG - Intergenic
999192369 5:149757873-149757895 ATGGAGGCCTTGGACTCCCATGG + Intronic
1002790067 6:430749-430771 CTGGGGATCTTGGACTCTATGGG - Intergenic
1006932213 6:37695309-37695331 CTGGAGGCCTTGGCCTCTCCAGG - Intronic
1006980621 6:38145051-38145073 CTGAGGCCCTTGGACCCTACAGG - Intronic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1010242759 6:73631786-73631808 CTGGAGACCTTGGGCCCCACAGG + Intronic
1012644902 6:101666433-101666455 CTGGAGGGGTTGGAGACTACAGG - Intronic
1015227660 6:130876049-130876071 CTGGAGAGCTTGGAGTCTAGTGG - Intronic
1018157467 6:160999809-160999831 CTGGATGAATTGGACTCAACAGG + Intronic
1018882197 6:167895326-167895348 CTGGAGGATTTGGACTCAGCAGG + Intronic
1021101746 7:16592193-16592215 CAGAAGGCCTTGCACTGTACTGG - Intergenic
1021628662 7:22622083-22622105 CTGGACTCCTTCAACTCTACTGG - Intronic
1023515749 7:40999710-40999732 CTGGAGGCCTTGCTCTCTCCAGG - Intergenic
1023948879 7:44825332-44825354 CAGGAGGCTATGGAGTCTACAGG + Intergenic
1028889144 7:95967415-95967437 TTGGAGGCCTTGGACACTCCAGG + Intronic
1031202543 7:118706903-118706925 CTAGATTCCTTGGACTCTTCAGG + Intergenic
1034859665 7:154584327-154584349 CAGCAGGCCTTGGACTCCACAGG + Intronic
1036118712 8:5990265-5990287 CTGAAAGGCTTGGATTCTACTGG - Intergenic
1040888857 8:52294441-52294463 CTGGGGGCCTTGGTCCCTATGGG - Intronic
1044411526 8:91889549-91889571 CTGCTGGCCTTTGACTCCACAGG + Intergenic
1049184059 8:141239792-141239814 CTGGAGGGCATGGCCTCTGCAGG + Intronic
1051575398 9:18609600-18609622 CTGTGGGACTTGGAGTCTACAGG + Intronic
1052414600 9:28161228-28161250 CTAGAGGCCTAGGACCCAACTGG - Intronic
1058990507 9:110251431-110251453 CAGGAAGCCTTGGACGCTGCAGG - Exonic
1060739963 9:126091595-126091617 TGGGAGGCCCTGGACTCTGCTGG + Intergenic
1061473530 9:130846598-130846620 CTGGCCGCCTTGCACTCTAGTGG + Intronic
1061902263 9:133678965-133678987 CTGGGGGCCTTGGAGACTTCAGG - Intronic
1186443659 X:9607467-9607489 CTGGAGGCTTTGGACCCTGGGGG - Intronic
1192522161 X:71812367-71812389 CTGGAATCCTTGTACACTACTGG - Intergenic
1198049097 X:132931279-132931301 CTGGAGGCCTTGGTCTCCTGGGG - Intronic
1199948001 X:152682747-152682769 CTTGGGGCCTTGGCCTCTGCTGG + Intergenic
1199961678 X:152785707-152785729 CTTGGGGCCTTGGCCTCTGCTGG - Intergenic
1200255567 X:154580709-154580731 ATGGAGGCCATGGACCCTGCAGG - Intergenic
1200262202 X:154623695-154623717 ATGGAGGCCATGGACCCTGCAGG + Intergenic
1201396785 Y:13557039-13557061 CTGGTGGCCTGGGACTCTTCAGG + Intergenic
1202189846 Y:22230599-22230621 CTGGTGGCCTAGGACTCCCCAGG - Intergenic