ID: 960164126

View in Genome Browser
Species Human (GRCh38)
Location 3:114382625-114382647
Sequence CCCACAGTGAATTCCTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960164123_960164126 -5 Left 960164123 3:114382607-114382629 CCAGGTAGGACTTCACTCCCCAC 0: 1
1: 0
2: 1
3: 11
4: 120
Right 960164126 3:114382625-114382647 CCCACAGTGAATTCCTCCCTAGG 0: 1
1: 0
2: 2
3: 16
4: 137
960164122_960164126 3 Left 960164122 3:114382599-114382621 CCTCTCTGCCAGGTAGGACTTCA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 960164126 3:114382625-114382647 CCCACAGTGAATTCCTCCCTAGG 0: 1
1: 0
2: 2
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960164126 Original CRISPR CCCACAGTGAATTCCTCCCT AGG Intronic
906681886 1:47732404-47732426 TCCTCAGTGAATTCCTGGCTAGG - Intergenic
907660771 1:56390612-56390634 CTCCTAGTGAATTCCTCCATGGG + Intergenic
907861326 1:58356614-58356636 CCCACAGGGCCTTCCTCCCAAGG - Intronic
912068683 1:105779789-105779811 CCCACAGAGAGTCCCTCACTGGG + Intergenic
912568385 1:110605285-110605307 CCAACCATGAATACCTCCCTGGG - Intronic
914453809 1:147816851-147816873 GCCACAGAGAATCCCTACCTAGG - Intergenic
917627304 1:176859393-176859415 TCCACAGTGAATTCATGCCCAGG + Intronic
921155192 1:212433346-212433368 CCCACCCTGAACTTCTCCCTCGG + Intronic
1064028222 10:11866415-11866437 GACACAGTGAGTTCCGCCCTGGG + Intronic
1064860208 10:19817454-19817476 CTCACACTGAAGCCCTCCCTGGG - Intronic
1067187658 10:44044142-44044164 CCCACACTGAAATTCTCACTGGG - Intergenic
1068630384 10:59291490-59291512 CCTACATTGAATTTCTCCTTTGG - Intronic
1073459697 10:103659585-103659607 CCCACACTGGGCTCCTCCCTGGG - Intronic
1073958246 10:108896653-108896675 CACACAGTGACTGCCTCTCTTGG + Intergenic
1077224365 11:1433648-1433670 CCCACAGCGCATCCCTCCCCAGG - Intronic
1078045196 11:7907440-7907462 CCCACAGTGAATCCCTGGCTTGG + Intergenic
1084094495 11:66901974-66901996 TCCACAGTGACTTCCTCCACGGG - Intronic
1084968442 11:72756447-72756469 CCCCCAGTGAGTTCCTCTCTGGG - Intronic
1085120717 11:73965660-73965682 CCCCCAGTGCATTCCCCACTGGG - Intronic
1085797984 11:79561077-79561099 CCTACAGTGCCTTCCTCTCTAGG - Intergenic
1089360776 11:117884996-117885018 CTCCCACTGAATTCTTCCCTGGG + Intergenic
1089698878 11:120232266-120232288 CCCCCACTGAAGGCCTCCCTTGG - Intergenic
1090807272 11:130210302-130210324 CACACACTGAAGTCCACCCTGGG - Exonic
1104117858 12:125766802-125766824 CCCACACTGAATTCCAGTCTGGG + Intergenic
1104753484 12:131254567-131254589 CCCACAGTGATATCCTGGCTGGG + Intergenic
1109108871 13:58290917-58290939 CCCACTCTGAATTCCTGCCATGG - Intergenic
1110254951 13:73423150-73423172 CCCTCAGTATATTCCTCCTTAGG + Intergenic
1110925906 13:81151029-81151051 CCCACACTGATCTCTTCCCTAGG - Intergenic
1112723488 13:102274270-102274292 CCCACAGTGAATCCCACCTTGGG + Intronic
1114674474 14:24431212-24431234 CCCACAGTGCATTCCTTGGTGGG - Intronic
1116773829 14:49157278-49157300 CCCACACTGCACTCCACCCTGGG + Intergenic
1117541116 14:56747449-56747471 CCCACATGGAAATACTCCCTGGG + Intergenic
1118911571 14:70066182-70066204 CCAACAGTGATGCCCTCCCTGGG - Intronic
1120885801 14:89450930-89450952 CCCAGGGTGAATTCCTTCCTAGG + Intronic
1121382894 14:93489847-93489869 CCCACAGTGGTTCCCTTCCTGGG + Intronic
1122978767 14:105181716-105181738 CCCACAGTCCCTCCCTCCCTGGG - Intergenic
1125042062 15:35200016-35200038 GCCACAGTGACTTCCTCCATGGG - Intergenic
1125734044 15:41911456-41911478 CCGACAGTGAATGCCTGGCTTGG + Intronic
1128264948 15:66257504-66257526 CTGAGAGTGAATGCCTCCCTAGG - Intergenic
1130408288 15:83622905-83622927 CCCACAGGGCATTTCTCCCGAGG + Intergenic
1130673736 15:85934665-85934687 CCCACAGTGAGTTCCTCCTAGGG + Intergenic
1131683050 15:94744133-94744155 CCCATAATTAATTCCTCCCCTGG - Intergenic
1132105508 15:99059587-99059609 CCACCAGTGACTCCCTCCCTCGG - Intergenic
1132597782 16:761148-761170 CCCACGGTGCCTCCCTCCCTGGG + Exonic
1134363294 16:13552824-13552846 CCCACAGAGAATTGCTCCCTTGG - Intergenic
1135969406 16:27061365-27061387 CCCTCAGTGACCTCCTCCCCTGG + Intergenic
1137403901 16:48175402-48175424 CCCACAGGGAAGTCCTCCTTGGG - Exonic
1139089124 16:63622389-63622411 GCCACAGTGAGATCCTGCCTCGG - Intergenic
1139633938 16:68246670-68246692 CCCACACAGACTTCCTCTCTGGG - Intronic
1143131866 17:4683571-4683593 GCCCCAGTGCATTCCACCCTGGG - Intronic
1143898041 17:10152431-10152453 CGCACAGTCAATTCTTCACTGGG - Intronic
1149256580 17:54834374-54834396 CCCACAGTGCATTTCCCCTTAGG - Intergenic
1153397848 18:4645044-4645066 TCCACATTGACTTGCTCCCTGGG - Intergenic
1154375807 18:13808739-13808761 CCCACAGTGAATTTCCTCGTGGG - Intergenic
1160504602 18:79419812-79419834 GCCGCAGGGACTTCCTCCCTCGG + Intronic
1160543268 18:79637388-79637410 CCCAAAGGGACTTCGTCCCTCGG - Intergenic
1163777644 19:19227472-19227494 GCCACAGGGAATGCCTCCCAGGG - Exonic
1165164187 19:33839991-33840013 TCCAAAGTGAAGTCCTCCATGGG - Intergenic
1166096269 19:40541389-40541411 CACACAGTCACTTCCTGCCTCGG - Intronic
1166251765 19:41576297-41576319 CCCACAGAGAATGCATCCCCTGG + Exonic
1166281411 19:41796700-41796722 CCCACAGAGAATGCATCCCCTGG + Exonic
925166114 2:1716688-1716710 CCCACAGTGAGGTCCTGTCTGGG + Intronic
925785816 2:7430820-7430842 CCCACAGTGACCTCCTCCCTAGG - Intergenic
927323288 2:21773272-21773294 GCCACTCTGGATTCCTCCCTTGG - Intergenic
928123988 2:28603753-28603775 CCCACACTGGCTCCCTCCCTCGG + Intronic
932706467 2:74029356-74029378 CCAACAGTCAATACGTCCCTTGG + Intronic
933098426 2:78218354-78218376 CCCACAGTGGATTTTTCCTTAGG - Intergenic
934857319 2:97737468-97737490 CTCACAGGGATCTCCTCCCTGGG - Exonic
938098524 2:128479404-128479426 GCCACAGTGAACTCTGCCCTTGG - Intergenic
938444552 2:131367002-131367024 CCCACATTGCACTCCTCCCCGGG + Intergenic
946571278 2:221026737-221026759 CCCACAGTGTCTGTCTCCCTGGG - Intergenic
948122680 2:235543042-235543064 GCCACAGTCATTCCCTCCCTGGG + Intronic
948617130 2:239206599-239206621 CCCACAGAGTTTTCCTTCCTAGG - Intronic
1169999454 20:11598180-11598202 CCCACAGTGGATTTTTCCTTAGG - Intergenic
1174292996 20:49522103-49522125 CCCTCAGTGACCTCTTCCCTCGG + Intronic
1175284975 20:57831719-57831741 CCCACAGGGAATTAGCCCCTGGG - Intergenic
1177374893 21:20257484-20257506 CTCACAGTGACATCCTCCCATGG + Intergenic
1181363524 22:22357015-22357037 CCCTCTGGGAATTCCTCCCCAGG + Intergenic
1181372719 22:22431223-22431245 CCCTCTGGGAATTCCTCCCCAGG + Intergenic
1183057877 22:35318136-35318158 CCAGCTGTGAATTCCTACCTTGG - Intronic
1183808509 22:40233829-40233851 CCTACAGTGGATGCCACCCTTGG + Intronic
1185143712 22:49117833-49117855 CCCACAGGGAATGCATCCCCGGG + Intergenic
958737620 3:98027560-98027582 CCCACTGTGAAATGCTCTCTTGG + Intronic
960164126 3:114382625-114382647 CCCACAGTGAATTCCTCCCTAGG + Intronic
964100905 3:152987421-152987443 CCCACGGTGAAGACCTCACTTGG + Intergenic
964797641 3:160517122-160517144 CCCACACTGCCTTCATCCCTAGG + Intronic
967852711 3:194094080-194094102 CCCACAGTCAGCTCATCCCTGGG + Intergenic
968547533 4:1206502-1206524 CCAACAGCAAATGCCTCCCTAGG + Intronic
969105342 4:4803312-4803334 CACACAGCCAAGTCCTCCCTGGG + Intergenic
969891214 4:10261761-10261783 CCCACAGTGAACTCCTTGATGGG - Intergenic
971283177 4:25259409-25259431 CCCCTAGGAAATTCCTCCCTAGG - Intronic
973968513 4:56187756-56187778 CGCACACTGAATGCCTCCCACGG + Intronic
977622048 4:99149073-99149095 CTCACCTTGAATTCCTTCCTGGG + Intronic
978875734 4:113638446-113638468 CCCATAGAGAATATCTCCCTTGG + Intronic
979097830 4:116573557-116573579 CCCACAGAGAATCCCTACCGGGG - Intergenic
980379786 4:131997783-131997805 CCCACAGTGAATTTAGTCCTAGG - Intergenic
984890341 4:184486460-184486482 CCAACAGTGAAAGCCTGCCTCGG + Intergenic
986107244 5:4671536-4671558 CCCCCAGTGAATTGGGCCCTGGG - Intergenic
987006562 5:13716225-13716247 CTCAAAGAAAATTCCTCCCTGGG + Intronic
992104263 5:73436996-73437018 CCCAGAGTGATTTCCTTCCTGGG - Intergenic
992291234 5:75282184-75282206 TCCACACTGAATTTCACCCTAGG + Intergenic
993567167 5:89490068-89490090 CTTACAGGGAATTCCTTCCTTGG - Intergenic
994115539 5:96058186-96058208 CCTACACTGAGTCCCTCCCTGGG + Intergenic
995041972 5:107599013-107599035 TCCACAGTGACTTCCTGACTAGG - Intronic
998406842 5:141878806-141878828 CCCACAGCGCCTTCTTCCCTGGG + Intronic
1001557972 5:172649109-172649131 CCCACAGTTAGTTCCTCCTTTGG - Intronic
1001738783 5:174031932-174031954 CCCACCATGGCTTCCTCCCTGGG - Intergenic
1002665247 5:180818522-180818544 GCCACAGTGAATTCCAACGTAGG - Intergenic
1005872708 6:29986940-29986962 CCCACATTTGATTCCTTCCTGGG - Intergenic
1006902904 6:37514479-37514501 CCCAGAGTGCCTGCCTCCCTGGG + Intergenic
1007895605 6:45354424-45354446 CCCAAAGTGTATGCCTCGCTTGG + Intronic
1011165234 6:84439239-84439261 CCCAGAGTAACTTCATCCCTAGG + Intergenic
1015803179 6:137080985-137081007 CCCACTGTGCATTCCTCCCAGGG + Intergenic
1015837690 6:137439578-137439600 CCCACAGGCAATCCATCCCTGGG + Intergenic
1017566881 6:155696324-155696346 CCCGCAGTGAATGCCTGCCTCGG - Intergenic
1019436052 7:1022764-1022786 TCCCCAGTTACTTCCTCCCTAGG + Intronic
1020129843 7:5553542-5553564 GCCACAGTGCATTCCTTCCTTGG + Intronic
1031344096 7:120642993-120643015 CCCACAGTGTATTATTCCATTGG + Intronic
1031800086 7:126232396-126232418 CCAAGAGGGAATTCCTACCTTGG + Intergenic
1032279475 7:130489561-130489583 CCCACAGCGAATTCCTGGTTGGG + Intronic
1033756922 7:144403665-144403687 CCCACAGAGAATCCCTGCCAGGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034459137 7:151188236-151188258 ACTACTGTGAACTCCTCCCTTGG - Intergenic
1035071312 7:156147136-156147158 TCCCCAGTGAATTCTTCCCGTGG - Intergenic
1035566041 8:642084-642106 CCCAAAGTGAAATCATCTCTGGG - Intronic
1035779230 8:2214851-2214873 CCCACAGTGAGGTGCTCACTGGG - Intergenic
1036544058 8:9749420-9749442 GCCACAGTGAACCACTCCCTGGG - Intronic
1039365139 8:36921267-36921289 CCCACAGTGGATTGCTCTTTAGG + Intronic
1042913457 8:73850670-73850692 CCCACAGTAAATTGCTGTCTTGG - Intronic
1048385053 8:133904377-133904399 CCCACACTGACTCCCTCCCTGGG - Intergenic
1048783676 8:138028132-138028154 CCCACAGTGAACTCCATCCTTGG - Intergenic
1048985513 8:139732693-139732715 CCCACTGTGCATTCCTCCTGGGG - Intronic
1049520094 8:143083397-143083419 CCCACAGTGTTATCCTTCCTGGG - Intergenic
1049852519 8:144840692-144840714 ACCACACTGACTTCTTCCCTGGG - Intronic
1050168639 9:2792546-2792568 CACACAATAAATTCCTCCCATGG + Intronic
1052841496 9:33295117-33295139 CCCACAGAAAAGGCCTCCCTGGG + Exonic
1058908311 9:109498563-109498585 CCCTCAGTGATTTCATGCCTAGG + Intergenic
1059604638 9:115821208-115821230 CACAGAGTCAATTTCTCCCTAGG - Intergenic
1060877031 9:127090847-127090869 CACACAGTTAATGCCTCCCCAGG - Intronic
1185876068 X:3703384-3703406 CCCACAGGAAATTCCTCCATAGG + Intronic
1186358374 X:8811465-8811487 CCCACACTGCATTCCTCAGTTGG + Intergenic
1187091668 X:16103418-16103440 CCCACAGTGAGGTCCTGCCAAGG + Intergenic
1188010384 X:25049113-25049135 CCCACTGTAAATTCCTCACCTGG - Intergenic
1188831533 X:34904150-34904172 AACACAGTCAGTTCCTCCCTAGG + Intergenic
1190180406 X:48187021-48187043 ACCACAGTGACTTCCTCGCCTGG + Intronic
1190189649 X:48266667-48266689 GCCACAGTGACTTCCTCGCCTGG - Intronic
1190199378 X:48347200-48347222 GCCACAGTGACTTCCTCGCCTGG + Intronic
1190658413 X:52633171-52633193 GCCACAGTGACTTCCTCGCCTGG - Intergenic
1190666147 X:52697682-52697704 GCCACAGTGACTTCCTCGCCTGG + Intronic
1190673271 X:52760728-52760750 GCCACAGTGACTTCCTCGCCTGG - Intronic
1190793087 X:53717905-53717927 CCCACACTGCATTCCAGCCTGGG + Intergenic
1194481336 X:94428853-94428875 GAAACAATGAATTCCTCCCTTGG - Intergenic
1195205308 X:102593755-102593777 GCCACAGAGATTTCCTTCCTAGG + Intergenic
1195560163 X:106274123-106274145 CCCACATTGAGTTGCTGCCTGGG - Intergenic
1195561799 X:106292216-106292238 CCCACATTGAGTTGCTGCCTGGG + Intergenic
1200789513 Y:7287038-7287060 CCCACAGGAAATTCCTCCGTAGG - Intergenic