ID: 960165308

View in Genome Browser
Species Human (GRCh38)
Location 3:114394770-114394792
Sequence AGTTCACACAGCCAGCCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960165307_960165308 -5 Left 960165307 3:114394752-114394774 CCAAATAACTTGGCTAACAGTTC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 960165308 3:114394770-114394792 AGTTCACACAGCCAGCCGACTGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960165308 Original CRISPR AGTTCACACAGCCAGCCGAC TGG Intronic
901161413 1:7178952-7178974 GGTTCACACAGCCAGCATCCTGG - Intronic
902165193 1:14564474-14564496 AGTTCATACAGCAAGCCCACAGG - Intergenic
903068790 1:20716453-20716475 AGTCCAGGCAGCCAGCCGGCAGG + Intronic
903514970 1:23904072-23904094 AGTTCACACTGCCTGAAGACAGG + Intronic
910991009 1:93056305-93056327 AGTTGAGACAGGCAGCTGACCGG + Intergenic
916337716 1:163692316-163692338 ATTTCACTCAGCCCGCCAACTGG + Intergenic
921068562 1:211640164-211640186 AGATTACACAGCAAGCCGAGAGG - Intergenic
923618000 1:235553790-235553812 AGGTCACACAGCTAGCTTACGGG - Intronic
924615877 1:245611693-245611715 AGAACACACAGCCAGCTGAATGG + Intronic
1067689651 10:48493599-48493621 AGAGCACACAGGCAGCCGAGTGG - Intronic
1067799661 10:49350335-49350357 AGCTCACACAGGCAGACCACAGG + Intergenic
1075328746 10:121556584-121556606 AGGTCACACAGCCAGAGGCCGGG + Intronic
1075707880 10:124512753-124512775 AGGTCACACAGCCAGCAAACAGG + Intronic
1075732912 10:124646934-124646956 ATCTCACACAGCCAGCCTCCTGG + Intronic
1075964981 10:126603568-126603590 AGTTCACACAGCTAGCAATCAGG - Intronic
1077160244 11:1109422-1109444 AGTACACACAGCCAGGCCCCAGG - Intergenic
1077457254 11:2688514-2688536 AGGTCACACAGCCAGGCCAGTGG + Intronic
1078187282 11:9062885-9062907 AGTTACCACAGCCAGCTAACAGG + Intronic
1081526839 11:43933404-43933426 AGGTCACACAGCCAGCGGCAAGG - Intronic
1081993888 11:47351709-47351731 AGATCACACAGCTAGCAGTCGGG + Intronic
1090770541 11:129915718-129915740 AGCACACACACCCAGCTGACGGG - Exonic
1091831784 12:3555247-3555269 AGATCACAAAGTCAGCTGACAGG + Intronic
1095933358 12:47651264-47651286 AGTTCATTCAGCCAGCATACAGG - Intergenic
1095974083 12:47927420-47927442 AGTCCAGACAGCCAGCCTTCTGG + Intronic
1102529407 12:113535032-113535054 AGGTCACACAGCCCGCAGTCAGG - Intergenic
1104719919 12:131039564-131039586 AGTCCACACAGCCAGCCTCCAGG - Intronic
1109029645 13:57176508-57176530 AGTCAACACACCCAGCCAACTGG + Intergenic
1117312167 14:54538263-54538285 ACTTCACACAGCCATCACACAGG - Exonic
1117868086 14:60170161-60170183 AGGTCACACAGCTAGGAGACAGG + Intergenic
1120271832 14:82322244-82322266 AGTTCTCACAACCCGCAGACCGG - Intergenic
1120449255 14:84645225-84645247 AGTTCACACAACAAGCATACAGG - Intergenic
1128518419 15:68358780-68358802 TGTTCAAACAGCCAGCAGAGTGG - Intronic
1128806653 15:70536140-70536162 GGGCCACACAGCCAGCGGACGGG + Intergenic
1129090391 15:73143533-73143555 AGTCCACACTGCCTGCCCACCGG - Intronic
1133584131 16:7175517-7175539 TGTTCACACAACCAGCCCATAGG - Intronic
1135878490 16:26228534-26228556 AGTTCACACAGCCAGCAAGTAGG - Intergenic
1141574524 16:84955473-84955495 AGGTCACACAGCGATCAGACAGG - Intergenic
1144797572 17:17902645-17902667 AGTGCTCACAGACAGCAGACAGG + Intronic
1146883643 17:36457167-36457189 AGGTCCCAAAGCCAGCCCACTGG - Intergenic
1151666627 17:75549072-75549094 AGGCCACACAGCCAGACCACAGG - Intronic
1157724624 18:49954513-49954535 CCTTCACAGAGCCAGCCTACTGG - Intronic
1158627889 18:59087579-59087601 ACATCACACAGCCAGCTGTCAGG - Intergenic
1159010298 18:63052663-63052685 AGTGCACACACACAGCCGTCCGG - Intergenic
1161357963 19:3829812-3829834 AGTGCACAAAGACAGCCTACTGG - Intronic
1161672551 19:5622368-5622390 AGGTCACACAGCCGGCCCCCTGG + Intronic
1163708467 19:18831742-18831764 AGTCCACACCGCCAGCCGCCCGG + Intergenic
1165309556 19:35022078-35022100 AGGTCACACAGCCAGGAGGCAGG - Intronic
928200136 2:29242637-29242659 AGGTCACACAGCCAGAAGAACGG - Intronic
934985891 2:98884276-98884298 AGCTCACACAGCCAGGAGAAAGG + Intronic
936651069 2:114426407-114426429 AGAACACACACTCAGCCGACAGG - Intergenic
943346908 2:186749386-186749408 ACTTCAGAAAGCCAGCCAACTGG + Intronic
945188473 2:207163796-207163818 ATTTCACACTGTCAGCCCACTGG - Intronic
948329785 2:237155850-237155872 AGGTCACACAGCCGGCCCAGAGG + Intergenic
1170541144 20:17389333-17389355 AGTTCACACAGCCAGGATACAGG + Intronic
1173248552 20:41352490-41352512 AGGTTACAAAGCCAACCGACAGG + Intronic
1173895265 20:46546051-46546073 AGTGCAAACAGGCAGCGGACTGG + Exonic
1175075694 20:56370835-56370857 AGGTCACACAGCTAGCCATCAGG + Intronic
1179436852 21:41368271-41368293 GGGGCACCCAGCCAGCCGACAGG + Intronic
1182666448 22:31963817-31963839 AGGTCACACCGCCAGTTGACAGG - Intergenic
950708162 3:14796612-14796634 AGCTCCCCCAGCCAGCTGACAGG + Intergenic
954290856 3:49649261-49649283 AGGTCACAGAGCCAGAGGACTGG - Intronic
956192281 3:66619517-66619539 AGGTCACACAGCCAGGAGGCAGG + Intergenic
960165308 3:114394770-114394792 AGTTCACACAGCCAGCCGACTGG + Intronic
962678855 3:137778141-137778163 AGGTCACACAGCCTGACAACTGG + Intergenic
969255330 4:5997484-5997506 AGGTCACACAGTAAGTCGACAGG + Intergenic
969545997 4:7828256-7828278 AGTTCACATAGCCAGCCGGGGGG - Intronic
972804493 4:42514240-42514262 AATTCACACACCCAGCTGAAAGG + Intronic
978759514 4:112341244-112341266 GTTTCACACAGCAAGCTGACTGG + Intronic
979664146 4:123292688-123292710 TGTTCACACACCCAGCACACTGG - Intronic
981231673 4:142363909-142363931 AGCTCACACAGCAATCAGACTGG + Intronic
982600582 4:157443814-157443836 AGTTCCCAGAGACAACCGACAGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
988631366 5:32934763-32934785 AGGGCACACAGCCAGCTGCCTGG - Intergenic
993344429 5:86765043-86765065 AATTCACACAGTCAGCTGAACGG + Intergenic
997337964 5:133121068-133121090 AGGTCACACAGCCAGTGAACGGG - Intergenic
1002671882 5:180874005-180874027 ATTTCACTCAGCCCGCAGACAGG + Intergenic
1007138715 6:39549483-39549505 AGCTCACACAGCAAGCACACAGG + Intronic
1007734354 6:43971410-43971432 AAGTCACACAGCCAGCAGCCTGG + Intergenic
1016867298 6:148779874-148779896 AGTTCACAGAGGCAGCTAACAGG - Intronic
1023629037 7:42144829-42144851 TGTTCACATGGCCAGCCCACTGG + Intronic
1025724095 7:64042146-64042168 AGTTCACAGAGGCAGCCGTGAGG - Intronic
1026742963 7:72990403-72990425 AGTGCTCCCAGCCAGCCGGCCGG + Intergenic
1027029078 7:74875107-74875129 AGTGCTCCCAGCCAGCCGGCCGG + Intergenic
1027100772 7:75374675-75374697 AGTGCTCCCAGCCAGCCGGCCGG - Intergenic
1029469716 7:100746611-100746633 AGCTCAGACAGCCAGAGGACAGG - Exonic
1030635226 7:111940410-111940432 AGGTCACACAGCTAGGTGACTGG - Intronic
1031963803 7:128012906-128012928 AGGTCACTCAGCCAGCCCAAAGG + Intronic
1033879893 7:145868658-145868680 AGTCCCCAAAGCCAGCCCACTGG - Intergenic
1037574731 8:20191038-20191060 TTTTCAGACAGCCAGGCGACAGG + Intergenic
1047161054 8:122379940-122379962 AGTTCACACAGTCACACAACTGG - Intergenic
1048216594 8:132501293-132501315 AGTTCACTCAGCCAGCAAGCGGG - Intergenic
1049312039 8:141938448-141938470 GGGTCACCCAGCCAGCAGACAGG + Intergenic
1049527292 8:143133816-143133838 AAATCACACAGCCAGCAGGCAGG - Intergenic
1053595894 9:39561260-39561282 AGTTCACACAGTCAGGCAAAAGG - Intergenic
1053853862 9:42317901-42317923 AGTTCACACAGTCAGGCAAAAGG - Intergenic
1054570366 9:66803755-66803777 AGTTCACACAGTCAGGCAAAAGG + Intergenic
1059165912 9:112076347-112076369 ATTTCAGACAGCAAGCCAACAGG + Intronic
1059425357 9:114217590-114217612 AGGTCAGACAGCCAGCCTAGAGG + Intronic
1060225370 9:121786981-121787003 AGATCTCCCAGCCAGCCAACTGG + Intergenic
1061264097 9:129495813-129495835 AGGTCACACAGCCGGCCGGCCGG + Intergenic
1061408526 9:130405812-130405834 AGGTCACACAGCTAGCAAACGGG - Intronic
1061471765 9:130832504-130832526 AGTTCACACAGCCAGGAGGTAGG - Intronic
1061889716 9:133611909-133611931 AGGTCACACAGCCAGCAAAGAGG + Intergenic
1062549795 9:137080739-137080761 AGAACGCAGAGCCAGCCGACAGG + Exonic
1186537141 X:10361778-10361800 AGTTCACACAGCCTGGGGAAAGG + Intergenic
1199742159 X:150745683-150745705 AGTGCACACAGCCAGCCCCTGGG + Intronic