ID: 960171213

View in Genome Browser
Species Human (GRCh38)
Location 3:114463342-114463364
Sequence AGTTCAGGGGGAAACCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960171213_960171222 10 Left 960171213 3:114463342-114463364 CCTCCAAGGTTTCCCCCTGAACT 0: 1
1: 0
2: 0
3: 11
4: 117
Right 960171222 3:114463375-114463397 CCTTTTTCAGGTTACAGCTAAGG 0: 1
1: 0
2: 1
3: 6
4: 133
960171213_960171219 -2 Left 960171213 3:114463342-114463364 CCTCCAAGGTTTCCCCCTGAACT 0: 1
1: 0
2: 0
3: 11
4: 117
Right 960171219 3:114463363-114463385 CTTACATTAATCCCTTTTTCAGG 0: 1
1: 0
2: 1
3: 15
4: 214
960171213_960171223 13 Left 960171213 3:114463342-114463364 CCTCCAAGGTTTCCCCCTGAACT 0: 1
1: 0
2: 0
3: 11
4: 117
Right 960171223 3:114463378-114463400 TTTTCAGGTTACAGCTAAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 146
960171213_960171224 22 Left 960171213 3:114463342-114463364 CCTCCAAGGTTTCCCCCTGAACT 0: 1
1: 0
2: 0
3: 11
4: 117
Right 960171224 3:114463387-114463409 TACAGCTAAGGTGGTAACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960171213 Original CRISPR AGTTCAGGGGGAAACCTTGG AGG (reversed) Intronic
900545447 1:3226398-3226420 AGATAAGGGGGAAGCCGTGGAGG - Intronic
900966391 1:5961724-5961746 AGTTCACAGTGAAACCTTGAAGG - Intronic
903528302 1:24009992-24010014 GGTGCAGGGGGAATCTTTGGAGG - Intergenic
903853386 1:26321334-26321356 AGTCCAGGGTGAAAACGTGGAGG - Intergenic
904583712 1:31566895-31566917 AGTTCAGGGTGAAACCAAGGTGG - Intergenic
906817015 1:48889691-48889713 AGTTCAGCTGTTAACCTTGGAGG - Intronic
910361389 1:86416200-86416222 TGTTCTGGTGGAAACCTGGGCGG - Intergenic
911005492 1:93217532-93217554 CGCTCAGGGGGAAGCCTGGGAGG - Intronic
915931557 1:160063524-160063546 AGTACAGTGGGAAGCCTTGAGGG - Intronic
917237206 1:172907168-172907190 AGTTAAGGGAGCAACATTGGAGG - Intergenic
918551247 1:185744945-185744967 AATCCAGGGGGAAACATTGAGGG + Intronic
920640971 1:207751931-207751953 AGGTCAGGGGGAGGCCCTGGCGG - Intergenic
922856463 1:228779200-228779222 AGTCCATGGGGAAACCTGGAAGG - Intergenic
923474374 1:234318901-234318923 ATTCCATGGGGAAACCTTTGTGG + Exonic
1064684209 10:17842776-17842798 AGTTCAGGGAGAAAACTTCCGGG + Intronic
1071152605 10:82652497-82652519 ACTTCAGAGGGAAACCTTGAGGG - Intronic
1072427010 10:95338155-95338177 AGTTCAGGGTGACACGGTGGGGG - Intronic
1073152459 10:101321402-101321424 AGCTCAGAGGGCATCCTTGGTGG + Intergenic
1073212917 10:101819063-101819085 AGTTCTTGGGGACACCTTGTGGG - Intergenic
1077021437 11:418849-418871 AGTTCAGAGGGCATTCTTGGGGG + Intronic
1077759358 11:5074969-5074991 AGTTCATGGGGAATCATTAGCGG - Intergenic
1083904019 11:65658541-65658563 AGTTGAGGGGGAGACCATGGAGG - Intronic
1086865971 11:91980762-91980784 AGGCCAGGGAGAACCCTTGGTGG + Intergenic
1092480447 12:8854666-8854688 AGTTCTGAGGGAAGCCCTGGGGG + Intronic
1095821306 12:46481536-46481558 GGTTCAGAGGGATACCTTAGAGG + Intergenic
1096585016 12:52614331-52614353 AGTTCAGTGGGAACCCTTTAAGG + Intronic
1098552297 12:71775906-71775928 AGATCAGGGGCAAGTCTTGGGGG + Intronic
1101740418 12:107495635-107495657 AGTTCAGGGGGTATTCATGGAGG - Intronic
1101815361 12:108141899-108141921 AGTTGACGGGGACAGCTTGGAGG - Intronic
1102428186 12:112861129-112861151 AGTTCAGGGGCCAACCTCTGTGG - Intronic
1103527187 12:121576866-121576888 AGTTCACAGGGCAGCCTTGGGGG + Intronic
1110865341 13:80388245-80388267 AGTAAAGGAGGAAAGCTTGGTGG + Intergenic
1119651846 14:76389459-76389481 AGTTAAAGGGGAGCCCTTGGGGG + Intronic
1121666129 14:95673720-95673742 AGTTTAGGGGGAAAGCTTTTAGG + Intergenic
1122340856 14:101027684-101027706 AGGTCAAGAGGAGACCTTGGGGG + Intergenic
1122746999 14:103903677-103903699 AAGTCAGGAGGAAACTTTGGGGG - Intergenic
1123031390 14:105453268-105453290 AGTTCTGGGCACAACCTTGGAGG - Intronic
1126378108 15:48016974-48016996 AGTTTAGGAGAAGACCTTGGAGG - Intergenic
1129178614 15:73857464-73857486 AGCTCAGGAGGGCACCTTGGAGG - Intergenic
1135524382 16:23202949-23202971 AGTTAAGGAGAAAACCTTGGGGG + Intronic
1151155244 17:72119847-72119869 AGTTCTGGGGGAGGCATTGGTGG - Intergenic
1151327192 17:73386610-73386632 AGATCAGGGAGACTCCTTGGTGG - Intronic
1152324011 17:79625115-79625137 AGGGCAGGAGGAAACCTTGGGGG - Intergenic
1156509655 18:37625809-37625831 AGTCCAGGGGGAAATTTTGTGGG - Intergenic
1156901350 18:42303708-42303730 AGAACAGAAGGAAACCTTGGGGG + Intergenic
1157365225 18:47058572-47058594 AGACCAGGGGAAAAACTTGGAGG - Intronic
1162057785 19:8075092-8075114 AGTGCTGGGTGAAACCCTGGGGG + Exonic
1163106198 19:15124368-15124390 AGTTTAGGGGGACACCTGTGGGG + Intronic
1165007407 19:32818225-32818247 AGTGCATGGGGACACCTGGGAGG + Intronic
1165831193 19:38731209-38731231 TGTTCAGGTGGAAGCCTAGGGGG + Exonic
926591599 2:14745611-14745633 AGAACAGGAGGAAACTTTGGAGG + Intergenic
927702357 2:25276564-25276586 AGTGCAGGGGGATGCCTGGGAGG - Intronic
934735181 2:96686395-96686417 AGTTCAGGGGGCTCCCCTGGGGG - Intergenic
935367100 2:102306127-102306149 AGATCAGGGGGCCATCTTGGAGG + Intergenic
937986821 2:127641758-127641780 AGGTCAGGAGAAAACCTTGGGGG - Intronic
938061457 2:128258372-128258394 TGCTGAGGGGGACACCTTGGTGG - Intronic
938299627 2:130200929-130200951 AGTTCTGGGGAAAGCCCTGGAGG + Intergenic
939504308 2:143026883-143026905 ACTTCAGAGGGACAGCTTGGTGG - Intronic
939708126 2:145480381-145480403 AGTTCAGGGGAAAAACTAGGTGG - Intergenic
942791769 2:179768936-179768958 ATTTCAGAGGGAAGCCTTGTTGG + Intronic
944868771 2:203888765-203888787 AATTCAGGGGAAAACGATGGTGG + Intergenic
946987154 2:225286268-225286290 AGTTCTGGGCAAAAACTTGGAGG + Intergenic
1171753735 20:29080554-29080576 GGGTCAGGGCGAAACCTGGGAGG - Intergenic
1171788513 20:29496976-29496998 GGGTCAGGGCGAAACCTGGGAGG + Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1176018122 20:62948023-62948045 AGACCAGGCGGAAAGCTTGGTGG + Exonic
1176310775 21:5147758-5147780 AGGTAAGGGGGACAGCTTGGGGG - Exonic
1177743694 21:25184993-25185015 AGTTCAATGAAAAACCTTGGAGG + Intergenic
1179846280 21:44114277-44114299 AGGTAAGGGGGACAGCTTGGGGG + Exonic
1180087718 21:45515521-45515543 AGGGCAGGGGGAATCCTAGGGGG + Exonic
1182841966 22:33398377-33398399 AGCTCAGGAGGAAAGGTTGGGGG - Intronic
1183596367 22:38814897-38814919 AGTTCAGGGAAAAATCTAGGAGG + Intergenic
1183884132 22:40863136-40863158 AGTACAGTGGGAAGCCTTTGTGG + Intronic
952160386 3:30687746-30687768 TGTCCAGGGGGCAACCTGGGAGG - Intronic
953466026 3:43120203-43120225 AGTCCAGAGGGAAACTCTGGAGG + Intergenic
955754993 3:62217583-62217605 AGTGCAGGAGGAATCCTTGCTGG + Intronic
956607614 3:71088787-71088809 TGTTTAGGGGGAAACGCTGGAGG + Intronic
957132314 3:76238619-76238641 TGTCTAGGGGGAAACCTGGGGGG - Intronic
960171213 3:114463342-114463364 AGTTCAGGGGGAAACCTTGGAGG - Intronic
961212161 3:125133891-125133913 AGTGCAGAAGGAAACTTTGGGGG - Intronic
961379324 3:126487015-126487037 GAGTCTGGGGGAAACCTTGGGGG + Intronic
961469931 3:127105257-127105279 AGTTCAAGGGGGAGGCTTGGTGG + Intergenic
962681833 3:137808399-137808421 AGGCCAGTGGGGAACCTTGGAGG - Intergenic
965208405 3:165751556-165751578 ACTTCAGGGGGACAGCTTGACGG + Intergenic
966014535 3:175125253-175125275 AGTACAGGGTGAAACATTGTGGG + Intronic
966227754 3:177616399-177616421 AGTGCAGAGGGAAATCTAGGAGG + Intergenic
969140263 4:5064967-5064989 AAAGCAGGGGGCAACCTTGGAGG - Intronic
972824881 4:42746377-42746399 AGTTTAGGGCCAAACCTTGGAGG + Intergenic
973637039 4:52870065-52870087 ATTTGAGAGGGAAAGCTTGGAGG - Intergenic
977613567 4:99062162-99062184 ACTTCAAGGGCATACCTTGGAGG + Exonic
981688831 4:147483493-147483515 AGTTCAGGGGGAAATCTCTGGGG + Intronic
981915480 4:150027909-150027931 TGTTGAGGGGGAAACCTGGTGGG + Intergenic
986350499 5:6874102-6874124 AGTACAGGGGGACTCCTAGGGGG - Intergenic
986520818 5:8616291-8616313 AGTTCAGGGGGATAAGTTGTTGG + Intergenic
990097170 5:52131146-52131168 AGGCCAGGTGGAAACTTTGGTGG + Intergenic
996335237 5:122377087-122377109 ACTTCAAGGGTAAATCTTGGAGG - Intronic
997479540 5:134173900-134173922 AGTTCATTGGAAAACCTGGGTGG - Intronic
999040417 5:148403686-148403708 AGTTAAGGGGTAATCCTTGTAGG + Intronic
1001844076 5:174904929-174904951 AGGTGAGGGAGCAACCTTGGTGG + Intergenic
1001936261 5:175708054-175708076 AGTCCAGGGTGAGTCCTTGGTGG - Intergenic
1002400858 5:178990968-178990990 GGTTCAGAGGGACTCCTTGGGGG + Intronic
1002556757 5:180047840-180047862 AGTGCAGGAGGAAAGCCTGGAGG - Intronic
1003115163 6:3278835-3278857 AGGTCAGGCAGAAACCTGGGAGG - Intronic
1003166470 6:3683397-3683419 AGATTAGGAGGAACCCTTGGGGG - Intergenic
1003611239 6:7616693-7616715 AATTCAGGGGGAAAAGCTGGTGG - Intergenic
1007107673 6:39294815-39294837 AGTCCAGGGGGACTTCTTGGAGG + Intergenic
1011229087 6:85139794-85139816 AGTTTAGAGGGAAACTTGGGGGG - Intergenic
1011775012 6:90720060-90720082 AGGTCACGGGGAAATTTTGGAGG + Intergenic
1018611146 6:165648994-165649016 TGTTCTGGGGAAAACCCTGGTGG - Intronic
1021610521 7:22453375-22453397 AGTTCAGGGGGAAATGCTGAGGG - Intronic
1022478778 7:30729372-30729394 GGTTCAGGGGGACGCCATGGAGG + Intronic
1022591803 7:31670923-31670945 AGTTCAGAGGGACAGCTTGATGG + Intergenic
1022984461 7:35637300-35637322 AGATCTGGGTGAAACATTGGAGG + Intronic
1029624633 7:101712847-101712869 AGTTCAGGAGGACATCCTGGAGG + Intergenic
1035184019 7:157111850-157111872 AGTTCAGGGGAACAACTTGATGG - Intergenic
1038029448 8:23624334-23624356 AGTTCTGGGGTAGGCCTTGGGGG + Intergenic
1039425721 8:37484230-37484252 AGCTCAGGGGGAAAGCATGCTGG + Intergenic
1039755564 8:40518515-40518537 AGGTCAGGGGGATACCTTGAAGG + Intergenic
1040380286 8:46865410-46865432 ATTTTAGGAGGAAACCTGGGTGG - Intergenic
1049307593 8:141913817-141913839 AGTTGTGGGGGAAATCCTGGAGG + Intergenic
1049317068 8:141975068-141975090 TCTCCAGGGGGAACCCTTGGGGG + Intergenic
1052807580 9:33025903-33025925 AGTGCAAGGGGAAACCTGGCAGG + Intronic
1056621126 9:88215857-88215879 AGTTGAGGGGGACACATTGGTGG - Intergenic
1062380685 9:136285263-136285285 AGTTCAGGGGGCATTCGTGGGGG + Intronic
1186856305 X:13629545-13629567 AGTTCTAGGGGAAATCTTGATGG + Intronic
1187700485 X:21960223-21960245 AGTTCTGGGAGAGACCTAGGAGG + Intronic
1193747679 X:85301625-85301647 ATTTCTGGGGGAAACCTAAGGGG + Intronic
1198613256 X:138425415-138425437 ACTTCAGAGGGAAAGCTTGATGG + Intergenic
1201368845 Y:13238238-13238260 TGTTCAGGGGTCAACATTGGTGG - Intergenic