ID: 960175124

View in Genome Browser
Species Human (GRCh38)
Location 3:114508588-114508610
Sequence CTATATCTAAAGATGGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960175124 Original CRISPR CTATATCTAAAGATGGACTT TGG Intronic
901884239 1:12211534-12211556 CTATCTCTGAAGATGGACGAAGG - Intergenic
903970071 1:27113043-27113065 CTATATCTTAAGTTAGAATTCGG - Intronic
912749234 1:112271895-112271917 CTCAATCAAAAGATGGACATTGG - Intergenic
913353605 1:117891961-117891983 TGAGATCTAAAGATAGACTTTGG + Intronic
914464473 1:147913946-147913968 TTATAACTAAATATGTACTTGGG + Intergenic
921047931 1:211490630-211490652 CAATCTGTAAAGTTGGACTTGGG - Intronic
922067750 1:222160237-222160259 CCACATCTCAAGGTGGACTTAGG + Intergenic
922503195 1:226111322-226111344 CTTTATCTAAATATGCACCTGGG - Intergenic
922655658 1:227381067-227381089 TTTTATTTAAAGGTGGACTTAGG + Intergenic
924010079 1:239655011-239655033 ACATATCTAAAGATGGAACTTGG - Intronic
924088143 1:240475555-240475577 ATATGTCAAAAGATGAACTTGGG - Intergenic
1068304223 10:55183052-55183074 CTATATCTCATAATGGATTTGGG - Intronic
1070180959 10:74013511-74013533 CTATATCTAAAGTGTGACTTTGG - Intronic
1072182630 10:93001738-93001760 CTATATCTGAAGTTTGGCTTAGG + Intronic
1073696455 10:105874913-105874935 CCTTATCTACACATGGACTTGGG - Intergenic
1073882613 10:108000944-108000966 CAGTATCTAAAGGAGGACTTTGG + Intergenic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1078353846 11:10618631-10618653 AGATATCTAAAGATTGAGTTGGG + Intronic
1079599267 11:22291070-22291092 CTATATTTCAAGATGAAATTTGG - Intergenic
1080050759 11:27856490-27856512 CTACATCTACAGATGTACTGAGG + Intergenic
1083138816 11:60704614-60704636 CTAGATCTGCAGATGGGCTTTGG + Intronic
1084581089 11:70023986-70024008 CTATGTCTGAAGCTGGTCTTGGG - Intergenic
1086434231 11:86765373-86765395 GAATATCTCAAAATGGACTTTGG + Intergenic
1087334175 11:96822166-96822188 CTATATCTCAAGATTCATTTAGG + Intergenic
1087949444 11:104202665-104202687 CTAAACCTGAAGATGGACTGAGG - Intergenic
1090971316 11:131645600-131645622 CTTCATCTAAATATGTACTTTGG + Intronic
1093025790 12:14244179-14244201 ACATAACTAAACATGGACTTGGG + Intergenic
1093436410 12:19139877-19139899 CTATATATAAAGAAAGACTTGGG + Intronic
1098754624 12:74344713-74344735 TTATATCCAAAGTTGTACTTTGG - Intergenic
1098754696 12:74346089-74346111 TTATATCCAAAGTTGTACTTTGG + Intergenic
1099807547 12:87539099-87539121 TTATATATAAAGGTGGTCTTGGG + Intergenic
1100490847 12:95076410-95076432 ATAGATTTAAAGATGAACTTCGG - Intergenic
1100858510 12:98779616-98779638 CTAAATCTTAAGAAAGACTTTGG - Intronic
1102088863 12:110169414-110169436 CTGAATCTAGAGATGGTCTTGGG + Intronic
1105907331 13:24825731-24825753 CTAAATTTGAAGATGGAATTTGG + Exonic
1106947480 13:34845046-34845068 CTATCTCTAAATATGCTCTTTGG - Intergenic
1107113906 13:36726320-36726342 CTATTCCTACAGATGGCCTTGGG + Intergenic
1107828766 13:44355157-44355179 CTAGATCTGAAGATGAGCTTGGG - Intergenic
1109377866 13:61521901-61521923 ATATATCTATATATGTACTTTGG - Intergenic
1110767128 13:79293345-79293367 CCCTATCTAAATATGGATTTTGG - Intergenic
1111535920 13:89603076-89603098 CTATACCTAAGGATGGATTTAGG - Intergenic
1111601012 13:90474129-90474151 ATATGTCTAAAGATAGATTTAGG - Intergenic
1114705077 14:24716816-24716838 ATATATCTAAAGCTGTATTTAGG + Intergenic
1118556245 14:67025954-67025976 CTATATTGAAAGATCTACTTTGG + Intronic
1118912115 14:70070111-70070133 CTATATCTTGAGAGGGACTTTGG + Intronic
1122830223 14:104392365-104392387 CCAAATCTAAAGATGAAATTGGG - Intergenic
1123726003 15:23101943-23101965 TTTAAGCTAAAGATGGACTTAGG + Intergenic
1123828983 15:24114276-24114298 CTATATATAAAGATTGATTTTGG + Intergenic
1123843903 15:24277711-24277733 CTATATATAAAGATTGATTTGGG + Intergenic
1123858979 15:24443991-24444013 CTATATATAAAGATTGATTTTGG + Intergenic
1123863614 15:24494378-24494400 CTATATATAAAGATTGATTTTGG + Intergenic
1140429762 16:74892118-74892140 CTCTATCTAAAGGAGCACTTTGG + Intronic
1146435973 17:32848202-32848224 TAAAATCTAAATATGGACTTTGG + Intronic
1149617068 17:58009515-58009537 GTATATCTACAGATGACCTTTGG + Intergenic
1153260248 18:3216777-3216799 CGATGTCTGAAGATGGACTGTGG + Intronic
1153264097 18:3251446-3251468 CTATTTTTAAAGATGTGCTTTGG + Intronic
1153567398 18:6432043-6432065 CAATATCTAAAACTGGACTTTGG - Intergenic
1157004310 18:43563528-43563550 CTATATATACAGACTGACTTAGG - Intergenic
1159546743 18:69849124-69849146 TTATATTAAAAGATGGAGTTAGG - Intronic
1163269974 19:16247283-16247305 CTTTATTAAAAGATGGTCTTAGG - Intergenic
1167482470 19:49741653-49741675 CTACCTCGGAAGATGGACTTGGG - Intronic
925195459 2:1920458-1920480 CTAAATCTGAGGATGGAGTTTGG - Intronic
925195471 2:1920557-1920579 CTAGATCTGAGGATGGAGTTTGG - Intronic
925636025 2:5942032-5942054 TTAATTCTAAAGATGGACATGGG - Intergenic
926462232 2:13145252-13145274 CTGTTTTTAAAGAGGGACTTGGG + Intergenic
926573812 2:14558732-14558754 CTATGTCTAAACATGGGGTTAGG + Intergenic
927803181 2:26120404-26120426 CAGAATCTAAGGATGGACTTCGG - Intronic
928345564 2:30491195-30491217 ATATATTTACAGATGTACTTGGG - Intronic
928816797 2:35306496-35306518 TTATATTTAAAGAAGGACTCAGG + Intergenic
929382519 2:41369167-41369189 CTACAGCTCAAGATGGACCTTGG + Intergenic
930132241 2:47863978-47864000 ATAAATCTAAAGCTGGATTTAGG + Intronic
930807718 2:55507908-55507930 TTATATCAAAAAATGGTCTTGGG - Intergenic
931267876 2:60676378-60676400 CTCTTTTTAAAGATGAACTTTGG + Intergenic
931497346 2:62823087-62823109 GTAGACCTAAAGATGGACCTAGG - Intronic
935038327 2:99401420-99401442 TTATATATAAAAATTGACTTTGG + Intronic
936692196 2:114903612-114903634 TTATATCTCAAGATGAATTTGGG + Intronic
939323635 2:140657392-140657414 ATATATCTAAAGATTTACTCTGG - Intronic
939342376 2:140915351-140915373 CAATATCTAAAGAAGGGTTTGGG + Intronic
940206526 2:151208751-151208773 CTATATTTATAGATGAATTTAGG - Intergenic
941279156 2:163528606-163528628 ATATAGCTAAAGCAGGACTTGGG + Intergenic
941486610 2:166089689-166089711 CTATATAAAAAGATGGAATGGGG + Intronic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
945560560 2:211334359-211334381 CTACATATTAAGATTGACTTAGG - Intergenic
945817599 2:214624748-214624770 CTTTTTATAAAGAAGGACTTTGG - Intergenic
945862384 2:215138869-215138891 GTATATCTAATGATGGGCTGAGG - Intergenic
946895724 2:224321526-224321548 CTAAATGTAAGGATGGAATTAGG - Intergenic
947109964 2:226708068-226708090 TTATATCCACAGAGGGACTTGGG - Intergenic
1173876918 20:46378887-46378909 CTTAAGCTAAACATGGACTTTGG - Intronic
1177112507 21:17045634-17045656 TTATATTTAAAAATGGAGTTAGG - Intergenic
1178896499 21:36562981-36563003 CTTCATCTAAACATGAACTTGGG + Intronic
1182158001 22:28094040-28094062 ATTTATCTGAAAATGGACTTGGG + Intronic
1182388193 22:29965058-29965080 CTTTATCTAAAGTAGGTCTTCGG + Intronic
949553149 3:5129355-5129377 TCATATATAAAGTTGGACTTTGG + Intronic
949989318 3:9564848-9564870 CTATATCTTAACAAGGATTTAGG + Intergenic
950841144 3:15969656-15969678 CAACATCTAATGATGGACTAAGG - Intergenic
951846576 3:27090953-27090975 GTATAAGTAAAGGTGGACTTAGG + Intergenic
952617270 3:35289562-35289584 CTATTTCTATAGAAGGACCTAGG + Intergenic
953971049 3:47347250-47347272 CTGTCTCTAGAGAGGGACTTAGG - Intergenic
956832927 3:73071053-73071075 CCATGTCTAAAGCAGGACTTGGG - Intergenic
959888942 3:111532608-111532630 CTATATATAAAGATGTAGTAGGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960175124 3:114508588-114508610 CTATATCTAAAGATGGACTTTGG + Intronic
962156560 3:132954532-132954554 CTATACATGAAGATAGACTTTGG + Intergenic
962736982 3:138334225-138334247 TTAAACCTAAAGATTGACTTGGG + Intergenic
964465789 3:156990450-156990472 CTATATCTAAGGATAAATTTTGG - Intronic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
968226328 3:196974624-196974646 CTATATCTAAAAATGAGCCTTGG - Intergenic
969880111 4:10166286-10166308 CTATATCTGAAGAAGGAACTAGG - Intergenic
970067295 4:12113128-12113150 CAATATCCAAAGATGGAATCAGG - Intergenic
973061859 4:45736040-45736062 CTATTTCTTAAGATTGGCTTAGG + Intergenic
973239134 4:47938690-47938712 CCACAACAAAAGATGGACTTAGG - Intronic
974514285 4:62888333-62888355 TTATATCCAAAGCTGGGCTTTGG + Intergenic
979517391 4:121625399-121625421 CTATATCTAAAGCAGTACTTAGG - Intergenic
981760996 4:148194177-148194199 CTATATTTACAGATTAACTTAGG + Intronic
986578359 5:9236150-9236172 CTATAATTCAAGATGGAGTTTGG + Intronic
987398747 5:17452590-17452612 CAAAATCTAAGGATGGATTTTGG + Intergenic
988192210 5:27953132-27953154 CTATAAATAAAAATGAACTTTGG - Intergenic
989521138 5:42401817-42401839 CTATATGTAAAGACAGACTTGGG + Intergenic
989524645 5:42439585-42439607 ATTTATCTAAAGATGGACACTGG + Intronic
989825011 5:45843160-45843182 CAATACCTAAAGATGGAATTGGG - Intergenic
990321907 5:54638202-54638224 CTATATCTAAAAATGCACCGTGG - Intergenic
990816829 5:59795273-59795295 CTATATGTGAGGATAGACTTAGG + Intronic
993528845 5:89000817-89000839 GCATATCTACAGATGGACTATGG - Intergenic
995027160 5:107437495-107437517 CTAAATCTATACATTGACTTTGG - Intronic
995304485 5:110629357-110629379 CTATAACTAAAGATAGTCTCTGG - Intronic
996834752 5:127778412-127778434 CAATATCTAAAAATGGATTGAGG - Intergenic
997214417 5:132098576-132098598 CCATATCCAAAGATGGCCCTTGG + Intergenic
997967318 5:138368659-138368681 ATATATGTAAATATGGACTATGG - Intronic
998930457 5:147175631-147175653 CTATTTCCCAAGATGGACTATGG - Intergenic
999327916 5:150654819-150654841 CTATTATTAAAGTTGGACTTAGG - Intronic
999410831 5:151348306-151348328 CTGCAGCTAAAGATGGTCTTGGG + Intergenic
1003348984 6:5297961-5297983 CAGTATCTAAAGCTGGATTTAGG + Intronic
1003383497 6:5646566-5646588 CTATAACTACAGTTGGACTTTGG + Intronic
1004652805 6:17627894-17627916 CTAGATCTAAAGAAAGACATTGG - Intronic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1008186141 6:48393345-48393367 TTAAATCTATAGATGAACTTGGG - Intergenic
1009402127 6:63269505-63269527 CTTTATCCAATGATGGACCTAGG - Intergenic
1010627903 6:78161100-78161122 TTATATATAAATATGGACATAGG - Intergenic
1014080110 6:117276079-117276101 CAATATCTTAAGATTGATTTGGG + Intergenic
1014796153 6:125727079-125727101 CTGTATATGAAGATGGGCTTGGG - Intergenic
1018123394 6:160658944-160658966 CTATATCTATAGATAGATATAGG - Intronic
1018333981 6:162764543-162764565 CTATCTCTAAATATGGACATGGG - Intronic
1018960535 6:168444463-168444485 CCATTTCTAAAGAATGACTTTGG - Intronic
1020740061 7:12004691-12004713 CTTTATCTGACGAAGGACTTTGG + Intergenic
1020762441 7:12284955-12284977 GTATACCAAAAGATGGTCTTAGG - Intergenic
1021247347 7:18280148-18280170 CAATATTTAAAGAGGGAATTTGG + Intronic
1022092472 7:27116593-27116615 AAATATCTAAGGATGGACTCTGG - Intronic
1022429849 7:30306771-30306793 CTATTTCAAAAAGTGGACTTGGG - Intronic
1022633602 7:32109952-32109974 CTATTTCTGCACATGGACTTGGG + Intronic
1026424780 7:70279815-70279837 CTATAGCCAAAGATGCACTCTGG - Intronic
1027187895 7:75982641-75982663 CTATCTCCATAGATAGACTTGGG + Intronic
1030088017 7:105833580-105833602 CTATATCTTAATAGGGATTTTGG + Intronic
1030650235 7:112109689-112109711 CTATATATAGAAATGGACTCTGG - Intronic
1031349455 7:120711824-120711846 CTAACTATAAATATGGACTTTGG - Intronic
1031379029 7:121062009-121062031 TTAATTCTAAAGATGAACTTTGG + Intronic
1038465519 8:27759303-27759325 CTACATTTAAAGATGAATTTAGG + Intronic
1040950159 8:52930534-52930556 ATTTATCTAAAGATCAACTTGGG + Intergenic
1043018538 8:74970847-74970869 CTACATCTAATGATGAACCTAGG - Intergenic
1043615067 8:82115098-82115120 CTATATCAAAAGAGGGGCCTTGG - Intergenic
1045076418 8:98574073-98574095 CTATAATTAAAGATGAAATTTGG + Intronic
1047921649 8:129640630-129640652 CTATCTCTAAAGATGGTATTAGG + Intergenic
1048853449 8:138665870-138665892 CTATTTCTAAAAATGTACTCTGG - Intronic
1052648109 9:31264249-31264271 CTAGATCTATAGTTGGACTCAGG - Intergenic
1053027032 9:34738655-34738677 TTACATCTAAGGATGGACATGGG + Intergenic
1056080485 9:83088267-83088289 CTATATATAAATATAGACATAGG + Intergenic
1056633980 9:88316662-88316684 GTATATCTATATATGCACTTGGG - Intergenic
1058360958 9:104145332-104145354 CTATATCTACAGAATGCCTTGGG + Intergenic
1059981555 9:119777947-119777969 CTTTTTCTAAAGCTGGAATTAGG - Intergenic
1060013932 9:120069997-120070019 CTTTATCTACTGTTGGACTTAGG + Intergenic
1187092655 X:16113492-16113514 CTATATCTAAGGAAAAACTTTGG + Intergenic
1193283314 X:79682548-79682570 CTATATTTCAAGATGGGATTTGG - Intergenic
1193691402 X:84649182-84649204 CTATATCTTCATATGGATTTTGG - Intergenic
1194720477 X:97334566-97334588 CCATACCTCAAGATGGAATTTGG + Intronic
1196392810 X:115226658-115226680 CTATATCTAGTGAGGGACTAAGG - Intronic
1196913734 X:120511030-120511052 CAATATATAAAGATGTACTTTGG + Intergenic
1197349648 X:125368567-125368589 ATATAGCTAAAGAAGAACTTGGG + Intergenic
1198569629 X:137941230-137941252 CTATATCTATAGATTCACCTTGG + Intergenic
1199338247 X:146644291-146644313 CTATATATAGATATGGACTAGGG - Intergenic
1199778122 X:151033510-151033532 CTAGATCTGAAGCTGGAATTTGG + Intergenic
1200907030 Y:8494186-8494208 CTATACCTAAAGAAGAACCTAGG + Intergenic
1201787319 Y:17799413-17799435 ATTTATCTAAAGATTCACTTAGG - Intergenic
1201814234 Y:18106575-18106597 ATTTATCTAAAGATTCACTTAGG + Intergenic
1201926089 Y:19289560-19289582 ATATATATATATATGGACTTAGG + Intergenic
1202259818 Y:22958729-22958751 CTATACCTAAAGAAGCACCTAGG + Intergenic
1202332035 Y:23764279-23764301 ATTTATCTAAAGATTCACTTAGG - Intergenic
1202412804 Y:24592473-24592495 CTATACCTAAAGAAGCACCTAGG + Intergenic
1202457977 Y:25077597-25077619 CTATACCTAAAGAAGCACCTAGG - Intergenic
1202538734 Y:25905781-25905803 ATTTATCTAAAGATTCACTTAGG + Intergenic