ID: 960177944

View in Genome Browser
Species Human (GRCh38)
Location 3:114539434-114539456
Sequence GCAAATAAGAGCTGTGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960177944_960177946 6 Left 960177944 3:114539434-114539456 CCACATACACAGCTCTTATTTGC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
960177944_960177945 -9 Left 960177944 3:114539434-114539456 CCACATACACAGCTCTTATTTGC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 960177945 3:114539448-114539470 CTTATTTGCTTCTCTACCTTAGG 0: 1
1: 0
2: 1
3: 36
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960177944 Original CRISPR GCAAATAAGAGCTGTGTATG TGG (reversed) Intronic
905068488 1:35205004-35205026 ACAAAAATGAGCTGGGTATGTGG + Intergenic
907789458 1:57647684-57647706 GGAAATAACATCTGGGTATGTGG - Intronic
910796269 1:91100544-91100566 GCAGATCAGATCTTTGTATGTGG + Intergenic
911297708 1:96137781-96137803 GCAAAGCAGAGCTGGGTGTGAGG - Intergenic
911830151 1:102540060-102540082 GCTAAAAAGAACTGGGTATGTGG - Intergenic
915792888 1:158694529-158694551 GTAATTAAGAGGTGTGTATTTGG + Intergenic
915984554 1:160451302-160451324 GCAAATCAGAGCTGCGTGTTTGG + Intergenic
916463735 1:165051517-165051539 GCAGATAACAGCTGTGTAGAAGG + Intergenic
918728484 1:187956912-187956934 GCAAATCAAACCTGTGGATGGGG + Intergenic
920605054 1:207373726-207373748 GAAAACAAAAGCTGTGTATGAGG + Intergenic
921009404 1:211126210-211126232 ACAAAAATTAGCTGTGTATGGGG + Intronic
924292718 1:242554541-242554563 GGAAAGAAGATCTGTGGATGTGG + Intergenic
1068516443 10:58031153-58031175 GCAAATAGGAGATGTGAAAGTGG - Intergenic
1068922757 10:62502160-62502182 GCCAATTAGGGCTGGGTATGGGG - Intronic
1070659663 10:78295468-78295490 ACAAATTAGAGATGTGGATGAGG - Intergenic
1072066862 10:91879802-91879824 CCAATAAAGAGCTTTGTATGTGG + Intergenic
1072758893 10:98039788-98039810 GCAAAGCAGAGCTAGGTATGCGG + Intergenic
1074593060 10:114832641-114832663 AGAAATAAGAGCTATTTATGTGG - Intronic
1074662441 10:115676973-115676995 GTAAATAAGAGGTATGTATCAGG - Intronic
1075638719 10:124049227-124049249 GGAAATAAGAGATGAGTATTTGG + Intronic
1078940237 11:15995135-15995157 GAAAAACAGAGCTGTGTATCTGG + Intronic
1080141779 11:28930444-28930466 CCAAAAAAGAGCTGTGTAAAAGG - Intergenic
1083223360 11:61267847-61267869 GGAAATACGAGGTGTGTGTGAGG + Intronic
1087002585 11:93435658-93435680 GAAAGAAAGAGCTGTGTAGGAGG - Intronic
1090438987 11:126710815-126710837 CCAAATAAGATTTGTGTTTGTGG - Intronic
1090834873 11:130447089-130447111 GCAAATCAGAGCTGGGGTTGGGG - Intergenic
1092037529 12:5350141-5350163 AAAAATAAGACCTGTGAATGGGG - Intergenic
1092305274 12:7293876-7293898 TCAGATAAGAGCTGTCTATCAGG - Intergenic
1093592843 12:20926411-20926433 GCAAATTAGTGCAGTGTCTGTGG - Intergenic
1094058931 12:26293009-26293031 GCAAGTAAGAGCTCTGTAGCAGG + Intronic
1097450904 12:59735501-59735523 GCGAATAAGAGTTCTGTTTGTGG + Intronic
1098187278 12:67910915-67910937 GCAAGTAAGGGCTTTGTCTGGGG + Intergenic
1101753164 12:107599991-107600013 TCAAGTAAGACCTGTGTTTGTGG - Intronic
1103236665 12:119378673-119378695 GCAAATTTCAGCTGTGTCTGGGG - Intronic
1107989368 13:45803751-45803773 GCATAGAAGAGCTATGTATAAGG + Intronic
1111369461 13:87298068-87298090 TCAAATAAGGGCGGTGAATGGGG + Intergenic
1112708485 13:102099684-102099706 ACAAATAAGAGATGTTTTTGAGG - Intronic
1115003131 14:28444932-28444954 TAGAATAGGAGCTGTGTATGGGG + Intergenic
1117051225 14:51861366-51861388 GCAAATGATAGCTGTGTCTGAGG - Intronic
1118815455 14:69310353-69310375 TCAAATAACAGCTGTGTTGGGGG - Intronic
1121493284 14:94375236-94375258 GCAAACATGAGCTGTGTATGGGG - Intergenic
1121661618 14:95639494-95639516 GCAAGGCAGAGCTGTGTGTGTGG + Intergenic
1124961223 15:34397107-34397129 GAAGAAAAAAGCTGTGTATGGGG - Intronic
1124977853 15:34543328-34543350 GAAGAAAAAAGCTGTGTATGGGG - Intronic
1124993233 15:34696495-34696517 GAAAATAAGAACTGTGAAAGGGG - Intergenic
1126682523 15:51216552-51216574 GCAAATAAAAGCAGACTATGGGG - Intronic
1129769543 15:78194324-78194346 GCAAATAAAAGCTCAGTACGGGG + Intronic
1130229288 15:82084376-82084398 GCAAGTGTGAGCTGTGTATGGGG + Intergenic
1131572830 15:93556388-93556410 GCACATAAGAGTGGGGTATGTGG - Intergenic
1131749541 15:95491833-95491855 CCTAATAATAGCTGTGTATTGGG + Intergenic
1133532544 16:6668536-6668558 GCAAATAAGAGCTTTATATCAGG + Intronic
1134065362 16:11224940-11224962 GATAATAAAAGCTGTTTATGAGG + Intergenic
1137316506 16:47329876-47329898 GCACATAAGAGCTAAATATGTGG + Intronic
1137793225 16:51192916-51192938 GCACACTTGAGCTGTGTATGGGG + Intergenic
1139083482 16:63555554-63555576 TCAAATAACAGCTATGTATGTGG + Intergenic
1140060766 16:71567800-71567822 GAAAATAAGAGCTCAGGATGAGG - Exonic
1141220453 16:82064797-82064819 ACAAATAAGAGCAGAGTCTGAGG - Intronic
1144072260 17:11685228-11685250 GCAAGTAAGAGCTGTTTCAGGGG + Intronic
1144300648 17:13920540-13920562 GCAAATCATAGATGTGTCTGTGG + Intergenic
1145105838 17:20116019-20116041 GACAATAAGAGTTCTGTATGTGG + Intronic
1147348241 17:39819376-39819398 GCAAATGATAGCTGTGCCTGTGG - Intronic
1148576155 17:48712809-48712831 GCAAAGAAGAGCTGTGACTGAGG - Intergenic
1150978325 17:70113608-70113630 GCAACTAAGAACTGAGTTTGGGG - Intronic
1153152897 18:2114770-2114792 ACAAATAAGAGATGGGTAGGTGG - Intergenic
1153475498 18:5494502-5494524 ACAAAAATTAGCTGTGTATGCGG + Intronic
1156062770 18:33100619-33100641 TCATATAAGAGCTCTGTATGTGG + Intronic
1156139914 18:34095177-34095199 GCAACTAAGAGAAGTCTATGTGG - Intronic
1158301088 18:56053994-56054016 GCAAATAAGAGCAGCATATTCGG - Intergenic
1159370626 18:67523341-67523363 GCACATAAAAGCAGTGTATTTGG + Intergenic
925592507 2:5524627-5524649 GAAAAAAATAGCTGTTTATGTGG + Intergenic
925807035 2:7660744-7660766 GCAAAAAAGAGCTGGGCAGGGGG - Intergenic
927536315 2:23863014-23863036 GCAAATACAAACTGTTTATGAGG - Intronic
928359788 2:30653872-30653894 GCAAATAATAGCTGCATATATGG + Intergenic
928630891 2:33190798-33190820 GCCAATGAGGGCTGTGTTTGTGG - Intronic
929688844 2:44058002-44058024 GCAAATGAGAGCAGGGAATGGGG + Intergenic
930736113 2:54780430-54780452 GCAAAGAAGATCTCTGTATCAGG - Intronic
932885524 2:75545920-75545942 GCAGATAATAGCTGAGAATGGGG + Intronic
933574739 2:84054746-84054768 GTAAATAAGAGATGTTGATGAGG - Intergenic
934042327 2:88138041-88138063 GCAAGTATTAGCTGTGTGTGTGG - Intergenic
934117355 2:88810160-88810182 GCAAATAAAAGTTGTTTGTGTGG - Intergenic
942431772 2:175919569-175919591 GCAAAGTAGTGCTGTGTATCTGG - Intergenic
943050417 2:182907223-182907245 TGAAATAAGAGTTGTGTGTGTGG - Intergenic
1171322715 20:24260543-24260565 GCAAATAGGAACTGGGTAAGGGG - Intergenic
1175132785 20:56802059-56802081 CCAAGTAAGAGCTGGGAATGAGG - Intergenic
1176678895 21:9807038-9807060 GAAAATAAGAGCTATCTTTGAGG - Intergenic
1177192931 21:17871825-17871847 CCAAATAAGAGTTTTGAATGGGG + Intergenic
1177345242 21:19859053-19859075 TCAAATAAGTGGTGTGGATGTGG - Intergenic
1181889494 22:26049424-26049446 GCAAATAAGACCTGTGACTCTGG - Intergenic
1182191579 22:28466598-28466620 GCAAATTAGAGATGTAAATGTGG - Intronic
1184062071 22:42089369-42089391 GCAGATAAAAGATGTGTGTGGGG - Intronic
950850355 3:16056432-16056454 ACAAATAAGAGTTGAGAATGAGG - Intergenic
954422834 3:50427593-50427615 GCAATTAAAAGGTGTTTATGTGG - Intronic
956203564 3:66732589-66732611 CACAATCAGAGCTGTGTATGTGG - Intergenic
956482781 3:69689535-69689557 GCAAAGGAGAGCTGGGTGTGCGG + Intergenic
960177944 3:114539434-114539456 GCAAATAAGAGCTGTGTATGTGG - Intronic
960402127 3:117214005-117214027 ACAAATAAGAGCTGTGCCAGAGG - Intergenic
961636482 3:128336094-128336116 GCAAGTAGGAGCTGTCTCTGAGG - Intronic
963889410 3:150617107-150617129 GCAAATAACAGCTGAGTTGGAGG + Intronic
964316125 3:155445945-155445967 GCGAATAAGTGGGGTGTATGTGG - Intronic
964918940 3:161872268-161872290 TCAGATAAGAGATGTGTAAGTGG - Intergenic
966940065 3:184740675-184740697 GCTAATCATAGCTGTGTTTGGGG - Intergenic
967668102 3:192198857-192198879 GCCACTAAGAGCTGTGTCTCTGG - Intronic
970133499 4:12896479-12896501 GAAAATAAGAGCAGAGAATGTGG + Intergenic
970541419 4:17083694-17083716 AAAAAAAAGAGCTGTGTATCTGG + Intergenic
970587294 4:17526774-17526796 GCAAAAAGGAGCCGTGAATGAGG + Intronic
972491181 4:39588727-39588749 GGAAATAAAAGCTAAGTATGGGG + Intronic
974730802 4:65863437-65863459 GCAAATAAAAGCAATATATGTGG + Intergenic
976475093 4:85474754-85474776 GCAAGTAAAACCGGTGTATGGGG + Intergenic
978060978 4:104338064-104338086 GCGAATAAGAGTTGTGTGAGTGG + Intergenic
980131408 4:128819481-128819503 GCTAAGAAGACCTGTGTAAGAGG + Intronic
980810544 4:137872975-137872997 GACAATAAGAGATGTGCATGAGG - Intergenic
982700518 4:158656178-158656200 GGATTTAAGAGATGTGTATGAGG - Intergenic
985119793 4:186628637-186628659 GCAAATCAGTGCTGTGGATCAGG - Exonic
985396653 4:189551906-189551928 GAAAATAAGAGCTATCTTTGAGG + Intergenic
985643511 5:1074511-1074533 GCACAGAAGAGCTGTTTCTGAGG - Intronic
987630527 5:20464589-20464611 GCAGAGAAGAGATGTCTATGAGG + Intronic
989487506 5:42009193-42009215 GCAAATAAGAGCTAAGTCAGTGG - Intergenic
990363892 5:55049463-55049485 TCAAATAGGAGCTGAGTTTGTGG - Intergenic
990709997 5:58570115-58570137 GGAAATAAAAGCAGTGTAAGAGG + Intergenic
991086053 5:62649234-62649256 GAAAATCTGAGCTGTGTATAGGG + Intergenic
992868915 5:80986346-80986368 TGCTATAAGAGCTGTGTATGGGG - Intronic
996213648 5:120841544-120841566 GCAAGAAAGAGATGTGTTTGAGG + Intergenic
996238531 5:121165628-121165650 CCAAATATTTGCTGTGTATGAGG - Intergenic
996429770 5:123360720-123360742 GCAGATAAGAAAAGTGTATGAGG + Intronic
997501676 5:134380063-134380085 ACAAAAATGAGCTGGGTATGGGG - Intronic
999227249 5:150036085-150036107 CCACTTAACAGCTGTGTATGTGG - Intronic
1000828223 5:166072674-166072696 GCAAATCAGAGATTTGTATAAGG + Intergenic
1001445919 5:171782941-171782963 GCCAGTCAGAGCTCTGTATGTGG + Intergenic
1002666554 5:180829870-180829892 GCAAATGAGCTGTGTGTATGAGG - Intergenic
1007261684 6:40568468-40568490 GCAAAAAAAAGTTATGTATGTGG + Intronic
1009637344 6:66283161-66283183 GAAACTAGGAGTTGTGTATGTGG - Intergenic
1010947167 6:81988898-81988920 GCAAATAACAACTGAGTATGTGG - Intergenic
1012300037 6:97575065-97575087 GCAAATAAGAGTTATCTTTGGGG - Intergenic
1015243184 6:131049098-131049120 GCAATGAAGAGCTGTGGATGTGG - Intronic
1020963774 7:14840132-14840154 GGATATAAGAGATGTGTATCAGG - Intronic
1022864226 7:34400505-34400527 GAAAATAGGAGCAGTTTATGCGG - Intergenic
1027197945 7:76044133-76044155 GCAGATAGGAGCTGAGTGTGAGG + Intronic
1030100029 7:105937663-105937685 GCAGATAAGGGCTGTGGGTGAGG + Intronic
1030596889 7:111550739-111550761 GTAAATAAGAGCTGTGCAGAAGG - Intronic
1031064369 7:117089012-117089034 TAAAATAACAGCTGTGTTTGAGG - Intronic
1031256142 7:119450905-119450927 GAAACTAAGAGCTCTGGATGGGG - Intergenic
1032841598 7:135718418-135718440 GCAATCAAGAGCTGTGAATGAGG + Intronic
1038035073 8:23680670-23680692 GCAAATATGTGCTGAGCATGAGG + Exonic
1038414690 8:27385737-27385759 ACAAAAAATAGCTGGGTATGGGG + Intronic
1039789867 8:40866756-40866778 GAAATTCAGTGCTGTGTATGTGG + Intronic
1039985710 8:42445913-42445935 TCAAAGAAGTTCTGTGTATGTGG - Intronic
1041168623 8:55117138-55117160 GAAAATTAGAATTGTGTATGTGG + Intronic
1041421051 8:57667333-57667355 ACAAATAAGATCTATGTATCTGG + Intergenic
1042009333 8:64222589-64222611 GAAAATAAGTGCTGTGAATTTGG + Intergenic
1045648277 8:104320277-104320299 GTAAAAAAGAGCTGAGTCTGAGG + Intergenic
1047836915 8:128703834-128703856 ACAAGTCAGAGCTGTGCATGAGG - Intergenic
1052695536 9:31872682-31872704 GCAAATCAGATCTCTGGATGTGG - Intergenic
1054904444 9:70402413-70402435 GCAAAGACGAGCTGTTTATATGG - Intronic
1057060356 9:91998643-91998665 GCAAATAATTGCTTTGTGTGAGG - Intergenic
1058055905 9:100448575-100448597 GCATGTAAGAAATGTGTATGGGG - Intronic
1059645906 9:116267353-116267375 GCAAATAACTGATGTCTATGTGG - Intronic
1203664066 Un_KI270754v1:9574-9596 GAAAATAAGAGCTATCTTTGAGG - Intergenic
1186811059 X:13188891-13188913 GCATATAAGAACACTGTATGGGG - Intergenic
1189074719 X:37904237-37904259 ACAAAAAAGAGGTGTGTGTGGGG + Intronic
1192435716 X:71142425-71142447 GCAAAGAAGCTCTGTGTATTGGG - Exonic
1194148886 X:90298890-90298912 TCAAATAAAAGCTGTTTATCAGG + Intergenic
1195652875 X:107304127-107304149 GCAAAAAAGAGCAGGGTAGGTGG + Intergenic
1196373589 X:115005556-115005578 GGAAATAAGAATTGTGTTTGGGG - Intronic
1198028794 X:132735212-132735234 CCAAATGACAGCTGTGTTTGAGG - Intronic
1199681769 X:150229696-150229718 GCTGATAAGAGGTGTGTAAGGGG + Intergenic
1200136609 X:153878299-153878321 CCCAAGAAGAGCTGTGAATGCGG + Intronic
1200495254 Y:3875624-3875646 TCAAATAAAAGCTGTTTATCAGG + Intergenic