ID: 960177946

View in Genome Browser
Species Human (GRCh38)
Location 3:114539463-114539485
Sequence ACCTTAGGACATAAGCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960177944_960177946 6 Left 960177944 3:114539434-114539456 CCACATACACAGCTCTTATTTGC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960177946 Original CRISPR ACCTTAGGACATAAGCAATG TGG Intronic
900079815 1:847516-847538 ACCCTAGGACATGAGCAACCTGG + Intergenic
911096113 1:94056486-94056508 ACCTTAGGTCAAAGGCAAAGTGG + Intronic
918952863 1:191162135-191162157 ACATTAGGACTTAAGCTATTTGG - Intergenic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
919474291 1:198015824-198015846 CCTTTTGGAAATAAGCAATGTGG - Intergenic
924919015 1:248606485-248606507 AGCTTAAAACATAAGCAATGGGG - Intergenic
1064090067 10:12375660-12375682 ACCCTAGGACACAGGCAATCGGG - Intronic
1064816574 10:19271899-19271921 ACCTTGAGAGATGAGCAATGAGG + Intronic
1069314744 10:67083198-67083220 ACTTGAGGACATTAGCAATGTGG - Intronic
1071596440 10:86930716-86930738 AAATTAGGATATAAGCACTGAGG - Exonic
1075661023 10:124196575-124196597 ACATTATGCCATAAACAATGGGG + Intergenic
1077979022 11:7279961-7279983 ACCTTAGGTGAAGAGCAATGAGG + Intronic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1086418434 11:86613172-86613194 ACCTGAAAAAATAAGCAATGGGG - Intronic
1087364943 11:97206790-97206812 TCTTGAGGACATAAGAAATGGGG - Intergenic
1087944412 11:104140761-104140783 AGGTTAGGACATTAGCAATAGGG - Intronic
1095797749 12:46238802-46238824 AACTGAGGAGAGAAGCAATGGGG - Intronic
1099075140 12:78097136-78097158 AGGTTAGGTCATCAGCAATGAGG + Intronic
1101765193 12:107691525-107691547 AAATTAGGCCAGAAGCAATGAGG + Intronic
1107610253 13:42105975-42105997 ACCTTGGAACTTAAGGAATGTGG + Intronic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1113408950 13:110066739-110066761 ACCTTAAGACATGAACAAAGTGG + Intergenic
1113419291 13:110157721-110157743 ACCTTAGAGTCTAAGCAATGGGG - Intronic
1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG + Exonic
1116170956 14:41401495-41401517 ACCATAGCAGATAAGGAATGTGG - Intergenic
1117190387 14:53284674-53284696 ACATAAGGACAAAAGTAATGAGG + Intergenic
1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG + Intergenic
1125369641 15:38959151-38959173 ACATTAGGAAATAAGCATTTTGG - Intergenic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1135284259 16:21179859-21179881 ACCGTTGGACATAAGCCCTGAGG - Exonic
1137498540 16:48992554-48992576 TCCTTAGGATATGAGCAAAGAGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1148955485 17:51350480-51350502 ACCACAGGACAAAAGCAATATGG - Intergenic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1160178685 18:76616206-76616228 CCCTTTGGAAATTAGCAATGAGG - Intergenic
1165385382 19:35507496-35507518 TCCCTAGGAAATAAGCAAAGAGG - Intronic
1165664331 19:37614186-37614208 ATTTTAGAACTTAAGCAATGAGG - Intronic
928479371 2:31666507-31666529 ATCAAAGGACATAAGCTATGGGG + Intergenic
928843764 2:35644041-35644063 AGCCTTGGACAGAAGCAATGTGG + Intergenic
930433684 2:51313970-51313992 ACCTCAGAAAACAAGCAATGGGG - Intergenic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
933399051 2:81767948-81767970 ACTTTAGGACATAAGCCTTGTGG - Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
942193761 2:173497018-173497040 AACTTAGGACAGAAGGAATCTGG - Intergenic
943453186 2:188071811-188071833 ACCTTAGGACAGAGACTATGGGG + Intergenic
944950048 2:204738288-204738310 ACCTAAGAACATATGTAATGCGG - Intronic
946718565 2:222579369-222579391 ACCTTAGGACATACCCAAGTAGG + Intronic
947766013 2:232637937-232637959 TCCTTAGGACCTAACAAATGAGG + Intronic
1174287898 20:49484812-49484834 ACATCAGTACATATGCAATGTGG + Intergenic
1175168057 20:57060265-57060287 ATCTCAGGACAGAGGCAATGGGG + Intergenic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1182467229 22:30525098-30525120 ACCTCAGGACATCTGCAGTGAGG + Exonic
950236364 3:11324667-11324689 CCCTAAGGACAAAGGCAATGGGG - Intronic
953666694 3:44930703-44930725 ACCTGAGGAGATATGCATTGTGG - Intronic
955506277 3:59636275-59636297 AACAGAGGCCATAAGCAATGGGG + Intergenic
957177591 3:76831387-76831409 GCCTTAGCACATAAACAATATGG + Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
963749786 3:149164710-149164732 CCCTCAGGTCAGAAGCAATGAGG - Intronic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
966688917 3:182724296-182724318 ACCAGAGGACCTAATCAATGGGG + Intergenic
966910754 3:184558577-184558599 GCCTTGGGCAATAAGCAATGAGG - Intronic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
973733623 4:53848232-53848254 ACCCTTGGAAAAAAGCAATGAGG - Intronic
973826602 4:54713319-54713341 ACCTCACGAGCTAAGCAATGAGG - Intronic
976870405 4:89786260-89786282 ACCATAGGCAATAAACAATGGGG - Intronic
979113999 4:116797675-116797697 ACATTCTGACATAAGGAATGAGG - Intergenic
982546887 4:156745030-156745052 ACATTAGGACATTATCAAGGAGG - Intergenic
982907843 4:161099745-161099767 ACCTTTGGTCATAAGAAAAGTGG - Intergenic
984978867 4:185258082-185258104 ACCTTAGGACAGAAAAAATTTGG + Intronic
986247620 5:6025117-6025139 ACCTCAGGAGAGAGGCAATGCGG + Intergenic
986611775 5:9575589-9575611 ACTTTAGTACATAAGCACTGTGG - Intergenic
987608573 5:20171987-20172009 AGCTTACAAAATAAGCAATGAGG - Intronic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
991301228 5:65131291-65131313 CCCTTATCTCATAAGCAATGGGG - Intergenic
992611113 5:78509525-78509547 CCCCGAGGAAATAAGCAATGAGG + Intronic
996183811 5:120452035-120452057 ACTTTAGTACATAACCAATAAGG + Intergenic
998041969 5:138956300-138956322 ACATTAAGGCATAAGCAAGGTGG - Intronic
1008015896 6:46519363-46519385 ATCTAAGGACATAAGAAGTGGGG + Intergenic
1008254993 6:49287276-49287298 ACTTTAGGATAAAACCAATGTGG - Intergenic
1009596735 6:65745824-65745846 CCCTTAGGAGACAAGCAAAGTGG + Intergenic
1010805861 6:80235629-80235651 GCCTTTGGACATAATTAATGTGG - Intronic
1022233621 7:28439683-28439705 ATCTTAGGAGATAGGCAGTGTGG - Intronic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1033873068 7:145781181-145781203 ACCTGAGAAAATAAGCAACGGGG - Intergenic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1035525689 8:311400-311422 ACCCTAGGACATGAGCAACCTGG - Intergenic
1038854001 8:31311202-31311224 ACTGTAGGAAAAAAGCAATGAGG + Intergenic
1040455690 8:47595044-47595066 ACCTCAGGACTTCAGGAATGAGG - Intronic
1041901385 8:62987041-62987063 AACTTAGGTCTTAAACAATGTGG - Intronic
1043038123 8:75224496-75224518 ACCTGAAGAAATAAGCAGTGGGG + Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1047757397 8:127929087-127929109 ACTTTGGGACAGAAGCAAGGGGG + Intergenic
1050029602 9:1371695-1371717 ACCTTGGGACATCAGCTCTGTGG + Intergenic
1050778377 9:9297814-9297836 AGCTTAGGACATTGGCAGTGGGG + Intronic
1051156781 9:14156785-14156807 ACCCTAGGACAGAAGCAAGTAGG - Intronic
1051274211 9:15383471-15383493 ACTTGAGGAAATAAGCAAGGAGG + Intergenic
1056339223 9:85608431-85608453 ACCAAATGACATAATCAATGTGG + Intronic
1059049993 9:110914019-110914041 ACCAAAGGAAAAAAGCAATGAGG - Intronic
1059066931 9:111095288-111095310 ACTTTAGGAGAAGAGCAATGGGG + Intergenic
1186598506 X:11010220-11010242 ACTTTACTCCATAAGCAATGGGG - Intergenic
1189030382 X:37443285-37443307 ACCTCAGGACATTTGCAGTGGGG + Intronic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1192112737 X:68381877-68381899 ACACTGGGACAGAAGCAATGTGG - Intronic
1192714112 X:73620964-73620986 ACCTGAAAAAATAAGCAATGGGG - Intronic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1202021387 Y:20468260-20468282 ACCACAGGACCTAATCAATGGGG + Intergenic