ID: 960181457

View in Genome Browser
Species Human (GRCh38)
Location 3:114585211-114585233
Sequence GAACTGGTGATGTCCTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960181454_960181457 3 Left 960181454 3:114585185-114585207 CCCTGCTGGCAGCTGAGGTTGGA 0: 1
1: 0
2: 4
3: 47
4: 322
Right 960181457 3:114585211-114585233 GAACTGGTGATGTCCTAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 75
960181455_960181457 2 Left 960181455 3:114585186-114585208 CCTGCTGGCAGCTGAGGTTGGAA 0: 1
1: 0
2: 1
3: 28
4: 223
Right 960181457 3:114585211-114585233 GAACTGGTGATGTCCTAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960181457 Original CRISPR GAACTGGTGATGTCCTAGAG AGG Intronic
900269895 1:1781667-1781689 GAAGTGGTGAGAGCCTAGAGTGG + Intergenic
902246851 1:15126481-15126503 GAACCGGAGTTGTCCTGGAGAGG - Intergenic
905601352 1:39254561-39254583 GAACTTGTGACCTCCTTGAGAGG + Intronic
906875602 1:49534951-49534973 GGAGGGGTGATGTCCTAAAGAGG - Intronic
912956814 1:114159845-114159867 TCACTGGTGAGGTCCCAGAGAGG + Intergenic
913389794 1:118297904-118297926 GAGCAGGAGATGTCCCAGAGAGG - Intergenic
916835738 1:168543121-168543143 GAACAGGTGATTTCCTAGTGGGG - Intronic
916838872 1:168579027-168579049 GAACAGGTGATTTCCTAGTGGGG + Intronic
920830980 1:209465476-209465498 GAACTGGAGATGGGCCAGAGAGG - Intergenic
921720027 1:218460748-218460770 GAACTCCTGGAGTCCTAGAGAGG - Intergenic
1063810260 10:9696786-9696808 GAACTGGTAGCATCCTAGAGTGG - Intergenic
1064191168 10:13207290-13207312 AAACTGGTGATGTGCTGGATTGG + Intronic
1073022820 10:100460721-100460743 TAACTGCTGTTATCCTAGAGGGG + Intergenic
1077385481 11:2267657-2267679 CAGCTGGTGTTGTCCCAGAGTGG - Intergenic
1081748862 11:45493432-45493454 GAACTGATGATGTATTAGACAGG + Intergenic
1083728100 11:64638700-64638722 TCACTGGTGGTTTCCTAGAGAGG - Intronic
1086741786 11:90378548-90378570 GACCTTGTGATGACCTTGAGTGG - Intergenic
1088376839 11:109150651-109150673 CAACTGGAGATGTTCTATAGTGG - Intergenic
1091561380 12:1616598-1616620 GAACTGGTGCTGTGCCTGAGTGG + Intronic
1097458994 12:59836661-59836683 GGACAGGTGATCTCCTATAGTGG - Intergenic
1100085728 12:90907968-90907990 GAACTGGTTATGTCCTAGCTGGG - Intronic
1103152500 12:118652986-118653008 GAACTGGTCATTTCCAAGTGGGG + Intergenic
1103567930 12:121826466-121826488 GCACTGCTGCTGTCCTAGGGAGG - Intronic
1104186559 12:126438230-126438252 GATCTGGTGAGTTACTAGAGCGG - Intergenic
1107705143 13:43095350-43095372 GAAATGGGGATGATCTAGAGTGG + Intronic
1107810276 13:44193799-44193821 GACCTGGTCATGTCCTGGGGTGG + Intergenic
1107981124 13:45735233-45735255 GCCCTGTTTATGTCCTAGAGAGG - Intergenic
1112213674 13:97407374-97407396 GAGTTGGTGATGTTCTAGCGGGG - Intergenic
1112379451 13:98874837-98874859 GAACTGGTAGAGACCTAGAGAGG - Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1112631969 13:101171715-101171737 ACACTGGTGATGTCTTGGAGAGG + Intronic
1120729799 14:87989991-87990013 GAATTGGAGTTGTCCAAGAGAGG - Intronic
1125582310 15:40795086-40795108 CAGCTGATGATTTCCTAGAGAGG - Intronic
1128782914 15:70374774-70374796 GAACTGCTTTTGTCCTCGAGTGG + Intergenic
1138267844 16:55672591-55672613 GAACTGATGATGTCAGAGAAGGG + Intronic
1139486003 16:67256973-67256995 CAAGTGGTGATGTCCTATGGGGG + Exonic
1148381288 17:47200175-47200197 TCACTGGTGGTGTGCTAGAGAGG + Intergenic
1159229818 18:65591851-65591873 GAACTGGTTCTGCCCTGGAGAGG + Intergenic
1161672129 19:5619219-5619241 GAGCTGGTGATGTTCTCTAGAGG - Intronic
1166323526 19:42034832-42034854 CAACTGCTGATGTTCTAGTGGGG - Intronic
1167123415 19:47532604-47532626 GAATTGGTGATGGCACAGAGTGG - Intronic
1168072532 19:53960949-53960971 GTACAGGTGAAGTCGTAGAGGGG + Intergenic
928637087 2:33257973-33257995 GATCTGGTGATCACCTAGTGTGG + Intronic
934516091 2:94987665-94987687 GAGGTGGTGCTGTCCTGGAGGGG - Intergenic
937120230 2:119435866-119435888 GAAGAGGTGTTGTCCTGGAGGGG + Intronic
942832196 2:180250557-180250579 AAGCTGGAGATGTCCTAGAAAGG - Intergenic
949077690 2:242071547-242071569 GCACTGGTGATGTCACTGAGAGG - Intergenic
1169914019 20:10670177-10670199 CAACTGTTCATGTTCTAGAGAGG - Intronic
1170425616 20:16232483-16232505 GAACTGGTGGTGAACTAAAGAGG + Intergenic
1181532257 22:23523286-23523308 GAGCTGATAATGTCCAAGAGTGG - Intergenic
951892662 3:27581595-27581617 GAACTGTTGCTGTCAAAGAGAGG - Intergenic
952805145 3:37342869-37342891 GCACTGATGAGGTGCTAGAGTGG - Intronic
956021703 3:64940171-64940193 GAACTTGTGAGGTCCTGCAGAGG + Intergenic
958466295 3:94463543-94463565 CAATTGATGATGTCCTATAGGGG - Intergenic
960181457 3:114585211-114585233 GAACTGGTGATGTCCTAGAGAGG + Intronic
968200918 3:196754560-196754582 GAACTGATGATGTATGAGAGTGG + Intronic
976348531 4:84033174-84033196 GAACTGTTGTGCTCCTAGAGTGG + Intergenic
977803380 4:101265842-101265864 GACCTGGTCATGTAATAGAGGGG + Intronic
1000422214 5:161051306-161051328 GAACTGGTGATGTTCTAGTCCGG + Intergenic
1000656911 5:163890294-163890316 GAATTGTTGAAGTGCTAGAGAGG - Intergenic
1001943354 5:175756650-175756672 GAACTGAAGATTTTCTAGAGTGG - Intergenic
1002191303 5:177479182-177479204 GAGCTGGAGCTGGCCTAGAGTGG - Intergenic
1002569314 5:180130997-180131019 GGGGTGGTGATGGCCTAGAGGGG - Intronic
1005146535 6:22697475-22697497 GTAATGGTGAAGCCCTAGAGAGG + Intergenic
1005774553 6:29116516-29116538 GAGCTGGTGTGGTGCTAGAGTGG + Intergenic
1007830697 6:44636261-44636283 GAACTGGAGATGTTCAAGGGTGG - Intergenic
1009497021 6:64362825-64362847 AAACTGATGAAGTCTTAGAGTGG - Intronic
1010184285 6:73125087-73125109 GATCTGGAGATGTCACAGAGAGG - Intronic
1018285133 6:162229595-162229617 GAACTGGTGATCTGGGAGAGGGG - Intronic
1023137599 7:37068321-37068343 GTACAGGTGGTTTCCTAGAGCGG - Intronic
1023884717 7:44345587-44345609 GAACTGGTCATCACCTGGAGGGG + Intergenic
1029789051 7:102823237-102823259 AAATTGGTGATGCCTTAGAGAGG - Intronic
1041313070 8:56536133-56536155 AAACAGGTGTTGTCCCAGAGAGG + Intergenic
1042875699 8:73438414-73438436 GAAATGGAGGTGTCCCAGAGAGG + Intronic
1045495979 8:102709294-102709316 TATTTGGTGATGTCCTAAAGTGG + Intergenic
1045866681 8:106874178-106874200 AACTTGGTGGTGTCCTAGAGAGG - Intergenic
1049468317 8:142763865-142763887 GAACTGGGGGTTTCCTAGAGAGG + Intergenic
1051101453 9:13527012-13527034 GAAATAGTGATTTCCTAGAGAGG - Intergenic
1055551227 9:77433860-77433882 GATCTGGTGCTGTCCTCTAGTGG - Intronic
1058381438 9:104381405-104381427 TAACTGATGTTGTCCTAAAGTGG + Intergenic
1061248280 9:129412819-129412841 GAGCTGATAATGTCCAAGAGTGG + Intergenic
1187927232 X:24261424-24261446 AAACTGGTGATGTGGTAGAGAGG - Intergenic
1198475240 X:136990486-136990508 AAACTGGTAATATCGTAGAGTGG + Intergenic