ID: 960181743

View in Genome Browser
Species Human (GRCh38)
Location 3:114588135-114588157
Sequence ATTCTGTTTTAGGTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 429}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960181737_960181743 0 Left 960181737 3:114588112-114588134 CCTTCTTTTGTCACTTGTCTGCT 0: 1
1: 0
2: 5
3: 40
4: 388
Right 960181743 3:114588135-114588157 ATTCTGTTTTAGGTGGGGGAAGG 0: 1
1: 0
2: 1
3: 57
4: 429
960181734_960181743 20 Left 960181734 3:114588092-114588114 CCCATATTACTTCCAGGGGGCCT 0: 1
1: 0
2: 0
3: 11
4: 67
Right 960181743 3:114588135-114588157 ATTCTGTTTTAGGTGGGGGAAGG 0: 1
1: 0
2: 1
3: 57
4: 429
960181735_960181743 19 Left 960181735 3:114588093-114588115 CCATATTACTTCCAGGGGGCCTT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 960181743 3:114588135-114588157 ATTCTGTTTTAGGTGGGGGAAGG 0: 1
1: 0
2: 1
3: 57
4: 429
960181736_960181743 8 Left 960181736 3:114588104-114588126 CCAGGGGGCCTTCTTTTGTCACT 0: 1
1: 0
2: 0
3: 14
4: 152
Right 960181743 3:114588135-114588157 ATTCTGTTTTAGGTGGGGGAAGG 0: 1
1: 0
2: 1
3: 57
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960181743 Original CRISPR ATTCTGTTTTAGGTGGGGGA AGG Intronic
900857451 1:5197401-5197423 AGTGTGTATTTGGTGGGGGAGGG + Intergenic
901028095 1:6289880-6289902 ATTCTGTCTTAGCAGGTGGAAGG - Intronic
901688824 1:10959597-10959619 ATTCTGTATTGGGTAGGAGAGGG - Intronic
901978568 1:13015054-13015076 ATTCTTTTTTAGGTTGGGCAGGG + Intronic
902003514 1:13213884-13213906 ATTCTTTTTTAGGTTGGGCAGGG - Intergenic
902022742 1:13359623-13359645 ATTCTTTTTTAGGTTGGGCAGGG - Intergenic
902042317 1:13501930-13501952 TTTTTTTTTTTGGTGGGGGATGG + Intronic
902775553 1:18672325-18672347 ATTCTGTAAGAGATGGGGGAAGG - Intronic
902845341 1:19106001-19106023 CTACTGTTTTAGATGGGGAAAGG + Intronic
903384744 1:22918995-22919017 ATTCTGATACAGGTGGGCGATGG - Intergenic
903757668 1:25674017-25674039 ATTGGGTGTTAGGTGGGGGCAGG - Intronic
903790052 1:25886591-25886613 TTTTTTTTTTTGGTGGGGGATGG + Intronic
905220908 1:36446636-36446658 GTTCTGTTTTGAGTGGGGGCAGG + Intronic
905796402 1:40818854-40818876 ATTCTGAATTAGGTAGGGGCGGG + Intronic
906932106 1:50180128-50180150 ATTTTTTTTTTGGTGGGGGTGGG - Intronic
907049759 1:51322050-51322072 GATCTGTTGGAGGTGGGGGAGGG + Intronic
907294465 1:53440706-53440728 ATTCTGTTATAGGCTGGGCACGG - Intergenic
907348298 1:53803062-53803084 ATTCTTTTTTGGGGTGGGGAGGG + Intronic
907444359 1:54498584-54498606 CTGCTGGTCTAGGTGGGGGAGGG - Intergenic
907916503 1:58874781-58874803 CTTCAGTTTTAGGGGAGGGAAGG + Intergenic
908257658 1:62316215-62316237 CATCTGTTTTAGCTGGAGGAGGG - Intronic
908372603 1:63498228-63498250 ATTCTGCTGTTGTTGGGGGAGGG - Intronic
908615971 1:65923006-65923028 ATTCAGATTTTTGTGGGGGAGGG - Intronic
909005203 1:70267911-70267933 ATTATATTTTAAATGGGGGAAGG - Intronic
909717734 1:78729476-78729498 ATTCTGATTTAGCAGGGGGTTGG + Intergenic
909721523 1:78776424-78776446 GCCATGTTTTAGGTGGGGGATGG - Intergenic
909761823 1:79298005-79298027 TTTCTGTTTTAGCTGGGGTTGGG + Intergenic
912622204 1:111173153-111173175 ATTCTGTCTTGGGTGGAGGAGGG - Intronic
912630346 1:111241463-111241485 ATACTCCTTTAGGTGGGGAATGG + Intronic
913696250 1:121328716-121328738 AATTTTTTTTAAGTGGGGGAGGG - Intronic
914141314 1:144951342-144951364 AATTTTTTTTAAGTGGGGGAGGG + Intronic
915376354 1:155399647-155399669 ATTCTGTTTTTTTTGGGGGGTGG - Intronic
916095025 1:161341716-161341738 TTTCTGTTTTTGGTGGGGGTAGG - Intronic
916140069 1:161689122-161689144 ATGCTGTTTTGGGTGGTGGTGGG + Intergenic
917050304 1:170915094-170915116 ATTATGTTTTATGTGGGAGAGGG - Intergenic
918646632 1:186913890-186913912 AATATGTTTTAGGTGGGGGTAGG + Intronic
919052127 1:192524491-192524513 ATTCTGTTTTAGTTGGCAGTTGG - Intergenic
919305076 1:195822064-195822086 ATGCTTTTTTAGGTCGGGCACGG + Intergenic
920038712 1:203082521-203082543 ATTCAGATTTAGCTCGGGGAGGG - Intergenic
920411473 1:205764820-205764842 ATTCTCTTTTACTTGGGGGAAGG - Intergenic
920483573 1:206347081-206347103 AATTTTTTTTAAGTGGGGGAGGG - Intronic
920529894 1:206694221-206694243 ATTATGGTTTATTTGGGGGAAGG + Intronic
921220935 1:212973548-212973570 ATTCTGTCATATGTGTGGGATGG + Intronic
921425674 1:214998388-214998410 TTTTTGTTTTTTGTGGGGGATGG + Intergenic
921745847 1:218739937-218739959 GTCCTTTTTTTGGTGGGGGAGGG - Intergenic
923083118 1:230679079-230679101 ATTCTGTTTTAGAAGGGTGCGGG - Intronic
923563360 1:235058555-235058577 ATTTTTTTTTTGGGGGGGGATGG + Intergenic
923798972 1:237188114-237188136 ATGCTGTTTTAGGTGAAGGAAGG + Intronic
923900829 1:238324474-238324496 ATTCTTTTTTAGGTGGGTTTGGG + Intergenic
924227018 1:241930345-241930367 ATTCAGTGTTAGCTGGGGTATGG + Intergenic
924310106 1:242731998-242732020 TTTCTGTTTTAGGTGGGGCCAGG - Intergenic
924488264 1:244508974-244508996 TTTTTTTTTTTGGTGGGGGAAGG - Intronic
924882253 1:248173158-248173180 ATTTTATTTTAAGTTGGGGATGG + Intergenic
1063303054 10:4870221-4870243 ATTCTATTATAAATGGGGGAGGG - Intergenic
1063400936 10:5744917-5744939 TTTCTGTCTTAGGTAGGGCACGG - Intronic
1064039268 10:11944487-11944509 TTTTTCTTTTTGGTGGGGGATGG - Intronic
1064066441 10:12186180-12186202 ACTCAGATTTATGTGGGGGAGGG + Intronic
1064283222 10:13969845-13969867 TTTCTTTTTTTGGTGGGGGAGGG - Intronic
1064388447 10:14920653-14920675 ATTCTGTTGTAGGTAGGTGGGGG - Intronic
1064447972 10:15413231-15413253 TTTTTTTTTTTGGTGGGGGATGG - Intergenic
1064637607 10:17385556-17385578 ATTCTCTTGCAGGTGGGGGCAGG + Intronic
1064677421 10:17775279-17775301 TTTCTGTTTTTTGTGGGGCAGGG + Intronic
1064863535 10:19853639-19853661 ATGCTGCTTTGGGTGGGGGGGGG + Intronic
1065162479 10:22937454-22937476 AATCTGTTTTAGATGTGGGTTGG + Intronic
1065774671 10:29108444-29108466 ATTAAGTTATAGATGGGGGAAGG + Intergenic
1067983080 10:51109549-51109571 TTTCTGTATTAGGTGAGGTAAGG - Intronic
1069248623 10:66241885-66241907 ATTTTGTTTTAGGAGTGGAATGG - Intronic
1069765181 10:70851459-70851481 ATTCTGTGTTTGGTGGGTGGGGG - Intronic
1071539179 10:86465015-86465037 ATTCTGGTTATGGTGGAGGATGG - Intronic
1071694416 10:87856964-87856986 ATACTGTTGTAGCTGGAGGATGG + Intergenic
1071868857 10:89769303-89769325 TTTCTGTTTTTGGTTGGGGCAGG + Intronic
1072727203 10:97822010-97822032 ATTCTTGTTTGGGAGGGGGAAGG + Intergenic
1072836044 10:98713468-98713490 ACTCTGGTTTCGGTGGGTGATGG - Intronic
1072941256 10:99766179-99766201 ATTCTGTTTTAGCTGCAGGATGG - Intergenic
1073738238 10:106375327-106375349 GGTATTTTTTAGGTGGGGGAAGG + Intergenic
1074867901 10:117555584-117555606 CTTCTGTTTTAGGGGAGGGGAGG - Intergenic
1075048266 10:119163395-119163417 TTTCTTTTTTTGCTGGGGGAAGG + Intronic
1075919116 10:126195568-126195590 CTTGTTTTTTGGGTGGGGGATGG - Intronic
1075986541 10:126790941-126790963 ATTCTGCTTTATGTGTGGTAAGG - Intergenic
1076271627 10:129157427-129157449 ATTCTCTCTTACTTGGGGGAGGG - Intergenic
1076609968 10:131718506-131718528 ACTCTGTTTTTTGTGGGGGCGGG + Intergenic
1078878966 11:15428834-15428856 ATTGTCTTTTACTTGGGGGAGGG - Intergenic
1078988374 11:16617201-16617223 ATTATGTTTAAAATGGGGGAAGG + Intronic
1079945998 11:26741382-26741404 TTTTTTTTTTAGGTGGGGGCGGG - Intergenic
1080381190 11:31773887-31773909 CTTCAGTCTTAGGTGGGGCATGG + Intronic
1080419329 11:32095999-32096021 ACTTTTTTTTAGGTGGGGGAGGG - Intronic
1080656571 11:34263166-34263188 ATGCTGCTTTTGGTGGGGGTTGG + Intronic
1080838172 11:35959925-35959947 TTTCTTTTTTTGGCGGGGGATGG - Intronic
1081175720 11:39924200-39924222 CTTTTTTTTTGGGTGGGGGAGGG - Intergenic
1081844725 11:46231795-46231817 ATTTTTTTTTGGGAGGGGGATGG - Intergenic
1081942533 11:46955991-46956013 TTTCTTTTTTTGGTGGGGGGGGG - Intronic
1082100835 11:48171699-48171721 ATTCTGTTTTAGTGGGGGTTAGG + Intergenic
1083167972 11:60903150-60903172 ATTCTCTTTTAGAGAGGGGACGG - Intronic
1083560373 11:63669001-63669023 ATTTTTTTTTGGGTGGGGGGGGG + Intronic
1083701618 11:64482943-64482965 CTTTGGTTTTGGGTGGGGGATGG + Intergenic
1086195448 11:84133472-84133494 ATTCTGTTTTAGGTTAGAGTTGG + Intronic
1086427481 11:86700425-86700447 ATGCTTTCTTGGGTGGGGGATGG - Intergenic
1088207843 11:107414761-107414783 ATGGTGGTTTAGGTGGGGGGTGG - Intronic
1088936825 11:114410372-114410394 ATTTTATTTTAGATGGGGAAAGG - Intronic
1089354496 11:117840912-117840934 CTTCTGATCTATGTGGGGGACGG - Intronic
1090921097 11:131206389-131206411 ATTCTGATTGATGTGGGGGCTGG - Intergenic
1091055708 11:132416966-132416988 ACTCTGTTTTGGGAAGGGGAAGG + Exonic
1091095498 11:132817755-132817777 ATTTTTTTTTTGGCGGGGGAGGG - Intronic
1091158702 11:133399131-133399153 ATTCTTTCTTTGCTGGGGGAGGG - Intronic
1091339467 11:134799184-134799206 ATTCTGTTTCAGGAGGCGGAGGG + Intergenic
1091482833 12:851955-851977 ATTCTGTGTGAGGAGGGGGTAGG + Intronic
1092478329 12:8837879-8837901 TTTTTTTTTTCGGTGGGGGAGGG - Intronic
1092611152 12:10174515-10174537 ATTCTTTCTTATTTGGGGGAAGG - Intronic
1093559901 12:20525454-20525476 ATTCTGATTTGGTTGGGGGGGGG + Intronic
1094167080 12:27453981-27454003 AATCTCTTTTTTGTGGGGGAGGG + Intergenic
1094587024 12:31786954-31786976 ATTCTGTTTAAGGCCGGGCATGG - Intergenic
1094607075 12:31958221-31958243 TTTCTTTTTTGGGGGGGGGACGG - Intergenic
1094735058 12:33224816-33224838 ATTGTGGTTTCTGTGGGGGAGGG - Intergenic
1095468523 12:42512660-42512682 ATTTTGTTTTTTGTGGGGGATGG + Intronic
1095933695 12:47654552-47654574 GATCTGGTTTAGGTGGAGGAGGG - Intergenic
1096643337 12:53012608-53012630 TTTCTTTTTTTTGTGGGGGACGG + Intronic
1097506266 12:60475842-60475864 CTTCTGTTTTTTGTCGGGGAGGG - Intergenic
1098106617 12:67074315-67074337 ATTCTCTTTTACCTGGAGGAGGG - Intergenic
1098865441 12:75757670-75757692 ATCATGTTTTGGGTGAGGGAGGG + Intergenic
1099538975 12:83881654-83881676 TTTTTTTTTTTGGTGGGGGAGGG + Intergenic
1099651751 12:85437417-85437439 ATTCTTTTTTTGGGGGGGTAGGG + Intergenic
1100244492 12:92743544-92743566 ACTCTATTTTTGGTGGGGGAGGG + Intronic
1100342096 12:93688994-93689016 ATACTTTTTTGGTTGGGGGAAGG + Intronic
1100564839 12:95785672-95785694 ATTCTGCTTTTGGTGTGGTATGG - Intronic
1100837265 12:98578157-98578179 TTTCTTTTTTTTGTGGGGGAGGG - Intergenic
1101011218 12:100451466-100451488 ATTCTGTCATATGTTGGGGAGGG - Intergenic
1101490012 12:105201577-105201599 AGTCTGTGTGGGGTGGGGGAGGG - Intronic
1101675636 12:106914066-106914088 ATTCTGATTTAAATGGGGGGTGG + Intergenic
1101866404 12:108523624-108523646 TTGCTCTTTTAGGAGGGGGAAGG - Exonic
1102043302 12:109814663-109814685 AATCTGTTTGAGGGGGAGGATGG - Exonic
1102855960 12:116293765-116293787 ATTCTGGCTTAGGTGAGGCAAGG + Intergenic
1103522320 12:121544603-121544625 TTTCTTTTTTTGGGGGGGGACGG - Intronic
1104458737 12:128936504-128936526 ATTCTGTTTTAGCTGCAGGATGG + Intronic
1105340611 13:19521060-19521082 ACTCTGTTGTTGCTGGGGGATGG + Intronic
1107756354 13:43627535-43627557 ACTATATTTTAAGTGGGGGAAGG - Intronic
1110731484 13:78883411-78883433 AGCCTGTTTTAACTGGGGGAGGG + Intergenic
1110750522 13:79109710-79109732 ATGCTGCTTTTGGTGGGGGGTGG + Intergenic
1111760520 13:92458293-92458315 ATTCTTTTTTTGGGGGGGGCAGG + Intronic
1113066646 13:106379455-106379477 ATTCTTTTTTTTGGGGGGGATGG - Intergenic
1113109031 13:106802287-106802309 ATTCAGTTTAAGTGGGGGGACGG + Intergenic
1114208242 14:20593506-20593528 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1114347739 14:21814481-21814503 AGACTGTTGTGGGTGGGGGAAGG + Intergenic
1115267207 14:31512770-31512792 ATTCTCTTTTACTTGGAGGAGGG - Intronic
1116331813 14:43606016-43606038 ATTCATTTTTTGGTGGGAGAGGG + Intergenic
1119656066 14:76417958-76417980 TTTTTTTTTTTGGTGGGGGATGG + Intronic
1120880253 14:89410105-89410127 TTTCTGTTTGAGATGGGGGGTGG - Intronic
1121379128 14:93446398-93446420 TTTTTTTTTTTGGTGGGGGATGG + Intronic
1121502407 14:94448626-94448648 ATTCTGTGGTAGGCGGGGGCTGG + Exonic
1121941317 14:98073642-98073664 ATTATGTTTTAGGGGAAGGAGGG - Intergenic
1122076099 14:99235685-99235707 TTTCTTTTTTTGGTGGGGGAAGG + Intronic
1122088949 14:99325497-99325519 ATTCTCTCTTACCTGGGGGAGGG + Intergenic
1202888376 14_KI270722v1_random:130952-130974 ATACTGTTTATGGTGGGAGAAGG - Intergenic
1124818900 15:33023047-33023069 TTTTTTTTTTGGGTGGGGGAGGG - Intronic
1125688626 15:41578761-41578783 ATTCCCTTTTAGGTGAGGGTTGG + Exonic
1125957856 15:43803032-43803054 ATTCTTTTTTTGGTGGTGGGGGG - Intronic
1126083173 15:44985507-44985529 ATTCTGTTTTTGGCTGGGCACGG - Intergenic
1127228889 15:56967134-56967156 ATTTTTTTTTTGGTGGGGGAGGG - Intronic
1127372001 15:58350216-58350238 ATTTTGCTTTTGGTGGGGGTTGG - Intronic
1127613494 15:60659809-60659831 ATATTGTTTTAGCAGGGGGATGG - Intronic
1127820341 15:62649290-62649312 ATTTTTTTTTTGGTGGGGGTGGG + Intronic
1128047855 15:64634883-64634905 CTGTTGTTTTTGGTGGGGGAGGG - Intronic
1128595885 15:68948676-68948698 AGACTGTTTTGGGTGGGGGGGGG + Intronic
1128620467 15:69144943-69144965 GTTTTGTTTTGGTTGGGGGAGGG - Intergenic
1130027802 15:80284957-80284979 AATCTGTTTTATTGGGGGGAGGG + Intergenic
1130287901 15:82570972-82570994 AAACACTTTTAGGTGGGGGAGGG - Intronic
1130755261 15:86756237-86756259 TTTCTTTTTTTGGTGGGGGCGGG - Intronic
1131074823 15:89488746-89488768 ATTCTGTATTTGGTGGGGCTGGG + Intronic
1132094194 15:98969925-98969947 ATTCTCTTTTTGTGGGGGGAGGG + Intronic
1134256918 16:12619869-12619891 TTTTTGTTTTGGGTGGGGGGAGG - Intergenic
1134544801 16:15099642-15099664 TTTCTCTTTTTGGAGGGGGAGGG - Intronic
1135362430 16:21826360-21826382 TTTCTCTTTTTGGAGGGGGAGGG - Intergenic
1135595756 16:23741660-23741682 TTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1135657906 16:24267576-24267598 ATTTTTTTCTAGGTGGGGCACGG - Intronic
1137327414 16:47455766-47455788 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1137554888 16:49464285-49464307 ATTCTGTAGAAGGTGGGGGTGGG + Intergenic
1138086702 16:54140071-54140093 ATTCCTTTTTAGCTGGGAGATGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138657819 16:58500976-58500998 CTTATTTTGTAGGTGGGGGAAGG + Intronic
1138676905 16:58657911-58657933 ATTCAGTTTTAGCTGGTGGCTGG + Intergenic
1139337366 16:66242164-66242186 ATTCAGTATGAGGTGTGGGAGGG + Intergenic
1139632094 16:68237038-68237060 ATTGGGTTGTAGGTGCGGGATGG - Intronic
1139846859 16:69927506-69927528 ATTCAGTTTCAGTTGGGGGCTGG - Intronic
1140074158 16:71681571-71681593 CTTCTGTTTTATGGGGGGAAAGG + Intronic
1140636068 16:76915352-76915374 ACTCTTTTCTTGGTGGGGGAAGG - Intergenic
1141021128 16:80497576-80497598 ATTCTCTTTTAGGATGTGGAAGG - Intergenic
1141501489 16:84447453-84447475 ATTCTATTTTAAGTCTGGGATGG + Intronic
1141770911 16:86089193-86089215 ATTATCTTCTAGGTGGGGGATGG + Intergenic
1142171621 16:88625468-88625490 AATCTTTTTTTGGTGGGGGGAGG - Intronic
1142441904 16:90103869-90103891 ATTCTGGTTTAGGTGGTTGAGGG + Intergenic
1142981783 17:3676692-3676714 GTTCTGATTTGGGTGGGGGGCGG + Intronic
1143432313 17:6895991-6896013 AATCTGTTTTTGGGGGGAGATGG + Intronic
1144180774 17:12750269-12750291 ATTCTGATTTAGGTCTGGGGAGG + Intronic
1144707921 17:17381676-17381698 TTTTTGTTTTTGGCGGGGGAGGG + Intergenic
1145953823 17:28840954-28840976 ATTTTTTTTGAGGTGGGTGAAGG - Intronic
1146326860 17:31893723-31893745 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1147172215 17:38628629-38628651 ACTTTGCTTGAGGTGGGGGATGG - Intergenic
1147258689 17:39196704-39196726 AAGCTGTTTTACCTGGGGGAGGG - Intronic
1147769026 17:42855225-42855247 CTTCTGTTTTGGATGGGAGAGGG + Intronic
1147974969 17:44242037-44242059 TTTTTTTTTTTGGTGGGGGAGGG + Intergenic
1149252928 17:54790981-54791003 ACACTGTTTTGGGTGGGGAAAGG - Intergenic
1149814981 17:59714638-59714660 TTTTTGTTTTTGGTGGGGGGTGG + Intronic
1150055769 17:62014037-62014059 TTTGTGTTTTTGGTGGGGGGTGG - Intronic
1150158444 17:62873440-62873462 AATCTGTTTTAGATGGGATAAGG - Intergenic
1151222263 17:72621881-72621903 ATTTTGTTTTAGGCTGGGCATGG - Intergenic
1152688045 17:81704215-81704237 AGTCTGTTTTAATTGGGGGTGGG + Intronic
1154301889 18:13201360-13201382 ATGCTATTTTAGATGGGGAAAGG - Intergenic
1155198223 18:23495008-23495030 ATTCTCTTTTTTGCGGGGGAAGG + Intergenic
1155383140 18:25246737-25246759 ATCCTCTCTTAGGTGGGGAAAGG - Intronic
1155621267 18:27783457-27783479 ATCCTTTTTTTGGTGGGGGGCGG - Intergenic
1156149220 18:34223375-34223397 AGCCTGCTTTGGGTGGGGGAAGG + Exonic
1157413259 18:47481546-47481568 AGTCTCTTTTATGTTGGGGATGG + Intergenic
1157685146 18:49637359-49637381 ATTCTGTTTTAGATGGGCTAAGG + Intergenic
1158476980 18:57788954-57788976 ATTTTGTTTTATTTGGGGGTGGG - Intronic
1158842679 18:61405207-61405229 TTTCTGCCTTAGGTGTGGGATGG + Intronic
1159695787 18:71554317-71554339 TTTCTTTTTTTGGGGGGGGATGG + Intergenic
1159755229 18:72355983-72356005 ATTCTGATTGAGGTGTGAGATGG + Intergenic
1160598857 18:79997245-79997267 ATACTGTTTGAGGTTGGGTAGGG - Intronic
1160787876 19:909797-909819 TTTTTGTTTTTGGTGGGGGTTGG - Intronic
1161314155 19:3610129-3610151 ATCCTGTTAGAGGTGGGGGCTGG + Intergenic
1161725709 19:5927367-5927389 ATTTTTTTTTAAGTGGGGCAGGG - Intronic
1161925637 19:7296854-7296876 GATGTGTTTCAGGTGGGGGAAGG + Intergenic
1163247712 19:16107583-16107605 AGTCTTTTTGAGGTGGGGGAGGG - Intergenic
1163535991 19:17876854-17876876 TTTTTTTTTTAGGGGGGGGACGG - Intronic
1163895674 19:20056894-20056916 ATTTTTTTTTTGGAGGGGGATGG + Intergenic
1164320418 19:24139301-24139323 TTTCTTTTTTGGGGGGGGGATGG - Intergenic
1165817443 19:38650633-38650655 ATTCTTTTTGAAATGGGGGAAGG + Intronic
1166876397 19:45900452-45900474 TTTCTGATTTCGGTGGGGGGGGG - Intronic
1167422352 19:49411768-49411790 ATTGTGCTAGAGGTGGGGGATGG + Intronic
1167532519 19:50026872-50026894 ATTTTGGTTTTGGTTGGGGAAGG + Intronic
926100229 2:10111207-10111229 ATACTGATTTAGGTGGGGTGCGG + Intergenic
926916833 2:17900492-17900514 ATTTTATTTTTGGTGGGGGATGG + Intronic
927627057 2:24732898-24732920 TTTCTTTTTTTGGCGGGGGATGG - Intronic
927858012 2:26539194-26539216 ATACTGTTTTAGGGATGGGATGG + Intronic
928506890 2:31962976-31962998 GTTCTGTCTTACTTGGGGGAGGG - Intronic
928525598 2:32136551-32136573 GCTTTGTTTTAGGTGGGAGAAGG + Exonic
929147815 2:38722044-38722066 CTTCTGTTCTAGGTGGGGGGGGG - Intronic
929352888 2:40981650-40981672 TTTCTGTTTTAACTGGGGGCAGG - Intergenic
930126483 2:47801803-47801825 TTTATTTTTTTGGTGGGGGAAGG + Intronic
930330564 2:49978154-49978176 ATTTTCTTTTTTGTGGGGGATGG - Intronic
930367783 2:50462905-50462927 ATTCTATTTTGGGGGAGGGAAGG + Intronic
930526929 2:52542271-52542293 CTGCTGTTGTGGGTGGGGGAAGG - Intergenic
931055331 2:58463110-58463132 AATCTGTTTTTGGTGGTTGACGG + Intergenic
931171328 2:59806870-59806892 ATTCTCTTTTGGGTGGGGGTGGG - Intergenic
932314973 2:70774009-70774031 CTACTCTTTAAGGTGGGGGAAGG + Intergenic
932828555 2:74965096-74965118 TTTTTTTTTTTGGTGGGGGATGG + Intronic
933453737 2:82494444-82494466 ATTCTGTTGATGTTGGGGGAGGG + Intergenic
933477212 2:82806466-82806488 ATTCTGTTTCAGGTTTGGGAGGG - Intergenic
934737437 2:96696899-96696921 ATTTTTTTTTAAGTGGGGGATGG - Intergenic
934883553 2:98004975-98004997 TTTGTGTGTTGGGTGGGGGATGG + Intergenic
934969536 2:98751725-98751747 ATCCTGATTTGGGTGGGGGCAGG + Intergenic
935876783 2:107515742-107515764 ATTCTGATACAGGAGGGGGACGG - Intergenic
936280065 2:111131200-111131222 ATTTTTTTTTTGGCGGGGGATGG + Intronic
936990908 2:118365007-118365029 ATGATGTTTTTTGTGGGGGAGGG + Intergenic
937924587 2:127158004-127158026 ATGCTGTTGGAAGTGGGGGAGGG - Intergenic
939674788 2:145059377-145059399 AGTCTGATTTTGGTGGGGGTGGG + Intergenic
940039698 2:149347382-149347404 ATTCTTTTTTAGGTTGGGCAGGG + Intronic
940402618 2:153265125-153265147 GTGCTGTTTGAGGTTGGGGAAGG + Intergenic
941617455 2:167736933-167736955 ATTCTTTTTTTGGGGGGGAAGGG - Intergenic
942031598 2:171967894-171967916 ATTTTTTTTTTGGTGGGGGTGGG - Intronic
943672099 2:190673938-190673960 TTTTTGTTTTAGGCAGGGGATGG + Intronic
944046352 2:195415799-195415821 ATTCTTTTTTTGGTGGGGGGCGG + Intergenic
944336596 2:198542009-198542031 ACTCTGTTGGGGGTGGGGGATGG - Intronic
944643957 2:201759228-201759250 ATTATGTTTTTTGTAGGGGAGGG - Intronic
944879044 2:203992641-203992663 AGTTTGTTTCAGGTGGGGTAGGG + Intergenic
944932106 2:204530300-204530322 ATTCTTTTTTTGTGGGGGGATGG - Intergenic
945047867 2:205797842-205797864 TTTCTGTCTTTGGTGGGGCAGGG + Exonic
945457300 2:210064806-210064828 TTTTTTTTTTTGGTGGGGGAGGG - Intronic
945839115 2:214867383-214867405 ATTCTGTTTTTGATAGGGGTGGG - Intergenic
947216567 2:227755293-227755315 ATTCAGATTTGAGTGGGGGAGGG - Intergenic
947944145 2:234085372-234085394 GTTTTGTTTTTGGTTGGGGATGG - Intergenic
948071809 2:235134009-235134031 TTTCCTTTTTAGGTGGGGGAGGG + Intergenic
948151849 2:235750934-235750956 ATTATTTTTTTGGTGGGGGGAGG - Intronic
1169024771 20:2360380-2360402 ATTCTATTTTAGGGAGGAGATGG - Intergenic
1169848816 20:10027186-10027208 ATGCTTTTTTAGGTTGGGAAAGG + Intronic
1170149989 20:13219587-13219609 ATTTTTTTTTGGGTGGGGAACGG - Intergenic
1170260084 20:14395232-14395254 AGTTTGTTTTTTGTGGGGGAAGG + Intronic
1170292350 20:14784655-14784677 ATGGTGTTTTAAGTGGGGGGGGG + Intronic
1170318908 20:15072770-15072792 ATTCTTTTTTAGATGTGGAAAGG - Intronic
1170769319 20:19318334-19318356 ATCCTTTTGTAGGTGGGCGATGG + Intronic
1171070020 20:22059372-22059394 ATTTTGTTTTTGCTGGGTGAGGG + Intergenic
1171908448 20:30920504-30920526 TTTTTTTTTTTGGTGGGGGACGG + Intergenic
1172070873 20:32255977-32255999 AATCTATTTTAGGTCGGGCACGG + Intergenic
1173218081 20:41105976-41105998 ATACTGTTGTGGGTGGGGGTGGG - Intronic
1173425802 20:42942420-42942442 GTTCTGTTTTTGGATGGGGAAGG - Intronic
1173559814 20:43995024-43995046 ATTCTGGAGGAGGTGGGGGAGGG - Intronic
1174365829 20:50055631-50055653 TTTCTTTTTTAGGTGGGGGTGGG + Intergenic
1174650825 20:52123867-52123889 TTTCTTTTTTGGGGGGGGGAGGG + Intronic
1175428544 20:58887431-58887453 GTTCTAATTTAGGTGGTGGATGG + Intronic
1177755506 21:25342424-25342446 ATTATGTATTAAGTAGGGGAAGG - Intergenic
1177857656 21:26417725-26417747 ATTCTATTTTATGCGGGGCACGG + Intergenic
1178671019 21:34591809-34591831 ATTCTAATTTGGGTGGGGCAGGG - Intronic
1178995593 21:37396215-37396237 TTTTTTTTTTAGGTTGGGGATGG + Intronic
1179176519 21:39011731-39011753 ATTCTCTCTTACCTGGGGGAGGG + Intergenic
1179454715 21:41491111-41491133 ATTCTGTTTCAGTTGGGGGTCGG + Intronic
1179968661 21:44821229-44821251 TTTCTTTTTGAGGTGGGGGAAGG - Intergenic
1182555853 22:31127931-31127953 AGGCTGTTTGGGGTGGGGGATGG - Exonic
1182666192 22:31961812-31961834 ATTCTGTACTAGGAAGGGGAGGG + Intergenic
1184281410 22:43439747-43439769 AGTCTGTTTTGTGTGGGGCAAGG - Intronic
1184587727 22:45459156-45459178 ATTCTTTTTTTGGGGGGGGAGGG - Intergenic
1184736926 22:46404593-46404615 TTTGGGTTTTTGGTGGGGGAGGG + Intronic
949790829 3:7790426-7790448 GTCCTGTTTTAGGTTGTGGAAGG - Intergenic
949909613 3:8891139-8891161 ATTTTGTTTTTCGTGGGGGTGGG - Intronic
952201598 3:31134604-31134626 GTTCTGCTTTAGGTGTGGGTTGG + Intergenic
952630556 3:35460708-35460730 AATCTCTTTTAGGTTAGGGAAGG - Intergenic
955183909 3:56696939-56696961 TTTCTTTTTTTGGTGGGGGCAGG - Intergenic
955228500 3:57079511-57079533 AGTCTGATTTAGGTGGCGGCGGG - Intergenic
955351950 3:58200180-58200202 ACTCAGTTTGAGGTGGAGGAGGG - Intronic
958443066 3:94179864-94179886 TGTGTGTTTGAGGTGGGGGAAGG + Intergenic
958618047 3:96521656-96521678 ATTCTGTGTTAGGTTGAAGAAGG - Intergenic
958843151 3:99233066-99233088 ATTCAATTTTAGGTGGGGCTTGG - Intergenic
959638509 3:108603976-108603998 TTGCTTTTTTTGGTGGGGGAGGG + Intronic
959781127 3:110234459-110234481 TTTCTTTTTTTGGTGGGGGGTGG - Intergenic
960181743 3:114588135-114588157 ATTCTGTTTTAGGTGGGGGAAGG + Intronic
960269897 3:115661981-115662003 AGTTTGTTTTTGGTGGGGGTCGG + Intronic
960800310 3:121532504-121532526 ATATTTTTTTTGGTGGGGGATGG + Intronic
962056016 3:131872457-131872479 ATTCTCTTTTACCTGGGTGAGGG + Intronic
962641339 3:137389840-137389862 ACTCTCTTTTAGGCTGGGGATGG + Intergenic
963325279 3:143855649-143855671 TTTCAGTTTTTTGTGGGGGAGGG + Intergenic
965103684 3:164334115-164334137 ATCCTGGTTTAGGAAGGGGAGGG + Intergenic
965914514 3:173826890-173826912 ATTATATTTTAGATGGGGGTTGG + Intronic
967041414 3:185696653-185696675 TTTCTCTTTTAGGTGTTGGATGG - Exonic
967641197 3:191866129-191866151 ATTAATTTTTAGTTGGGGGAGGG - Intergenic
967896440 3:194399813-194399835 GTTGTTTTTTTGGTGGGGGAGGG + Intergenic
968240755 3:197082363-197082385 TTTTTGTTTGGGGTGGGGGACGG - Intronic
968362172 3:198154836-198154858 ATTCTGGTTTAGGTGGTTGAGGG + Intergenic
968798431 4:2725526-2725548 ACTCAGCTTGAGGTGGGGGAAGG - Intronic
968809923 4:2795190-2795212 GTCCTGTTTTGGGTGGGGGCAGG + Intronic
969443449 4:7231234-7231256 ATTCTCTTTTAATTGGGGGGAGG + Intronic
971038937 4:22728807-22728829 ATGCTGTTTTATTTGGTGGAGGG + Intergenic
971412277 4:26386550-26386572 TTCCTGTTTTTGGTGAGGGACGG - Intronic
972807035 4:42539397-42539419 ATTTTGTTTTTGTTGGGGGGGGG - Intronic
975197903 4:71547107-71547129 ATTCTTTTTTGGGGTGGGGAGGG + Intronic
975419469 4:74145763-74145785 ATACTGTACTAAGTGGGGGATGG - Intronic
976369667 4:84272986-84273008 ATTTTGATTTGGGTTGGGGAAGG + Intergenic
976493351 4:85697791-85697813 TTTCTGTGTGAGGTGGAGGAAGG + Intronic
978006439 4:103622738-103622760 ATTCTTTTTTATGTGGGGGTTGG - Intronic
978059171 4:104314573-104314595 ATTTTTTTTTTGGGGGGGGATGG - Intergenic
980083078 4:128364644-128364666 TTTCTGTTTTGGGTGTTGGATGG + Intergenic
980191678 4:129532682-129532704 ATTCTGTGTAGGTTGGGGGAGGG + Intergenic
980543834 4:134231109-134231131 ATGCTGTTGTAAGTGGGGGTAGG + Intergenic
981805200 4:148707216-148707238 ATTTTTTTTTTGGTGGGGGGGGG + Intergenic
981922025 4:150096191-150096213 ATTTTGTTGAATGTGGGGGAAGG + Intronic
982275404 4:153632309-153632331 ATTTTTTTTTGGGTGGGGGGAGG - Intronic
982742296 4:159070145-159070167 ATTCTGTTTATGGTAGGGAATGG - Intergenic
984424390 4:179564422-179564444 ATACTTTTTTGGGAGGGGGATGG - Intergenic
985906363 5:2840493-2840515 ATAATGTTTTCGGTGGTGGAGGG + Intergenic
986190703 5:5494165-5494187 ATTCAGTTCAAGGTGGTGGAAGG - Intergenic
986623887 5:9705856-9705878 AGTCTTTTTTTGGGGGGGGATGG - Intronic
987438896 5:17932095-17932117 ATTTTGTTTTTTGTGAGGGAGGG - Intergenic
987791884 5:22578728-22578750 CATCTTTTTTTGGTGGGGGAGGG + Intronic
988395877 5:30697621-30697643 ATTCTGTTTTACATGGTGGCAGG - Intergenic
989004836 5:36798651-36798673 AGTCTTTTTCAGGTAGGGGAAGG + Intergenic
991334987 5:65537057-65537079 GTGCTGTTTTTGGTGAGGGAAGG - Intronic
992809368 5:80371457-80371479 AATCTCTTGTAGTTGGGGGAAGG - Intergenic
994244493 5:97464384-97464406 ATTTTGTTATAATTGGGGGAGGG - Intergenic
994722893 5:103401059-103401081 ATTATGTTTGAGGTGGGGTGAGG + Intergenic
995578352 5:113566910-113566932 TATCTGTTTTAGGGTGGGGAGGG + Intronic
995733141 5:115267042-115267064 AAAATGTTTTAGGTGGGGCATGG - Intergenic
996719736 5:126618370-126618392 ATTTTTTTTTTGGTGGGGGATGG - Intronic
997778193 5:136630153-136630175 ATGCTGTCTTAGGAGGGGGCGGG + Intergenic
998832897 5:146178608-146178630 TTTTTTTTTTTGGTGGGGGATGG - Intronic
999374876 5:151080043-151080065 ATTGTGTTTTGGTAGGGGGAGGG - Intronic
999656170 5:153812610-153812632 ATGCTATCTTAGCTGGGGGAAGG - Exonic
1000778214 5:165445220-165445242 ACTTTTTTTTTGGTGGGGGACGG - Intergenic
1001073035 5:168603504-168603526 ATTTTTTTTTGGGTGGGGGGTGG + Intergenic
1001160441 5:169307940-169307962 ATTGTGTTTGAGGTGGGAAAGGG + Intergenic
1001783268 5:174389086-174389108 ATTCTGATTTTGGAGAGGGAAGG - Intergenic
1001868529 5:175129071-175129093 GTTCTGAATTAGGTTGGGGAAGG + Intergenic
1002661956 5:180797395-180797417 TTTTTTTTTTTGGTGGGGGATGG - Intronic
1004122554 6:12838785-12838807 ATTCTGCTTCATGTGGGGGTTGG - Intronic
1004463634 6:15862720-15862742 TTTCTTTTTTGGGTGGGGCAGGG - Intergenic
1004942898 6:20579888-20579910 GTTCTGTTTTTTGTAGGGGAGGG + Intronic
1005165338 6:22913399-22913421 AGCCTGTTTGAGGTGGGAGAAGG - Intergenic
1006042613 6:31268706-31268728 AGTCTGTTGCAGGTGGGGGTGGG - Intergenic
1006282107 6:33061303-33061325 TTTCAATTTTGGGTGGGGGAGGG - Intergenic
1006486635 6:34348312-34348334 ATTTTTTTTTTGGTGGGGGGCGG - Intronic
1009319911 6:62274792-62274814 ATTTAGTTTGAGGAGGGGGAAGG - Intronic
1010520817 6:76834097-76834119 ATACTATTTTTGGTGAGGGAAGG + Intergenic
1010813719 6:80329881-80329903 TTTATGTTTTAGTTGGGGGAAGG - Intronic
1011611250 6:89152643-89152665 ATTCTGTCTTAAGAGGTGGAAGG - Intronic
1011639018 6:89402050-89402072 TTTTTTTTTTTGGTGGGGGATGG + Intronic
1012457564 6:99424562-99424584 ATTTTGTTTTACTTGGGGGCAGG + Intronic
1013316024 6:108943959-108943981 ATTCTGATTCAGGTCTGGGATGG + Intronic
1014105441 6:117555586-117555608 ATTCCGTATTTGGTGGGGGCAGG + Intronic
1015157080 6:130108642-130108664 ATTTTTTTTTTGGTGGGGGGAGG + Intronic
1015727529 6:136314730-136314752 CTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1016137789 6:140567532-140567554 ATTCTCTTGTGGGTGAGGGACGG + Intergenic
1016168302 6:140975421-140975443 TTTTTTTTTTTGGTGGGGGATGG + Intergenic
1016357809 6:143236742-143236764 AATGTGTTTTAGTTGGGGGGTGG - Intronic
1016404680 6:143717572-143717594 TTTTTTTTTTTGGTGGGGGAAGG + Intronic
1016938566 6:149466380-149466402 CCTCTTTTTTAGGTAGGGGAGGG - Intronic
1016939479 6:149472664-149472686 ATTCTCTTTGGGGTGGTGGAGGG - Intronic
1017482527 6:154871760-154871782 ATTCTTTTTTTTGTGGGGGATGG - Intronic
1017942229 6:159063087-159063109 TTTTTGTTTTGGTTGGGGGAAGG - Intergenic
1018457232 6:163963182-163963204 ATTCTGTATTAATTGGGGGGGGG + Intergenic
1019001254 6:168754557-168754579 ATTCTTTTTTTTGGGGGGGATGG - Intergenic
1019253508 7:33871-33893 ATTCTGGTTTAGGTGGTTGAGGG - Intergenic
1019859063 7:3640026-3640048 CTTTTGTTTTTGGTAGGGGAGGG + Intronic
1021687521 7:23201757-23201779 ATTCTTTTTTTGTTGGGGGAGGG - Intergenic
1022254586 7:28643479-28643501 TATCTGTGTAAGGTGGGGGAGGG - Intronic
1023467302 7:40470082-40470104 CTTCTTTTTTGGGAGGGGGAAGG + Intronic
1025768417 7:64481021-64481043 ATACTGTTTAAGGTTGGGTAGGG + Intergenic
1026622199 7:71959627-71959649 TTTTTTTTTTAAGTGGGGGAAGG + Intronic
1026765732 7:73158411-73158433 ATTGTGTATTTGCTGGGGGAGGG - Intergenic
1027042206 7:74968108-74968130 ATTGTGTATTTGCTGGGGGAGGG - Intronic
1027081436 7:75234250-75234272 ATTGTGTATTTGCTGGGGGAGGG + Intergenic
1027883904 7:83878006-83878028 ATTCTGTTTTAGAAGGGCTAGGG - Intergenic
1028111525 7:86948118-86948140 ATTCTGTTTTGGCTGGAAGAGGG - Intronic
1028246132 7:88479764-88479786 ATTATGTTTCAAGTGGTGGATGG + Intergenic
1029061968 7:97807531-97807553 CTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG + Intronic
1029390023 7:100268839-100268861 ATTGTGTATTTGCTGGGGGAGGG + Intronic
1030437671 7:109545141-109545163 CCTCTCTTTTTGGTGGGGGAAGG + Intergenic
1030682019 7:112443893-112443915 TTTGTTTTTTTGGTGGGGGATGG - Intronic
1031675463 7:124605982-124606004 GGTCTATTTTAGGAGGGGGAGGG - Intergenic
1031784893 7:126017073-126017095 ATTATGTTTTTGGAGGGGAAGGG - Intergenic
1032633093 7:133675149-133675171 GTTGTGTTTTTGGTGGGGGATGG + Intronic
1033997943 7:147375432-147375454 ATTCAGTTTTTGGTGGGGAAGGG - Intronic
1034541476 7:151761218-151761240 ATGGTGTTTTAGTTTGGGGAAGG - Intronic
1034678827 7:152912192-152912214 ATTCTGTGTGGGGTGTGGGAGGG + Intergenic
1035763169 8:2084982-2085004 ATTCTGTTGGAAGAGGGGGAAGG - Intronic
1035787305 8:2271866-2271888 ATTCTGTTATGGGCGGGGCAGGG + Intergenic
1035805502 8:2449850-2449872 ATTCTGTTATGGGCGGGGCAGGG - Intergenic
1036102922 8:5807115-5807137 AATGTGTTTGAGGTGTGGGAAGG + Intergenic
1036296766 8:7543642-7543664 GTTCTGTTTCAGGTGGAGCAGGG + Intergenic
1036325801 8:7777377-7777399 GTTCTGTTTCAGGTGGAGCAGGG - Intergenic
1037263031 8:17028253-17028275 ATTCTGGCTTTAGTGGGGGAAGG - Intronic
1037780378 8:21864396-21864418 CTGCTGTTTGAGTTGGGGGAGGG - Intergenic
1037952374 8:23027743-23027765 CTTCTTTTTTAGGTGGTGGTGGG - Exonic
1038096935 8:24323593-24323615 CTTCTTTTTTGGGTGGGGGGTGG - Intronic
1039114309 8:34075303-34075325 TTTTTTTTTTTGGTGGGGGACGG + Intergenic
1040570787 8:48607574-48607596 ATTATTTTATAAGTGGGGGAAGG + Intergenic
1040851547 8:51905782-51905804 TTTCTTTTTTGGGGGGGGGATGG - Intergenic
1042750618 8:72153910-72153932 ATGCTATTTAAGGTGGGGAAAGG - Intergenic
1043045371 8:75316279-75316301 TTTCTTTTTTTGGTGGGGGGGGG + Intergenic
1043066569 8:75579098-75579120 ATTTTTTTTTTTGTGGGGGACGG + Intergenic
1043538803 8:81235956-81235978 ATTCAGTATGAGGTGGGGAAAGG - Intergenic
1044065192 8:87689944-87689966 ATTCTGTATTCGGTGGTGAAGGG - Intergenic
1044508010 8:93042985-93043007 TTTGTGTTTCAGGTGGGGGATGG + Intergenic
1044844954 8:96371581-96371603 GTTATTTTTTTGGTGGGGGATGG + Intergenic
1046771421 8:118120158-118120180 ATTTTATTTTAGGAGTGGGAAGG + Intergenic
1047695640 8:127401103-127401125 ATTTTATTTTATGTGGGGGAGGG + Intergenic
1047703810 8:127477406-127477428 AATCTGTTTTTGCTGGTGGAGGG - Intergenic
1048786020 8:138051206-138051228 TCTCTGTTTTGGGTGAGGGATGG + Intergenic
1049978707 9:884208-884230 ATTCATTTTAAGGTGGGTGAAGG - Intronic
1051152768 9:14102152-14102174 ATACTGTTTTTGGTGGGGGAGGG - Intronic
1051254844 9:15202721-15202743 TTTTTTTTTTTGGTGGGGGAGGG - Intronic
1051265184 9:15302838-15302860 TTTCTTTTTTTGGTGGGGGATGG - Intronic
1051748206 9:20315743-20315765 ATTGTGTTTATGGTGGTGGAGGG - Intergenic
1052036814 9:23692009-23692031 ATTATGATTTGGGTTGGGGAAGG - Exonic
1052246178 9:26337846-26337868 ATTCTGTTTTAGGTAAGATAGGG - Intergenic
1054900746 9:70367077-70367099 ATTCTGTTTTGGGGGGTGGAAGG - Intergenic
1055766456 9:79668626-79668648 ATTTTGTTTTAAGTTGAGGAGGG - Intronic
1056276787 9:85001568-85001590 ATTTGGTTTCAGGTTGGGGATGG + Intronic
1056305147 9:85283099-85283121 ATTCTGCTTTGTGAGGGGGATGG - Intergenic
1057247335 9:93467808-93467830 ATTCTGTTATGGGTGGAGGAAGG + Intronic
1057256863 9:93556694-93556716 ATTCTGTTTTAGGTTGGGCCTGG + Intronic
1057288205 9:93777869-93777891 ATACTGTTTTGGGGAGGGGATGG + Intergenic
1057574286 9:96229286-96229308 ATTCTGTGTTGGTTGGGGGTAGG + Intergenic
1057940378 9:99276870-99276892 GTTTTGTTTTAGGTTGAGGAAGG - Intergenic
1058189493 9:101895494-101895516 TTTCTGTATTAGGTAGGAGAAGG + Intergenic
1059499899 9:114743186-114743208 GTTATGTTTTAGGTGGAGGATGG - Intergenic
1060001042 9:119958844-119958866 TTTCTGATTTAGTTGGGGGAGGG - Intergenic
1060441651 9:123645426-123645448 ATTATCTTTTAGATGGGGGCTGG - Intronic
1061127722 9:128687606-128687628 TTTTTTTTTTTGGTGGGGGAGGG - Intronic
1061300440 9:129701654-129701676 TTTCTGTTTTGGATGGGGCATGG - Intronic
1061326103 9:129865658-129865680 ATTCTTTTTTTTGTGGGGGAGGG + Intronic
1061402304 9:130375233-130375255 ATTCTGTTTGAGGGGGGAGTGGG - Intronic
1062746859 9:138218498-138218520 ATTCTGGTTTAGGTGGTTGAGGG + Intergenic
1185659668 X:1717315-1717337 ATTCTGTTCTAGGAGGTGAACGG - Intergenic
1186187891 X:7039982-7040004 ATTCTGTTTTAGGATTGGAATGG - Intergenic
1186850457 X:13574687-13574709 TTCCTGTCTTAGGTGTGGGATGG - Intronic
1187847953 X:23560804-23560826 GGCCTGTTTCAGGTGGGGGAAGG - Intergenic
1189288008 X:39865939-39865961 GTTTTTTTTTAGGTGGGGGAGGG - Intergenic
1189986473 X:46557900-46557922 ATTTTTCTTTGGGTGGGGGAGGG + Intergenic
1192851235 X:74958361-74958383 ATTCTGGTTTAGCTGGGGAGAGG + Intergenic
1194675549 X:96789546-96789568 ATACTGCTTTAGGCGGGAGAAGG + Intronic
1196309376 X:114144421-114144443 ATTTTTTTTTTGGTGGGGGAAGG - Intergenic
1196416487 X:115477236-115477258 CTTATGTTCTAGGTGGGGGCAGG - Intergenic
1196722030 X:118863483-118863505 ATTCTGGTTTAGGTGAGTTATGG - Intergenic
1197180931 X:123535831-123535853 AGCCTGTTGTGGGTGGGGGAGGG + Intergenic
1197778453 X:130136482-130136504 ATTCTGTTTTAATGGAGGGATGG + Intronic
1198151252 X:133912516-133912538 TTTTTTTTTTTGGTGGGGGAAGG + Intronic
1199429451 X:147742482-147742504 ATTCTGATTCAGGTGGAGGGTGG + Intergenic
1199601378 X:149543365-149543387 ATTCTGTGCTAGTTGGGGCAGGG + Intronic
1199648999 X:149936119-149936141 ATTCTGTGCTAGTTGGGGCAGGG - Intronic
1201695108 Y:16816198-16816220 GGCCTGTTTTGGGTGGGGGAAGG + Intergenic
1201945202 Y:19503458-19503480 GTACCATTTTAGGTGGGGGAAGG - Intergenic