ID: 960181798

View in Genome Browser
Species Human (GRCh38)
Location 3:114588741-114588763
Sequence GGCACGGAACTCTCCACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960181798 Original CRISPR GGCACGGAACTCTCCACTGT AGG Intronic
900379528 1:2377039-2377061 CGCACGTAACTCTCCACGCTGGG - Intronic
901673807 1:10871192-10871214 GACCCGGAACTGTCCTCTGTAGG - Intergenic
904829254 1:33296184-33296206 GGGCCGGACCTTTCCACTGTGGG + Intronic
905810404 1:40908504-40908526 GGGACTGAGCTCTCAACTGTGGG + Intergenic
907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG + Intergenic
914999779 1:152578854-152578876 GGCAGATAATTCTCCACTGTGGG + Intronic
915142147 1:153774544-153774566 GCCAAGGAACTCTCCTCTGCTGG - Intronic
921919451 1:220650078-220650100 GGCACTGCACACACCACTGTTGG + Intronic
923680295 1:236113338-236113360 GGTCCTGAACACTCCACTGTGGG - Intergenic
1066154781 10:32662965-32662987 GGCAGGGAACTCACCACAGTTGG + Intronic
1072611593 10:97020784-97020806 GCCCCGGGACCCTCCACTGTGGG - Intronic
1077147136 11:1051362-1051384 GGCAGGGAAGCTTCCACTGTCGG + Intergenic
1079331205 11:19534327-19534349 TGCACTGAAGTCTGCACTGTGGG - Intronic
1082806651 11:57455978-57456000 GGGACAGACCTCTCCTCTGTGGG - Intergenic
1090462291 11:126902226-126902248 GGCAAGGAAATACCCACTGTGGG + Intronic
1096673557 12:53214397-53214419 GGCAGGGCACTCTTCACTTTGGG - Intronic
1100519545 12:95360372-95360394 GCAACGGCACACTCCACTGTGGG + Intergenic
1103877881 12:124142750-124142772 GGGATGGAATTTTCCACTGTGGG - Intronic
1107080513 13:36369805-36369827 GGCAGTGAACTCCACACTGTAGG + Intronic
1108736928 13:53293868-53293890 TGCACACAACTCTCCACTGAAGG + Intergenic
1110132243 13:72022497-72022519 GGGAGGGAACCCTCCTCTGTGGG + Intergenic
1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG + Intergenic
1120872064 14:89346737-89346759 GGGACGGAACTCTCCACTCCTGG - Intronic
1121501191 14:94439678-94439700 GGTACGGAACTCTGCTCTGTGGG + Intergenic
1145105938 17:20116917-20116939 GGCAGGACACTCTCCACTGCAGG - Intronic
1151287993 17:73127385-73127407 GGCACGGCCCTCTCCACCATGGG + Intergenic
1161498369 19:4599268-4599290 GGCATGGAAGACCCCACTGTGGG - Intergenic
1165160358 19:33812386-33812408 GACAGGGAACTCTCCATTATTGG + Intronic
1167034460 19:46986008-46986030 GGCCCGGTGCTCTCTACTGTCGG + Intronic
1167573394 19:50305047-50305069 GCCACGGAACTCTGTTCTGTGGG + Intronic
937411917 2:121683960-121683982 GGGATGGAATTTTCCACTGTGGG - Intergenic
937661862 2:124439303-124439325 GGCACTGAATTCTGCACTGGGGG + Intronic
938568749 2:132543346-132543368 GGAATGGAATTTTCCACTGTGGG + Intronic
940837486 2:158539645-158539667 GGCACTGAAAACTTCACTGTGGG - Intronic
947445372 2:230158741-230158763 GGGACAGAACTTTCCACTGCAGG - Intergenic
947771455 2:232673584-232673606 GGGAGGGAACTCTTCAATGTGGG - Intronic
948365296 2:237450780-237450802 GGCACGGACCTCCCCACCCTGGG + Intergenic
1170959211 20:21010194-21010216 GGAACTGAGCTCTTCACTGTGGG - Intergenic
1177971802 21:27799175-27799197 GGCTAGGTACTCTCCACAGTAGG + Intergenic
949916162 3:8966238-8966260 GGCATGGAACTCTCCACTTCTGG - Intergenic
950779533 3:15379439-15379461 GGCAGGGAACTCCTCAGTGTGGG - Intergenic
951075659 3:18388699-18388721 GCCACAGAACTTTTCACTGTAGG - Intronic
951227917 3:20142609-20142631 AGCACTTAACTCTCCACTCTTGG - Intronic
952108319 3:30093758-30093780 GGAACGGAATTTTCCACTGTGGG + Intergenic
954976273 3:54697913-54697935 GGCATGGTAATCTTCACTGTTGG + Intronic
960181798 3:114588741-114588763 GGCACGGAACTCTCCACTGTAGG + Intronic
963276649 3:143337914-143337936 AGCATGTTACTCTCCACTGTGGG - Intronic
974402619 4:61425712-61425734 GGGAAGGAACCCTCCTCTGTGGG - Intronic
974428878 4:61771191-61771213 GGAATGGAATTTTCCACTGTGGG + Intronic
977575133 4:98666633-98666655 GGGAAGGAACTCTCCTCTGGGGG - Intergenic
983686835 4:170420531-170420553 GGAACAGAATTTTCCACTGTGGG - Intergenic
988484226 5:31655073-31655095 AGCACGGAAGACTCCACTGATGG - Intronic
989319723 5:40120802-40120824 GGAACAGAAGTTTCCACTGTGGG - Intergenic
997395030 5:133552959-133552981 GCCACAGAATTCTCAACTGTAGG + Intronic
1000009279 5:157216606-157216628 GGCCCTGATCTCCCCACTGTGGG + Intronic
1000149740 5:158487902-158487924 GGCAGGGAGCTTTCCACTGGAGG - Intergenic
1004900453 6:20188756-20188778 GGGATGGAACTTTCCATTGTGGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1012595763 6:101036746-101036768 AGCATGGATCTCTCCACTTTGGG + Intergenic
1018958295 6:168428029-168428051 GGCACGTAACCGTGCACTGTTGG - Intergenic
1024002678 7:45201371-45201393 GGCAGGGCTCTCTCCACTTTAGG + Intergenic
1024538163 7:50455490-50455512 GGCAGTGAATTCTCCATTGTAGG - Intronic
1029561855 7:101308354-101308376 GGCACGCACCTCTCCTCTGACGG + Intergenic
1032010976 7:128347757-128347779 GGCACAGAACCCTGCACTGTGGG - Intergenic
1033426527 7:141249604-141249626 GACACTGAACTCTGCCCTGTTGG + Intronic
1033986795 7:147236150-147236172 GGCACTGACCTCCCCACTGCAGG + Intronic
1035618891 8:1022814-1022836 GGCACGGAACCATCCACTCCCGG - Intergenic
1042742194 8:72062323-72062345 GGGCCAGAACTCTCCACTTTTGG + Intronic
1043983480 8:86667338-86667360 GGAAGGAAACTCTCCACTTTCGG - Intronic
1044429457 8:92091510-92091532 GGCACAGGAATCTCCCCTGTTGG + Intronic
1045281120 8:100750537-100750559 GGCACAGAACTCACCACTTTAGG + Intergenic
1050334046 9:4573820-4573842 GGGAAGGAACACTCCAGTGTGGG - Intronic
1051488640 9:17636251-17636273 AGCACAGAACTTGCCACTGTGGG + Intronic
1057271098 9:93651910-93651932 GGCAGGGAACCCTCTCCTGTGGG + Intronic
1186047573 X:5552653-5552675 TGCAGGGAACTCTCCAGTTTCGG + Intergenic
1187625729 X:21111288-21111310 GTCACGCCACTCTTCACTGTTGG - Intergenic
1195641645 X:107182241-107182263 GGGACTGAACTATGCACTGTAGG + Intronic
1200884242 Y:8252786-8252808 GGCATGGCACCCTCCACTGGTGG - Intergenic
1201491819 Y:14549905-14549927 CCCAGGGAAGTCTCCACTGTTGG - Intronic