ID: 960183771

View in Genome Browser
Species Human (GRCh38)
Location 3:114613986-114614008
Sequence AAGGATGAGGAGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 1, 1: 2, 2: 29, 3: 358, 4: 2748}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960183771_960183777 24 Left 960183771 3:114613986-114614008 CCCACCTCCTTCTCCTCATCCTT 0: 1
1: 2
2: 29
3: 358
4: 2748
Right 960183777 3:114614033-114614055 CATGAGAATTAGTTTTCTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960183771 Original CRISPR AAGGATGAGGAGAAGGAGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr