ID: 960184882

View in Genome Browser
Species Human (GRCh38)
Location 3:114626145-114626167
Sequence AACATTTAGGAATATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960184882_960184888 6 Left 960184882 3:114626145-114626167 CCCACCACATATTCCTAAATGTT 0: 1
1: 0
2: 3
3: 28
4: 326
Right 960184888 3:114626174-114626196 CAGAGATGCACAGATGTATATGG 0: 1
1: 0
2: 3
3: 27
4: 379
960184882_960184890 12 Left 960184882 3:114626145-114626167 CCCACCACATATTCCTAAATGTT 0: 1
1: 0
2: 3
3: 28
4: 326
Right 960184890 3:114626180-114626202 TGCACAGATGTATATGGGTAAGG 0: 1
1: 0
2: 0
3: 21
4: 173
960184882_960184889 7 Left 960184882 3:114626145-114626167 CCCACCACATATTCCTAAATGTT 0: 1
1: 0
2: 3
3: 28
4: 326
Right 960184889 3:114626175-114626197 AGAGATGCACAGATGTATATGGG 0: 1
1: 0
2: 0
3: 18
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960184882 Original CRISPR AACATTTAGGAATATGTGGT GGG (reversed) Intronic
902848917 1:19137617-19137639 AACATTTAGGTATACGTATTAGG - Intronic
903402810 1:23069538-23069560 AAAATTTATGAATTTGTGTTGGG + Intronic
903661633 1:24982169-24982191 AACATTTGGAAATATGGGGGGGG - Intergenic
903983707 1:27209117-27209139 AAAATTTATGAATTTGTGTTGGG - Intergenic
904147975 1:28410260-28410282 AAACTTTAGGAATAAGTGGCTGG - Intronic
904886245 1:33740693-33740715 GACATTTAGAAATATGGTGTGGG + Intronic
905968929 1:42125607-42125629 AGAATTTAGGAATATGAAGTTGG + Intergenic
907755763 1:57309008-57309030 AACGTTTACGAATTTGTGTTGGG - Intronic
907907490 1:58797117-58797139 AACATTTTTGTATATGTGATTGG - Intergenic
908096061 1:60740087-60740109 CACATATAGGCATGTGTGGTAGG + Intergenic
908444639 1:64189399-64189421 AACATTTGGCAGCATGTGGTTGG + Intergenic
908500932 1:64743933-64743955 AGCATTTAGAAATGCGTGGTTGG + Intergenic
908990110 1:70076471-70076493 AACATATAGGAATTTATGGTTGG + Intronic
909226835 1:73035281-73035303 AATATTTATGAATATGATGTGGG - Intergenic
910581738 1:88835067-88835089 AACATTTATAAATATTTGCTGGG + Exonic
911062098 1:93757491-93757513 ATCATTTTGCAATATGTGTTGGG + Intronic
911651765 1:100396992-100397014 AACGTTTATGAATTTGTGTTAGG - Intronic
913347011 1:117819217-117819239 AACATTTGGCAGCATGTGGTTGG - Intergenic
913359782 1:117967511-117967533 AAAGTTTAGGAATTTGTGTTGGG + Intronic
917323368 1:173807050-173807072 AACATTTTGGTATATATGTTTGG - Intronic
917519489 1:175736219-175736241 AAACTTAAGGAAGATGTGGTGGG + Intronic
918530466 1:185514830-185514852 AACATTTTGGCATAGCTGGTAGG + Intergenic
919228818 1:194745304-194745326 AACATTTAGGAAGGGGAGGTTGG + Intergenic
919472519 1:197996802-197996824 AACATTTGGGAGGCTGTGGTGGG - Intergenic
920318206 1:205095332-205095354 AAAATTTATGAATTTGTGTTGGG - Intronic
920477537 1:206291003-206291025 AATGTTTAGGTGTATGTGGTTGG - Intronic
921627455 1:217393019-217393041 AACATTTAGCAATTTGAGGCAGG + Intergenic
922009677 1:221570126-221570148 AACAGTATGGGATATGTGGTAGG + Intergenic
922055529 1:222038987-222039009 CACATTTCCAAATATGTGGTCGG + Intergenic
922662019 1:227438484-227438506 ATCATTTAGGGAAATGTAGTAGG + Intergenic
923170711 1:231414569-231414591 AACATTTAAGAAAATTAGGTAGG + Intronic
923387806 1:233482940-233482962 AACGTTTATGAATTTGTGTTGGG + Intergenic
923809048 1:237292121-237292143 AACATTTAGGGATCTCTTGTTGG - Intronic
923818002 1:237402100-237402122 AATATTTATGATTATCTGGTGGG + Intronic
923895553 1:238266004-238266026 ATCATTTTGAAATCTGTGGTTGG + Intergenic
923905926 1:238383570-238383592 AAAATTTAGGAATTTGTGTTGGG - Intergenic
1062871935 10:912352-912374 AACATTTACAAATTTGTGTTGGG + Intronic
1063487738 10:6435739-6435761 AAAGTTTAGGAATTTGTGTTGGG + Intronic
1064140884 10:12789167-12789189 AAAATTTACGAATTTGTGTTGGG - Intronic
1065400953 10:25300565-25300587 AGTACTTAAGAATATGTGGTAGG - Intronic
1065685201 10:28277441-28277463 AAAGTTTAGGAATTTGTGTTGGG + Intronic
1065867920 10:29929657-29929679 AGCATTTATGAAATTGTGGTGGG - Intergenic
1066296512 10:34058598-34058620 AATATTTATGAATTTGTGTTGGG - Intergenic
1066316217 10:34249351-34249373 AACATTTAGGAATTTTTACTCGG + Intronic
1066359546 10:34716913-34716935 AAAGTTTATGAATATGTGTTGGG - Intronic
1066474757 10:35735734-35735756 ATCATCTAGGAATATATGGGTGG + Intergenic
1066988788 10:42492557-42492579 AACAATTATGAATATTTCGTTGG + Intergenic
1068369857 10:56098250-56098272 ATCATTTGGGTATATGTGCTGGG + Intergenic
1068638735 10:59377508-59377530 AAAATTGAGGATTATGTGTTAGG + Intergenic
1069537571 10:69266088-69266110 CACATTTAGCCCTATGTGGTAGG - Intronic
1069575786 10:69527615-69527637 AAAGTTTAGGAATATGTGTTGGG + Intergenic
1069808389 10:71140541-71140563 AAAATTTAGCCAGATGTGGTGGG - Intergenic
1070720284 10:78752297-78752319 AGCATTGAGTAATACGTGGTAGG - Intergenic
1072517256 10:96197513-96197535 AAAATTTAGAAATATGTGAAGGG + Intronic
1073714335 10:106085345-106085367 AAAATATAGGAGTATGAGGTCGG - Intergenic
1074665043 10:115712568-115712590 AAGATTTAGAAATTTGTGGCTGG + Intronic
1075136381 10:119789713-119789735 AACATTTGGGAAGGTGGGGTTGG + Intronic
1077758543 11:5064513-5064535 AATATAAAGGAAAATGTGGTGGG - Intergenic
1078249898 11:9608338-9608360 AACATTTGGGAGTCTGAGGTGGG - Intergenic
1079084291 11:17434081-17434103 CACATTTAGAACTATGTAGTTGG - Intronic
1079373096 11:19868730-19868752 AACTTTTGGCACTATGTGGTTGG + Intronic
1080364934 11:31562874-31562896 AATATTTAGAAATATGGGGGAGG - Intronic
1081095225 11:38924350-38924372 AATAATTATGAATATTTGGTTGG - Intergenic
1083209208 11:61172345-61172367 AACTTTTAGATATTTGTGGTTGG + Intergenic
1086288559 11:85278079-85278101 AACATTTAGGATTAGTAGGTGGG - Intronic
1086491666 11:87362387-87362409 AACATTTAGCAGCATGTGGTTGG + Intergenic
1086625802 11:88950678-88950700 AATATTTTGGAATATCTGGGAGG - Intronic
1086642282 11:89174581-89174603 AAGATTTAGGGCTATGTGCTAGG - Intergenic
1086661534 11:89425444-89425466 AACATTTAGTAATATGGGTCTGG + Intronic
1087224872 11:95587256-95587278 AAGAAAAAGGAATATGTGGTAGG + Intergenic
1088502449 11:110496353-110496375 AACATCAATGAATATTTGGTAGG - Intergenic
1089895760 11:121928612-121928634 GAAATTTAGGAATATGTCTTAGG - Intergenic
1090128776 11:124117702-124117724 AACATTTACGAGTTTGTGGCTGG + Exonic
1090198552 11:124838200-124838222 AACATATATGAATTTGTGTTGGG + Intergenic
1090680538 11:129051659-129051681 AACATTTAGGTATATTGGCTGGG + Intronic
1091362997 11:134993075-134993097 AACATTTATTAATAGGTGCTTGG - Intergenic
1091701968 12:2669373-2669395 AAAGTTTACGAATATGTGTTGGG + Intronic
1092048049 12:5446657-5446679 ACAATTTGGGAATATATGGTTGG - Intronic
1092509234 12:9136046-9136068 TACATTTAGAAATATTTGCTAGG - Intergenic
1093210857 12:16306894-16306916 AACACTTTGGAAGATGAGGTGGG + Intergenic
1094317994 12:29153176-29153198 AACATGTAGGAATACATTGTGGG + Intronic
1094751159 12:33409924-33409946 AGCATTTAGGAATTTATGGAAGG + Intronic
1095359170 12:41315041-41315063 AACATTTAGGAATATGGTTTTGG - Intronic
1095456428 12:42390624-42390646 AAAGTTTAGGAATTTGTGTTGGG - Intronic
1097211814 12:57376651-57376673 AATATTTAGAAATATGGGGACGG + Intronic
1097849061 12:64393704-64393726 GACATTTATGAATTTGTGTTGGG - Intergenic
1098064164 12:66594423-66594445 AACATTTACAAATTTGTGTTGGG - Intronic
1098587653 12:72173168-72173190 AATAATTAGAAATATGTGTTTGG + Intronic
1098662064 12:73107361-73107383 AACATTTTGGAAAATGTGTAGGG + Intergenic
1099722333 12:86380794-86380816 AACATTTGGGATTATGGGCTTGG - Intronic
1100830187 12:98510374-98510396 GACATTTAAGAATATGAGGCTGG - Intergenic
1100988969 12:100231791-100231813 AAAATTTAGGCAGGTGTGGTGGG + Intronic
1104369910 12:128215378-128215400 GACATTTAGGTATTTGGGGTTGG + Intergenic
1104658881 12:130594595-130594617 AAAATTTATGAATTTGTGTTGGG + Intronic
1105378578 13:19865277-19865299 AAAATTTACAAATATGTGTTGGG + Intergenic
1106699543 13:32214395-32214417 AAAATTTATGAATTTGTGTTGGG - Intronic
1108568612 13:51727289-51727311 AACATTTTTTAATATCTGGTAGG + Intronic
1109073338 13:57799205-57799227 AACATTAAGGACTATGTGTACGG + Intergenic
1110181162 13:72619118-72619140 ACCATTTGGGAATAAGTTGTGGG - Intergenic
1110253435 13:73405997-73406019 AAAGTTTAGGAATTTGTGTTGGG + Intergenic
1111014220 13:82355883-82355905 CACATTTAGGAATATGGAATAGG + Intergenic
1111612062 13:90617306-90617328 AACATTTGGCAGCATGTGGTTGG - Intergenic
1112988996 13:105487525-105487547 CACATTTAGGTATATTTTGTAGG - Intronic
1115932797 14:38516405-38516427 AACATTTAGAAAAATGTGGTAGG + Intergenic
1115937253 14:38566462-38566484 AACATATTGGAATGTGTGTTTGG + Intergenic
1116451015 14:45065454-45065476 AAAATTTATGAATTTGTGTTAGG + Intronic
1117098311 14:52319491-52319513 AACAGTTTGGAATATGTTGTTGG - Intronic
1117504697 14:56390446-56390468 AAAATTTATGAATTTGTGTTGGG - Intergenic
1117701212 14:58415386-58415408 AACATTGATTAATATGTGTTAGG + Intronic
1118237373 14:64020343-64020365 AAAATTTAGGAATTTATGTTGGG + Intronic
1118417642 14:65559998-65560020 AACATTAAGGTAAATGTTGTAGG + Intronic
1118588307 14:67378179-67378201 AACATTTAGGAAGGAGTGGGAGG - Intronic
1118872436 14:69754534-69754556 AACATTCAGGAATAATTGGAGGG - Intronic
1120541875 14:85761080-85761102 AAAATTTATGAATCTGTGTTGGG - Intergenic
1124451962 15:29801930-29801952 AAAATTTACGAATTTGTGTTGGG + Intronic
1125315259 15:38424783-38424805 AAAATTTATGAATTTGTGTTGGG + Intergenic
1125384475 15:39122661-39122683 AGCATGTGGGAATATATGGTTGG + Intergenic
1126369934 15:47934755-47934777 AAGCTTGAGGAATATGGGGTTGG + Intergenic
1127002682 15:54528386-54528408 AAAATTCAGGAATATTTCGTAGG + Intronic
1127115320 15:55720832-55720854 AACATTTATGAATTTGTGTTGGG + Intronic
1130372636 15:83298782-83298804 AAAATTTATGAATTTGTGTTGGG + Intergenic
1130972069 15:88741393-88741415 AACACGTAGGAAGGTGTGGTTGG + Intergenic
1131148572 15:90032473-90032495 AACAATTAAGAATGTGTGTTTGG + Intronic
1132135360 15:99332396-99332418 AATATTTACGAATTTGTGCTAGG - Intronic
1133944015 16:10333621-10333643 AACATTGATGAAATTGTGGTTGG - Intronic
1134278498 16:12797743-12797765 AAAGTTTAGGAATTTGTGCTGGG + Intronic
1134812934 16:17182673-17182695 AACAATTAGGCATATGTGGGGGG + Intronic
1137321582 16:47388857-47388879 AACTTTGAGGAATATGGAGTTGG - Intronic
1137532867 16:49293595-49293617 AATATTTAGGAAAATGAGCTTGG - Intergenic
1138944068 16:61826422-61826444 GACATTTAGCAATATGGGGAAGG - Intronic
1139480384 16:67227299-67227321 AACATTAAGGGATATGGGGTGGG + Intronic
1140579845 16:76217070-76217092 AACAATTATGAATGTGTGGTAGG + Intergenic
1140739688 16:77930187-77930209 AACAATAAGGAATATGTGTTGGG - Intronic
1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG + Intronic
1142377504 16:89713687-89713709 AAAGTTTAGGAATTTGTGTTGGG - Intronic
1143007882 17:3848693-3848715 AACTTGAATGAATATGTGGTTGG + Intergenic
1145000789 17:19303147-19303169 AATATTTAAGAATAAGTTGTGGG + Intronic
1147023834 17:37563489-37563511 AACATATAGGACTTTGGGGTTGG - Intronic
1148577610 17:48722793-48722815 AACTTTTAGGAAAATGGGGGCGG + Intergenic
1148877095 17:50695430-50695452 AACATTTATAAATATGTTATAGG + Exonic
1149019019 17:51942028-51942050 TACAGTTATTAATATGTGGTAGG - Intronic
1149370524 17:55989727-55989749 AAGATTTAGGGACCTGTGGTGGG - Intergenic
1150184624 17:63167363-63167385 AAAATTTCAGAAAATGTGGTTGG + Intronic
1150522565 17:65884572-65884594 AACATTCTAGAATATGAGGTAGG + Intronic
1155047768 18:22118093-22118115 AAAATTTAGGAAAATATGGCTGG + Intergenic
1155638222 18:27980372-27980394 ACCGTTTAGGAATCTGTTGTAGG + Intronic
1155684240 18:28528353-28528375 AACCTTTATGAATTTGTGTTGGG + Intergenic
1155755510 18:29490086-29490108 AACAAATAAGAATTTGTGGTAGG - Intergenic
1156854089 18:41762026-41762048 AACTTGAAAGAATATGTGGTGGG + Intergenic
1156865484 18:41884724-41884746 ATCATTTAGGTATATATGTTAGG + Intergenic
1156909866 18:42398950-42398972 AATATTTTGGAATATATTGTGGG + Intergenic
1156947369 18:42851370-42851392 AACATCTAGAGATATGTGTTTGG + Intronic
1157305674 18:46515661-46515683 AAAATCCAGGAATATGGGGTTGG + Intronic
1157786256 18:50485672-50485694 AAAATTTATGAATTTGTGTTGGG - Intergenic
1158054960 18:53267760-53267782 AACAATAACGAATATGTGGCCGG - Intronic
1158622520 18:59045404-59045426 CTCCTTTAGGAATGTGTGGTTGG + Intergenic
1159085616 18:63787605-63787627 ATTATTTAGGAATATGTGCATGG - Intronic
1159250061 18:65864326-65864348 AACATTTAAGAATTTGTGTCGGG - Intronic
1160003990 18:75054688-75054710 GACATTTAGGAAAAGGTGGTTGG + Intronic
1161604933 19:5209525-5209547 AAGATTGAGGAAGATGGGGTTGG - Intronic
1161955480 19:7492133-7492155 AACATTTGTGAATATGTAGTTGG + Intronic
1165446422 19:35859292-35859314 AAAGTTTATGAATTTGTGGTGGG - Intronic
925769057 2:7264846-7264868 GACATTTTAGAATATGTGCTAGG + Intergenic
926836941 2:17033478-17033500 AACATTGAGGAATGTGTCCTGGG + Intergenic
927786025 2:25975516-25975538 AAAAATTAGGAATATCAGGTTGG - Intronic
928143998 2:28754910-28754932 AACAATCAGGAATATGTTGTGGG - Intronic
929013351 2:37470067-37470089 AACAGTCTGGAATATGTGATTGG - Intergenic
929213162 2:39381941-39381963 AACCTATGGGAGTATGTGGTGGG - Intronic
931393573 2:61865698-61865720 AAAATTTACGAATTTGTGTTGGG - Intergenic
933006102 2:76997627-76997649 CACATTTAAGAATATGTGGTTGG + Intronic
933829203 2:86193101-86193123 GACATTTAAGAAGATGGGGTTGG + Intronic
934112290 2:88755243-88755265 AACATTTAAGATTATGTGGCTGG - Intergenic
934896585 2:98125038-98125060 AGCATTTAGGGAAATGTGGTCGG + Intronic
935878499 2:107537255-107537277 AAAATTTAAAAATATGTGCTAGG + Intergenic
936386370 2:112033140-112033162 AGCATTTGGGGACATGTGGTGGG + Intergenic
937454195 2:122027233-122027255 AAAATTTATGAATTTGTGTTGGG + Intergenic
938470921 2:131560350-131560372 AACAATTAGGTAAATGTAGTGGG + Intergenic
939387862 2:141524517-141524539 AAAGTTTATGAATATGTGTTGGG - Intronic
940542316 2:155036850-155036872 CATAGTTAGTAATATGTGGTGGG + Intergenic
940627726 2:156196475-156196497 AACAGTTAGGCATATGTCCTAGG + Intergenic
941094666 2:161224115-161224137 AACATGTAGGATTCTGGGGTTGG - Intronic
941554946 2:166966352-166966374 CAAATTTAGGTATATCTGGTTGG - Intronic
943319992 2:186434190-186434212 AACATTTGGCAGCATGTGGTTGG + Intergenic
943939297 2:193970545-193970567 AAAATTTATGAATTTGTGTTGGG + Intergenic
944068671 2:195646372-195646394 AACAATTAGGAAACTGTGATAGG - Intronic
944864437 2:203846923-203846945 AACATTTAGCAATTTGTGCCAGG - Intergenic
944997736 2:205313176-205313198 CACATTTAGGATTGTTTGGTTGG + Intronic
945586233 2:211667136-211667158 AAAGTTTACGAATTTGTGGTGGG + Intronic
947974221 2:234350716-234350738 AGCATTCAGGAAAATGTGTTAGG - Intergenic
948412407 2:237774210-237774232 AACATTTTGGACTATGGTGTGGG - Intronic
1168818177 20:755140-755162 AACATTTTGGTCTATGTGGTAGG + Intergenic
1169122582 20:3106215-3106237 AACATTTAGGATTATGGTGATGG - Intergenic
1170520059 20:17175755-17175777 AACATTTAGGAGGATATGCTTGG - Intergenic
1170796170 20:19548856-19548878 TGCATTTAGGCATTTGTGGTAGG - Intronic
1171991568 20:31700528-31700550 AAATTTTAGGCATATGTGGAGGG - Intronic
1174175121 20:48639765-48639787 AACATTCAGAGATATGTGGAAGG - Exonic
1174602250 20:51734228-51734250 AACACTTTGGAAGATGAGGTGGG - Intronic
1177160578 21:17543860-17543882 AACATCTAGGAAGATGTGACAGG + Intronic
1177302266 21:19263492-19263514 AAAATTAAAGAATATGTGGTGGG - Intergenic
1177776350 21:25571297-25571319 AAGATTTAAGAATATCTGGCTGG - Intergenic
1177784938 21:25661300-25661322 AACATTTAAGAAAATTTGCTAGG + Intronic
1178185259 21:30211341-30211363 AACATTTTGGAAAATGTAATGGG + Intergenic
1178998002 21:37424495-37424517 AATATTCAGGATGATGTGGTTGG + Intronic
1182871502 22:33651540-33651562 ATTATTTCGGAATATGTGGAAGG - Intronic
1185209281 22:49559782-49559804 AATATTTAGGCATAAATGGTTGG + Intronic
949706186 3:6820134-6820156 AACACTAAGGAAAATGAGGTGGG - Intronic
950821837 3:15768398-15768420 AACATTTGGGAGGCTGTGGTGGG + Intronic
950836073 3:15920203-15920225 AACCTTGAGGGATATGTGGATGG - Intergenic
951079447 3:18434983-18435005 AACGTTTAGAAAATTGTGGTCGG - Intronic
951128801 3:19016824-19016846 AACATTTCTGAAAATGTGTTGGG + Intergenic
952047210 3:29337340-29337362 AAGATTTAGGAATATATGGCTGG + Intronic
953851530 3:46468817-46468839 AACATTTAGGGATTTGGGGTGGG + Intronic
954874039 3:53789498-53789520 AGCAGTTAGGAAAATTTGGTGGG + Intronic
955131967 3:56179102-56179124 AAAATTTATGAATTTGTGTTGGG + Intronic
955167819 3:56531773-56531795 AAACTTTTGTAATATGTGGTGGG - Intergenic
955226237 3:57062643-57062665 AACAAGCAGGAATATCTGGTGGG + Intronic
955489141 3:59465040-59465062 AATATTTATGAATTTGTGTTGGG - Intergenic
956533841 3:70253183-70253205 AACATTTTGGAAAATATGGTAGG + Intergenic
957563856 3:81860101-81860123 GACATTTTGGAATATGTATTAGG - Intergenic
959259919 3:104064587-104064609 AACATTTACAAATTTGTGTTTGG - Intergenic
959492025 3:107001613-107001635 CACATATGGGAATATGTGATTGG - Intergenic
959589297 3:108059941-108059963 AATATTTAGGAACATGGGCTTGG - Intronic
960042201 3:113162093-113162115 GAGATATGGGAATATGTGGTAGG + Intergenic
960184882 3:114626145-114626167 AACATTTAGGAATATGTGGTGGG - Intronic
960905199 3:122593995-122594017 AACATATAGCAATATGAGATAGG + Intronic
962894935 3:139705551-139705573 ACCATTTTGGAATATGGTGTTGG - Intergenic
963507054 3:146199502-146199524 TACATTTAGATAAATGTGGTAGG + Intronic
964616068 3:158666785-158666807 AACATTTAGGAAAACGTAGTTGG + Intronic
966745794 3:183275763-183275785 AACATTTAGCGGGATGTGGTGGG - Intronic
966791152 3:183671025-183671047 TACATATAGGTATATGTTGTCGG + Exonic
967192172 3:186994025-186994047 AACACATAGAAATATGTGGAAGG - Intronic
967529380 3:190531553-190531575 AACATTCAGGAGTATGTGCCGGG - Intronic
967762610 3:193242067-193242089 AACATTTACAAATTTGTGTTGGG - Intronic
969973657 4:11074412-11074434 AACATTTAGGAGTCTCTGGATGG - Intergenic
970740713 4:19234398-19234420 ATCATATAGGAATATGTCTTAGG - Intergenic
971250148 4:24967782-24967804 AACATTTGGCAGCATGTGGTTGG + Intronic
972053245 4:34767265-34767287 AATATTTAGGTATAGGTAGTTGG + Intergenic
972066042 4:34945475-34945497 AATATTGAGGCATGTGTGGTGGG - Intergenic
972365117 4:38367383-38367405 AACATTTACAAATTTGTGTTGGG + Intergenic
972418379 4:38864705-38864727 AACATTTAGAAATATGAGTGAGG + Intergenic
972756334 4:42051231-42051253 AACTTTTAGGAAGATTTGTTAGG - Intronic
972853652 4:43079998-43080020 AACATTTAGGTAAATGTAATGGG - Intergenic
973145419 4:46819592-46819614 AAAGTTTATGAATTTGTGGTGGG + Intronic
973717160 4:53688352-53688374 AACATTTTGGTTTCTGTGGTTGG - Intronic
973744811 4:53953202-53953224 AACATTTAATAATATGCGGTAGG - Intronic
974813127 4:66971684-66971706 AACATATAGGGACATGGGGTAGG - Intergenic
977481507 4:97583580-97583602 GCCATTTAGGACTATTTGGTTGG + Intronic
978007918 4:103640696-103640718 AAAATTTATGAATTTGTGTTGGG - Intronic
978107745 4:104924734-104924756 AAAATTTACGAATTTGTGTTGGG + Intergenic
978653575 4:111038968-111038990 AGCATTTAGAAATATGTTATGGG - Intergenic
979817680 4:125129970-125129992 AAAATAGAGGCATATGTGGTGGG + Intergenic
980524530 4:133972171-133972193 AACATTCAGGAATATGTTACTGG - Intergenic
980746345 4:137021970-137021992 AAGATCCAGGAATATGTGCTAGG - Intergenic
981448582 4:144869224-144869246 ATCATTTGGGAATATGGGGGAGG + Intergenic
983957251 4:173712279-173712301 AACATTTATGAATATTTATTAGG + Intergenic
984242626 4:177235997-177236019 AACATTTAAGAATACTTGGCCGG - Intergenic
984316716 4:178139236-178139258 AACATTTGGCAGTATGCGGTTGG + Intergenic
985111357 4:186549216-186549238 CATATTTAGGAATATGTTCTTGG - Intronic
985941152 5:3137306-3137328 AACATTGTGGCATATATGGTGGG + Intergenic
986253973 5:6086426-6086448 AAAGTTTAGGAATTTGTGTTGGG + Intergenic
988745345 5:34129969-34129991 GACATTTAAGAAAATGTGCTTGG - Intergenic
989053345 5:37343043-37343065 AAAATATGGAAATATGTGGTCGG - Intronic
989233301 5:39113442-39113464 AATGTTTTGAAATATGTGGTGGG + Intronic
989547611 5:42692986-42693008 AAAAATTAGGAATAGGTGGGTGG - Intronic
990272410 5:54157745-54157767 AACATTTACGACTATTTTGTCGG - Intronic
990447318 5:55904777-55904799 CACATGTAGGAATCTGGGGTGGG - Intronic
992667213 5:79022073-79022095 AACATTTAGAATTCTCTGGTTGG - Intronic
993050051 5:82916115-82916137 AACAATTACCATTATGTGGTAGG - Intergenic
993070460 5:83156142-83156164 AAGAGTTATGAATATGTGTTTGG + Intronic
993994349 5:94703303-94703325 AACATTGAAGAATCTGTAGTAGG + Intronic
994738940 5:103594382-103594404 AAGAGTTTGGAATATGGGGTGGG - Intergenic
995142093 5:108746528-108746550 AAAATGTAGAAAGATGTGGTTGG - Intergenic
995191632 5:109324301-109324323 AAAATTTATGAATTTGTGTTGGG - Intergenic
995982962 5:118129798-118129820 AACTTTTAGGAATTTTTTGTGGG + Intergenic
996132735 5:119801587-119801609 AACTTTAAGGAAGATGAGGTGGG - Intergenic
996868859 5:128162896-128162918 AAAATTTACGAATTTGTGTTAGG - Intronic
999436671 5:151568663-151568685 AAAACTGAGGAGTATGTGGTGGG - Exonic
1000133712 5:158324100-158324122 TACGTTCAGGGATATGTGGTAGG - Intergenic
1000742541 5:164987408-164987430 AACATTTAGACATCCGTGGTTGG + Intergenic
1001340792 5:170843298-170843320 AAAGTATAGGCATATGTGGTCGG - Intergenic
1002513475 5:179739269-179739291 AACTTTTGGGAAGCTGTGGTGGG + Intronic
1003797748 6:9624032-9624054 AGCATTTAGGGATGTGTGGGTGG + Intronic
1003842609 6:10137532-10137554 AACATCTATGAAACTGTGGTAGG + Intronic
1004029360 6:11851223-11851245 GACATTTACCAATATGTTGTTGG + Intergenic
1004375057 6:15083893-15083915 AAAATTTACGAATTTGTGTTGGG + Intergenic
1005123083 6:22412731-22412753 AAAATTTATGAATTTGTGTTGGG - Intergenic
1005488465 6:26323588-26323610 AACCGTTAGGAAAAGGTGGTTGG + Intergenic
1009798359 6:68502053-68502075 AACGTTTAGGAATTTTTGGAGGG + Intergenic
1010629180 6:78176491-78176513 AAAGTTTATGAATTTGTGGTGGG + Intergenic
1011781859 6:90798426-90798448 AAAGTTTATGAATATGTGTTGGG + Intergenic
1011959301 6:93067953-93067975 AAAAGTTAGGAAGATGTGATTGG + Intergenic
1012903360 6:105034244-105034266 CACTTCTTGGAATATGTGGTTGG - Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1014101889 6:117520263-117520285 AAACTTTAGGAATTTGTGTTGGG + Intronic
1014308275 6:119768640-119768662 CACATTTAGGAAAATTTGGACGG - Intergenic
1016114505 6:140263074-140263096 AACATTTAGGGATATGTGTCAGG - Intergenic
1016392845 6:143592214-143592236 AATATTTAGGCATATGGGATGGG + Intronic
1017091295 6:150761742-150761764 GACAATTAGGAATATTTGTTTGG - Intronic
1018685780 6:166303334-166303356 AACATTTAGGCATCTTTGGCCGG + Intergenic
1020854600 7:13402426-13402448 AAAATTTAGTTTTATGTGGTAGG + Intergenic
1021139532 7:17006965-17006987 AAAATTTACGAATTTGTGTTGGG - Intergenic
1021422564 7:20461947-20461969 AGCATTTAGTAAAATCTGGTAGG + Intergenic
1021445549 7:20730107-20730129 AAGATTTAGGAATACTGGGTTGG - Intronic
1021627587 7:22609605-22609627 AACATTTAGGAGACTGAGGTGGG - Intronic
1022422260 7:30234699-30234721 AAAAATTAGGATTATGTGTTTGG - Intergenic
1023620151 7:42063214-42063236 AACATTTAGGAAAATGTGGCTGG + Intronic
1024341113 7:48261415-48261437 AACATTTTGGAAAATGTTTTTGG + Intronic
1024408334 7:49008771-49008793 AGCATTTAGAAATATGTGCTAGG - Intergenic
1026852344 7:73732960-73732982 CACATTTATGAATATGTTGCTGG + Intergenic
1026919871 7:74147402-74147424 AATTTTTATGGATATGTGGTAGG + Intergenic
1028736968 7:94225296-94225318 AATATTTAGGTAAATGGGGTAGG - Intergenic
1033344119 7:140514009-140514031 AAAGTTTAGGAATTTGTGTTGGG + Intergenic
1033880104 7:145870733-145870755 AACATTTAGAAATATGTTCTTGG + Intergenic
1034884520 7:154788884-154788906 AAAATTGAGGAAAATGTGGGAGG - Intronic
1035919031 8:3656772-3656794 AAAAATTAGGCAGATGTGGTGGG + Intronic
1037049689 8:14356379-14356401 AGCATGTAGGAATTTTTGGTAGG - Intronic
1038318158 8:26505400-26505422 ACCATTTAGTTATATGTGCTAGG - Exonic
1038420639 8:27431942-27431964 AAAGTTTACGAATTTGTGGTGGG - Intronic
1040849046 8:51879464-51879486 ATCATTTAAGAATCTGAGGTGGG + Intronic
1041057446 8:54001401-54001423 AAGAATTTAGAATATGTGGTTGG + Intronic
1041086449 8:54261199-54261221 AACATTTAGGAGTATGGGAGAGG - Intergenic
1041476180 8:58269085-58269107 AACATTTACAAATTTGTGTTGGG + Intergenic
1042242756 8:66681188-66681210 AACATTTGGGAAACTGTGGAAGG - Intronic
1043243732 8:77972155-77972177 AAGATTTAGGAACATGTTGAAGG + Intergenic
1044025536 8:87166830-87166852 AACAATTATGAGTTTGTGGTGGG - Intronic
1044346333 8:91108680-91108702 AACATTTATGAATTTGAGTTGGG - Intronic
1044445386 8:92269469-92269491 AAAATTTATGAATTTGTGTTGGG - Intergenic
1045678055 8:104629922-104629944 ACCATTTTAGAATATGGGGTAGG + Intronic
1046481599 8:114826012-114826034 AACAATTAGCCAGATGTGGTGGG - Intergenic
1050783188 9:9365094-9365116 AACACTGAGTAATATGTGCTGGG + Intronic
1051262483 9:15277749-15277771 AACATTTTAGAATTTGTGATGGG - Intronic
1052195706 9:25711823-25711845 AACATTTTGGAAAAAGTGTTTGG + Intergenic
1052385570 9:27819927-27819949 AACGTTTAGCAATATCTGGATGG - Intergenic
1055044957 9:71914278-71914300 AAAATTTACGAATTTGTGTTGGG - Intronic
1055351368 9:75392440-75392462 AAAATTTATGAATTTGTGTTGGG + Intergenic
1056807245 9:89738394-89738416 AACATTTAAAAACATGTAGTAGG - Intergenic
1057170226 9:92958637-92958659 AATATTCATGAATTTGTGGTTGG - Intronic
1057741196 9:97712768-97712790 AAAGTTTACGAATATGTGCTGGG - Intergenic
1059825578 9:118024672-118024694 AACATTTGGGAATTTGTAGAAGG + Intergenic
1061339776 9:129970499-129970521 AACATTTAAGAATATTGGCTGGG - Intronic
1186159773 X:6764760-6764782 AAAATTTGGGCATCTGTGGTAGG + Intergenic
1186769094 X:12800006-12800028 AAAATTGAAGAAAATGTGGTTGG + Intronic
1187013485 X:15303383-15303405 AAAATTTATGAATTTGTGTTGGG + Intronic
1187181622 X:16947653-16947675 AATATTTAGAAATATGTTATGGG - Intronic
1188220184 X:27531824-27531846 TACATTCAGGGATATGTGCTAGG + Intergenic
1188961163 X:36493462-36493484 AATATTTAACAATATGTGGTTGG - Intergenic
1188967552 X:36573678-36573700 AACATCCATGAAAATGTGGTAGG - Intergenic
1189725041 X:43959781-43959803 AACATTTAGGAAAATTGGGAGGG + Intronic
1189732671 X:44037902-44037924 TAAATTTAGGACTTTGTGGTTGG + Intergenic
1189845173 X:45129223-45129245 AACACTTAGAAATATGTACTAGG + Intergenic
1190180241 X:48185541-48185563 TCCATTTGGGAGTATGTGGTAGG - Intergenic
1193508435 X:82371182-82371204 AACATTTGGCAACATGTGATGGG - Intergenic
1193778090 X:85668843-85668865 AACATTAAGTAAAATGTGGCTGG + Intergenic
1194002941 X:88454463-88454485 AGCATGTAGGCATATTTGGTGGG - Intergenic
1195929449 X:110059685-110059707 AAAATTTATGAATTTGTGTTGGG - Intronic
1196536034 X:116845564-116845586 AATATTTAGGAATTTTTGTTTGG - Intergenic
1198604930 X:138326597-138326619 AACATTTAGGAATGCCTGGCGGG - Intergenic
1199552730 X:149076339-149076361 AACATTTAGCAGCATGTGGTTGG + Intergenic