ID: 960193684

View in Genome Browser
Species Human (GRCh38)
Location 3:114739068-114739090
Sequence ACTTCAATACGTTGGCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960193684_960193691 21 Left 960193684 3:114739068-114739090 CCATCGTGCCAACGTATTGAAGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 960193691 3:114739112-114739134 GAGAATGGGCCATACCTGGGTGG 0: 1
1: 2
2: 1
3: 68
4: 1396
960193684_960193689 17 Left 960193684 3:114739068-114739090 CCATCGTGCCAACGTATTGAAGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 960193689 3:114739108-114739130 AGCAGAGAATGGGCCATACCTGG 0: 1
1: 0
2: 3
3: 13
4: 148
960193684_960193687 6 Left 960193684 3:114739068-114739090 CCATCGTGCCAACGTATTGAAGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 960193687 3:114739097-114739119 AACTAATGCTGAGCAGAGAATGG 0: 1
1: 1
2: 1
3: 20
4: 224
960193684_960193690 18 Left 960193684 3:114739068-114739090 CCATCGTGCCAACGTATTGAAGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 960193690 3:114739109-114739131 GCAGAGAATGGGCCATACCTGGG 0: 1
1: 0
2: 0
3: 9
4: 155
960193684_960193688 7 Left 960193684 3:114739068-114739090 CCATCGTGCCAACGTATTGAAGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 960193688 3:114739098-114739120 ACTAATGCTGAGCAGAGAATGGG 0: 1
1: 0
2: 2
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960193684 Original CRISPR ACTTCAATACGTTGGCACGA TGG (reversed) Intronic
919018901 1:192077733-192077755 GCTTCATTACATTGGCATGATGG + Intergenic
1092045617 12:5430405-5430427 ACGTCGATATTTTGGCACGAGGG + Intergenic
1102345045 12:112154329-112154351 ACTTCAAAAAGTTGGGAGGAAGG + Intergenic
1113380708 13:109803133-109803155 ACTTCAATATCTAGGCACAAAGG - Intergenic
1121624479 14:95374295-95374317 ACTTCATTAGGTAGGCATGATGG + Intergenic
1126115185 15:45201533-45201555 ACATCAATACTTTGGGACAAAGG + Intergenic
1140425393 16:74856936-74856958 ACTTCAAGGCGCTGGCACGGTGG + Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1170809492 20:19662528-19662550 ACTTCACTACCTTGGCAGGCTGG + Intronic
1171087153 20:22248193-22248215 ACTTCAAAATGTTGGCACTGAGG + Intergenic
951196495 3:19828711-19828733 GCTTCATTACATGGGCACGATGG + Intergenic
955279089 3:57577082-57577104 ACTTCAGTAAGTTGGGAGGAAGG - Intronic
960193684 3:114739068-114739090 ACTTCAATACGTTGGCACGATGG - Intronic
969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG + Intronic
970421921 4:15912960-15912982 ACTTAAATACGTTTGCTCAATGG - Intergenic
982604249 4:157494008-157494030 ACTTCAATAAATTGGCAAGTGGG + Intergenic
1007730875 6:43945216-43945238 ACTTCAATCCATTGGCAAGCTGG - Intergenic
1014370854 6:120605819-120605841 GCTTCAAGACTTTGGCACCAGGG - Intergenic
1021094577 7:16521134-16521156 ACTTCAATACCTTGCCATGTGGG + Intronic
1037317167 8:17609954-17609976 CCTTGAAAACGTTGGCAGGAGGG + Intronic
1049467952 8:142761739-142761761 GCTTCATTACGTAGGCATGATGG - Intergenic
1058337022 9:103842579-103842601 ACTTCAATATGATGGCTCCATGG - Intergenic