ID: 960194730

View in Genome Browser
Species Human (GRCh38)
Location 3:114751478-114751500
Sequence CCTAGCAGGTGCCACATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960194730 Original CRISPR CCTAGCAGGTGCCACATAGT AGG (reversed) Intronic
900878418 1:5363070-5363092 CCTAGCATCTGGCACACAGTAGG - Intergenic
901587814 1:10312880-10312902 ACTAGCATTTGGCACATAGTAGG + Intronic
901681749 1:10916788-10916810 CCTGGCACCTGGCACATAGTAGG + Intergenic
901763115 1:11483351-11483373 CTTAGCACCTGGCACATAGTAGG - Intronic
903241229 1:21984011-21984033 CCTAGCACGTGGCACACAGAAGG - Intronic
906648453 1:47492920-47492942 CATAGCATCTGACACATAGTGGG + Intergenic
907512755 1:54973939-54973961 CCTAGAAGGTTACACATAGTAGG - Intergenic
910743759 1:90550770-90550792 CCTAGCAGGAGAAACATAGGGGG + Intergenic
913158160 1:116120670-116120692 CCTGGCACCTGCTACATAGTAGG + Intronic
919984169 1:202661310-202661332 CCCAGTAGGTGCCACCCAGTAGG - Intronic
1063313307 10:4977227-4977249 CCTATCATATGCAACATAGTTGG - Intronic
1064118297 10:12597490-12597512 CCTAGCAGGTCCCTCATGGTAGG + Intronic
1065085953 10:22176593-22176615 TCTTGCAGGTAGCACATAGTTGG - Intergenic
1067489109 10:46681177-46681199 CACAGCATGTGGCACATAGTAGG - Intergenic
1067605564 10:47659196-47659218 CACAGCATGTGGCACATAGTAGG + Intergenic
1071621122 10:87120572-87120594 CACAGCATGTGGCACATAGTAGG + Intronic
1072137379 10:92559931-92559953 ACTAGCCTGTGCAACATAGTGGG - Intronic
1072222027 10:93334751-93334773 CCTAGTACCTGGCACATAGTAGG - Intronic
1072471256 10:95716060-95716082 ACCAGCATGGGCCACATAGTGGG - Intronic
1073250799 10:102119510-102119532 CCTAAGAGGTGCCAGATAATTGG - Intronic
1074608245 10:114995438-114995460 CCTAGAATGTGCCACAAACTGGG - Intergenic
1075225110 10:120621744-120621766 CAGAGCACGTGGCACATAGTGGG - Intergenic
1075874433 10:125794755-125794777 CCTAGCAGGTGCCTTAGAATTGG - Intronic
1075934550 10:126328227-126328249 CCTAGCACCTGGCACATAATAGG + Intronic
1077895996 11:6453962-6453984 CCTAGCAGTGGCGACATAGAGGG + Intronic
1080872573 11:36250111-36250133 CCTAGCAGGTGACTCAGAGATGG + Intergenic
1083718917 11:64594408-64594430 CCGAGCACCTGGCACATAGTAGG + Intronic
1086537573 11:87866654-87866676 CCTACCGTGTGCCATATAGTGGG + Intergenic
1087593412 11:100221688-100221710 CATAGTACCTGCCACATAGTGGG - Intronic
1089979426 11:122760084-122760106 TCTAGTAGCTGGCACATAGTAGG - Intronic
1090215338 11:124957287-124957309 CCCAGCAGGTGCCACATTACTGG - Intronic
1091203273 11:133799206-133799228 TCTAGCACCTGCCGCATAGTAGG - Intergenic
1092921271 12:13233614-13233636 CTAAGCAGGTGCCACTGAGTTGG - Intergenic
1093210699 12:16304870-16304892 CCTAGTAGATGACACATAGTAGG - Intergenic
1093644021 12:21562359-21562381 AGTAGCACGTGCCACATAGCTGG - Intronic
1096223861 12:49851688-49851710 CCTAGGAGGTCTCACATAATAGG + Intergenic
1096809265 12:54159305-54159327 CCAAGCAGCTGCCACAGAGCGGG + Intergenic
1096976445 12:55701777-55701799 CCTAGCCTGTGCAACATAGTGGG - Intronic
1101043404 12:100779792-100779814 CCCAGTTGGTGGCACATAGTAGG + Intronic
1103070436 12:117936832-117936854 CATGGCAGGTGCCCCATACTGGG + Intronic
1103454144 12:121051627-121051649 CCCAGCACCTGACACATAGTTGG + Intergenic
1103532321 12:121611196-121611218 CCCAGCAGCTGGCACACAGTAGG - Intergenic
1104261447 12:127186971-127186993 TCTGGCAGGTGCCACAGAGGAGG - Intergenic
1106773268 13:32983594-32983616 CCTACCATGTGCCAGATACTGGG + Intergenic
1110354194 13:74547595-74547617 ACTAGCCTGGGCCACATAGTGGG + Intergenic
1111851425 13:93580554-93580576 CATAGCACGTGGCACATAATAGG - Intronic
1112792178 13:103015353-103015375 CCTTGCAGGTGGCAGATGGTGGG - Intergenic
1115094091 14:29613928-29613950 CCCAGCATGTTCCACATAGTAGG - Intronic
1120038796 14:79728939-79728961 TCTAGCACCTGGCACATAGTAGG - Intronic
1122365959 14:101194992-101195014 GCTGCCTGGTGCCACATAGTGGG + Intergenic
1125737256 15:41935353-41935375 CCTGGCACCTGACACATAGTAGG + Intronic
1127937981 15:63661802-63661824 CCCTGCAGGTGCCACATAACAGG + Exonic
1130672699 15:85926679-85926701 CATGGCAGCTGGCACATAGTAGG - Intergenic
1131094278 15:89646009-89646031 CCTAGCAGGTGACAAATGGCAGG - Exonic
1131450215 15:92533042-92533064 CCAAGCAGCTGCTACAGAGTTGG + Intergenic
1132228717 15:100165466-100165488 CCAAGCAGGTGCCACTCATTTGG - Intronic
1132645779 16:998664-998686 CACACCAGGTGCCACACAGTGGG + Intergenic
1137528005 16:49253779-49253801 ACAACCTGGTGCCACATAGTGGG + Intergenic
1138314295 16:56055378-56055400 CCTAACAGGTGCCCCATAGGTGG - Intergenic
1140207084 16:72942220-72942242 TATGGCAGGTGCCACATAATGGG - Intronic
1140413816 16:74759037-74759059 CCTGCCAGGTGCAACAGAGTGGG - Intronic
1141192577 16:81835073-81835095 CCTTCCAGGTGCCACTTACTTGG + Intronic
1142319212 16:89370277-89370299 CCTCAGAGCTGCCACATAGTTGG - Intronic
1144151969 17:12457024-12457046 TCAAGCAGGCCCCACATAGTTGG + Intergenic
1145248807 17:21286308-21286330 CCTAGCAGCGGGCACCTAGTGGG + Intronic
1146733195 17:35213319-35213341 ACTAGCAGGTGGCAGTTAGTTGG + Intergenic
1147006455 17:37407311-37407333 CCTAGCAGGCCCCCCAAAGTAGG + Intronic
1147632633 17:41941899-41941921 CCCAGCATCTGCCACACAGTGGG + Intronic
1159092147 18:63861332-63861354 CCCAGCAGGGGCCACATGGCAGG - Intergenic
1161127729 19:2569167-2569189 CCCAGCAGGTGCCTCATGCTGGG - Intronic
1163828387 19:19536117-19536139 CCCAGCAGGTGCCACAGAGCAGG + Intronic
1164203601 19:23039510-23039532 CTGAGCAGGTGGCTCATAGTTGG + Intergenic
1164887855 19:31798604-31798626 CCTAGCAGGGGCTACAGAATGGG - Intergenic
1165966326 19:39584100-39584122 CCTAGCAAGTGCCACACACAAGG + Intergenic
1165972040 19:39639886-39639908 CCTAGCAGGTGCCACACAGAAGG + Intergenic
1168009938 19:53521886-53521908 CCTAGCAGGTACCACATGGCTGG - Exonic
1168017229 19:53583237-53583259 CCTAGCTTGGGCAACATAGTGGG + Intergenic
934153744 2:89175099-89175121 CCCAGCAGATGCCATATGGTTGG - Intergenic
934511598 2:94948454-94948476 CCTAGCACTTGCTATATAGTTGG - Intergenic
935803005 2:106717392-106717414 GCTAGCAGGTGGTAGATAGTGGG - Intergenic
937445966 2:121958114-121958136 ACTAGCAGTAGGCACATAGTAGG - Intergenic
940994420 2:160132945-160132967 CCTAGTATGTGTCATATAGTAGG + Intronic
948238418 2:236408264-236408286 CCCAGCACGTGCCACAGAGAAGG + Intronic
1169426267 20:5499832-5499854 CCTTGCAGGTGAAACATGGTGGG - Intergenic
1172042652 20:32056875-32056897 CCTGGCACCTGGCACATAGTAGG + Intronic
1172047624 20:32091773-32091795 CCCAGCCTGGGCCACATAGTGGG + Intronic
1172113171 20:32559352-32559374 CCTAGATGCTGGCACATAGTAGG + Intronic
1174051962 20:47773158-47773180 CTTAGCATGTGGCACATAGTAGG - Intronic
1174112043 20:48203946-48203968 AGTAGCTGCTGCCACATAGTAGG + Intergenic
1174912020 20:54617804-54617826 ACTAGCAAGTGCCATAAAGTAGG - Intronic
1174919458 20:54686191-54686213 CTCAGCATGTGGCACATAGTGGG - Intergenic
1176587551 21:8603512-8603534 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1180270381 22:10580510-10580532 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1180786679 22:18551554-18551576 ACTAGCAGGTCCCAGATGGTAGG - Intergenic
1181243593 22:21491075-21491097 ACTAGCAGGTCCCAGATGGTAGG - Intergenic
1182117784 22:27767144-27767166 CCTAGCACCTGACATATAGTAGG + Intronic
1183099403 22:35574700-35574722 CCTAGAACCTGGCACATAGTAGG + Intergenic
1183977364 22:41520355-41520377 CTTAGAAAGTGCCACACAGTAGG - Intronic
1184460067 22:44632792-44632814 CCTAACAAGTGACACATCGTGGG + Intergenic
949139803 3:618239-618261 CCTAGCAGGTTCCAGCTACTAGG + Intergenic
949909643 3:8891247-8891269 CCTGGCAGGGGTCACAGAGTTGG + Intronic
950080495 3:10218702-10218724 CATAGCACCTGCCACACAGTAGG - Intronic
950502206 3:13371797-13371819 CTGAGCAGGTGCCAGATACTGGG - Intronic
950881524 3:16326445-16326467 CCTAGCACAAGGCACATAGTAGG + Intronic
952929613 3:38348854-38348876 CCTAGCACCTGGCACAAAGTAGG - Intronic
953100811 3:39824912-39824934 ACTAGCCTGGGCCACATAGTTGG - Intronic
954612747 3:51954926-51954948 CATAGAACGTGGCACATAGTAGG - Intergenic
955218673 3:57006075-57006097 CCTAGCACCTGGCACACAGTTGG + Intronic
956683559 3:71803840-71803862 CATAGCACCTGACACATAGTGGG + Intergenic
959580843 3:107980885-107980907 CCCAGCACTTGGCACATAGTAGG - Intergenic
960194730 3:114751478-114751500 CCTAGCAGGTGCCACATAGTAGG - Intronic
961332039 3:126148088-126148110 GCTAGCAGGTGCCATCCAGTAGG - Intronic
961627959 3:128276622-128276644 CCTAGCATCTGGCTCATAGTAGG - Intronic
963239891 3:142992576-142992598 CCTAGCAGGAGACACATAGGCGG - Intronic
963625970 3:147672980-147673002 CCTAGCACCTCTCACATAGTGGG - Intergenic
966298212 3:178448716-178448738 CCTAGTACCTGGCACATAGTAGG - Intronic
968952737 4:3703061-3703083 CGTAGAAGGTGCCACACAGACGG + Intergenic
970539082 4:17059533-17059555 CCTAGCAGCTGCCCCAGGGTTGG + Intergenic
970617195 4:17779633-17779655 CATAGCAGCTGGCACATAGTAGG + Intronic
975381654 4:73707438-73707460 CCTACTATATGCCACATAGTAGG - Intergenic
977053370 4:92158601-92158623 ACTAGCCTGTGCAACATAGTGGG - Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
982268658 4:153564366-153564388 CATAGCAGGTGCCATCTAGGAGG + Intronic
982880696 4:160710930-160710952 CCCAGCAAGTGGCACATAATTGG - Intergenic
990764228 5:59164416-59164438 CCTAGCATCTGACGCATAGTAGG - Intronic
993408180 5:87538676-87538698 GCTTGCAGCTGGCACATAGTAGG + Intergenic
995434009 5:112115315-112115337 CATAGCATCTGGCACATAGTAGG - Intergenic
996210140 5:120798458-120798480 CCTACCAGGTAGCACATTGTGGG + Intergenic
996442689 5:123510226-123510248 GCTAGCCTGGGCCACATAGTAGG - Intergenic
997178402 5:131802516-131802538 CCTAGCACTTGGAACATAGTAGG - Intergenic
997804766 5:136906155-136906177 CTGAGCTGGTGCCACAAAGTGGG + Intergenic
998183495 5:139961671-139961693 CTGAGCTGGTGACACATAGTGGG - Intronic
998416613 5:141950829-141950851 CCCAGCAACTGACACATAGTAGG - Intronic
999263869 5:150253891-150253913 CCCAGCAGCTGACATATAGTAGG - Intronic
1001566538 5:172703141-172703163 CCTACCATGTGCCACATGCTAGG - Intergenic
1001566539 5:172703141-172703163 CCTAGCATGTGGCACATGGTAGG + Intergenic
1001729915 5:173945170-173945192 CCCAGATGGTGGCACATAGTAGG + Intronic
1004127577 6:12888279-12888301 CCTAGCTGGTGCCATCTATTAGG + Intronic
1006131834 6:31874251-31874273 CCCAGCACCTGGCACATAGTAGG + Intronic
1006315527 6:33289206-33289228 CCTCTCAGCTGCCACACAGTCGG + Exonic
1006390865 6:33757577-33757599 CCTAGCAGGTGCTGCATGGATGG - Intergenic
1007097314 6:39221513-39221535 CCTACCAGGTGCCAGACATTGGG - Intronic
1007253511 6:40512567-40512589 CCTGGCAGGAGCCACATTTTGGG + Intronic
1007339667 6:41182707-41182729 CCTAGCAGGTGCGAGAGACTAGG - Intergenic
1008138199 6:47801204-47801226 GCTAGCAGGTGCCACGCTGTAGG - Intronic
1008182945 6:48355853-48355875 GCTAGCAGGTGCCACAGTGCTGG - Intergenic
1008584918 6:52939913-52939935 CCTGGCAAGTTCAACATAGTGGG + Intergenic
1011701177 6:89956371-89956393 GCTAGCAGTTGGCACATAGTTGG + Intronic
1013213180 6:108004759-108004781 CCCAGCACGTGCCACAGAGAAGG + Intergenic
1013656927 6:112255586-112255608 CCTAACATGTGCCAGATACTTGG + Intergenic
1016990695 6:149925917-149925939 CCTCGCAGGGGCCACACTGTCGG - Intergenic
1017124981 6:151056877-151056899 CCTAGCACTTGGCACACAGTGGG + Intronic
1017409891 6:154156911-154156933 TTTAGCAGGTGCCACAGATTTGG + Intronic
1020089476 7:5330651-5330673 GCTACCAGGTAGCACATAGTAGG - Intronic
1023684197 7:42718143-42718165 TCTAGCAGCTGGCACCTAGTAGG - Intergenic
1031345008 7:120653726-120653748 CATAACAATTGCCACATAGTAGG - Intronic
1033478420 7:141713775-141713797 CCCAGCATCTGCTACATAGTAGG + Intronic
1035441231 7:158902736-158902758 CCTTGCAGCTACCACATAGGAGG + Intronic
1039262043 8:35782395-35782417 CCTATCTGGTGCTATATAGTAGG + Intronic
1039483520 8:37893447-37893469 TCTAGCACCTGGCACATAGTAGG + Intronic
1040582969 8:48712425-48712447 CCTAGCTGGGACCACATAATAGG + Intronic
1040948104 8:52906188-52906210 CCTAACAGATGCCACAAAGGAGG + Intergenic
1043240859 8:77933594-77933616 CTTGGCAGTTGGCACATAGTAGG + Intergenic
1044157083 8:88860649-88860671 ACTAGGGGGTGCCACACAGTGGG - Intergenic
1045243611 8:100423772-100423794 ACTAAGAGGTGACACATAGTAGG - Intergenic
1047986099 8:130235444-130235466 ACTAGGAGATGCCACAAAGTGGG - Intronic
1048006994 8:130427491-130427513 CCTCTCAGATGCCACATACTTGG + Intronic
1048172895 8:132124830-132124852 CCCAGAAGATGCCACATAGCTGG - Exonic
1048190028 8:132279579-132279601 CATAGCACCTGGCACATAGTAGG + Intronic
1051823572 9:21194176-21194198 CCTAGTAGGTGACTCTTAGTTGG - Intergenic
1052340318 9:27358611-27358633 CCTAGCAGCTGGCACACAGTAGG + Intronic
1054985396 9:71256372-71256394 CCTCGCACCTGTCACATAGTTGG - Intronic
1058658785 9:107249720-107249742 CATAGCATGTGACACATAGTAGG + Intergenic
1061058182 9:128235738-128235760 CCTAGCAGGGGCGACAGAGCAGG - Intronic
1061437857 9:130578067-130578089 CCTAGGGTGTGGCACATAGTAGG - Intergenic
1203617516 Un_KI270749v1:81690-81712 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1187111866 X:16310359-16310381 CATAGCACTTGCCACATAATAGG + Intergenic
1189279334 X:39810255-39810277 CATAGCAGGTACCTCATAGTAGG - Intergenic
1189666783 X:43364187-43364209 CATAGCACATGGCACATAGTAGG + Intergenic
1190409797 X:50125277-50125299 CCCAACACGTGCCACATAGGGGG - Intergenic
1192274155 X:69613042-69613064 CATAGCACCTACCACATAGTAGG - Intergenic
1198338762 X:135693409-135693431 ACTAGCTGGTACCACATAGATGG - Intergenic
1199245165 X:145595743-145595765 CCTTGTAGGTGGCATATAGTTGG - Intergenic
1200226143 X:154418975-154418997 TCTAGCAGCTGGCACATAGTAGG + Intronic