ID: 960195929

View in Genome Browser
Species Human (GRCh38)
Location 3:114768037-114768059
Sequence ATGGATAATTAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960195929_960195934 14 Left 960195929 3:114768037-114768059 CCCTGCACCATCTAATTATCCAT 0: 1
1: 0
2: 1
3: 10
4: 254
Right 960195934 3:114768074-114768096 AAACCATTGGCTCTAGAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 152
960195929_960195933 1 Left 960195929 3:114768037-114768059 CCCTGCACCATCTAATTATCCAT 0: 1
1: 0
2: 1
3: 10
4: 254
Right 960195933 3:114768061-114768083 AGCTTAATATGAAAAACCATTGG 0: 1
1: 0
2: 0
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960195929 Original CRISPR ATGGATAATTAGATGGTGCA GGG (reversed) Intronic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
901001214 1:6149651-6149673 ATGGATAAATGGATGATGGATGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
905249437 1:36638591-36638613 ATGTAAAACTAGATGGTGCTGGG - Intergenic
907161720 1:52375735-52375757 ATGAATTATTACATTGTGCATGG + Intronic
908489661 1:64630712-64630734 AATGAGAATTAGATGGTTCATGG - Intronic
909543730 1:76819903-76819925 ATATATAATTAGCTGATGCATGG + Intergenic
910747152 1:90586539-90586561 ATGGTTAAATAGATGCTGAAGGG - Intergenic
912620685 1:111153701-111153723 AAGGATAAATAAATGGTGCTAGG - Intronic
914351262 1:146842578-146842600 ATGGATGAGTAGATGATGGATGG + Intergenic
914351393 1:146843115-146843137 ATGGATAGATAGATGATGGATGG + Intergenic
914905818 1:151742706-151742728 ATGGATGATTAGGAGGTGGAGGG + Intergenic
916535177 1:165697376-165697398 ATGGATAATTAGATTGACCGTGG + Intronic
918123928 1:181565798-181565820 ATGGATAATTAGCTGGATCCTGG + Intronic
918522999 1:185435633-185435655 ATGGATCATTAGATGGAGATTGG + Intergenic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
924170316 1:241332583-241332605 ATGGACTCTTAGATGGTGAAGGG - Intronic
1063862186 10:10323076-10323098 AAGGTTAAGTAGATGGTGGATGG + Intergenic
1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG + Intronic
1065591383 10:27265678-27265700 ATGGAAAAATTGATGGGGCATGG - Intergenic
1065921116 10:30393444-30393466 ATGCAAAAGTAGATGTTGCATGG - Intergenic
1068095294 10:52483947-52483969 ATGGCAAATTAGTGGGTGCATGG - Intergenic
1068358483 10:55943487-55943509 TTGAATAATTAGATGCTACAAGG + Intergenic
1072076120 10:91975895-91975917 TTGGATAATTGGTTGGTGTAAGG - Intronic
1073690396 10:105801809-105801831 ATGTATGCTTAGTTGGTGCAAGG - Intergenic
1075118478 10:119647006-119647028 AAGGATAATTAAATGGTGAGGGG + Intergenic
1075987671 10:126801617-126801639 ATGGATAATTAGATAAAGTATGG - Intergenic
1077304069 11:1860259-1860281 ATGGATAATTGAATGATGGATGG + Intronic
1077304072 11:1860282-1860304 ATGGATAATTGAATGATGGATGG + Intronic
1078848207 11:15140732-15140754 AAGAAAAATTAGATGGGGCATGG - Intronic
1078857099 11:15215218-15215240 ATAGATAATTAGATTTTACATGG - Intronic
1080090622 11:28344199-28344221 ATGGAGAACTAAATGGTGCTTGG - Intergenic
1080239309 11:30108330-30108352 ATGGTTAAGTAGATTGTGAAAGG - Intergenic
1081765819 11:45609450-45609472 ATGGATACTTGGATGATGGATGG + Intergenic
1084545957 11:69815199-69815221 ATGGATAGGTGGATGGTGGATGG + Intronic
1084705126 11:70811653-70811675 ATGGATGAATAGATGATGGATGG - Intronic
1084705134 11:70811703-70811725 ATGGATAAATGAATGGTGGATGG - Intronic
1085052402 11:73386596-73386618 GTGCGTAATTAGAAGGTGCAAGG + Intronic
1085472364 11:76766575-76766597 AGGGATAATTTGAGGGTGCTGGG + Intergenic
1085805382 11:79631369-79631391 ATGTATAATTTTATGGTGTAAGG + Intergenic
1086153407 11:83638874-83638896 ATGGACACTTGGATGGAGCAAGG + Intronic
1088941013 11:114456183-114456205 ATGGAAAATTGGTTGTTGCAAGG + Intergenic
1089290380 11:117434228-117434250 ATGGATAATTGGATGGTAGGTGG - Intronic
1089419854 11:118323338-118323360 ATGGATGAATAGATGATGGATGG + Intergenic
1093065672 12:14655707-14655729 TAGGATAATTATATGGTGTATGG + Intronic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1099758052 12:86880470-86880492 ATGGATACTTTGAATGTGCAAGG - Intergenic
1102222970 12:111207046-111207068 ATGGATAAATGGATGGTGGTTGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1105249011 13:18679293-18679315 ATGGATAGTTAGATGGATAAGGG + Intergenic
1107292503 13:38871696-38871718 ATGGATAGTTGGATGGTCAATGG - Intronic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1109082613 13:57924967-57924989 TGGGATAATTTGTTGGTGCAGGG - Intergenic
1109228132 13:59722072-59722094 AGGGATAATTAGATGTTTTATGG - Intronic
1110985843 13:81967334-81967356 ATGGATAATTAAAAGATGAAAGG - Intergenic
1111223924 13:85244687-85244709 ATTGATTATTAGGTGGTCCATGG - Intergenic
1112133247 13:96547211-96547233 AAGAACAATTAGATAGTGCAGGG + Intronic
1112567939 13:100567249-100567271 ATGGTGAATGAGATGTTGCATGG - Intronic
1115748575 14:36464087-36464109 AAGGCTAATTAGATGGATCATGG + Intergenic
1116404972 14:44556427-44556449 ATGGATAACTACATGATGAATGG - Intergenic
1120706191 14:87748297-87748319 CTGGCTAATGAGATGGTGTAAGG - Intergenic
1122029898 14:98904717-98904739 ATGGATAAATAGACAGTGGATGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122910326 14:104824710-104824732 ATGGATGGTAAGATGGTGGATGG + Intergenic
1125001012 15:34769939-34769961 ATGGAAAATTACATGCTGGAAGG - Intergenic
1125977946 15:43972427-43972449 ATGGACAATAAGATGTGGCAGGG + Intronic
1126734593 15:51718159-51718181 ATAGATAGTTAGATGATGGATGG + Intronic
1127660434 15:61095581-61095603 ATGGAGAATGAGGTTGTGCAAGG + Intronic
1133612601 16:7447551-7447573 ATGGATAATGAGAAGGTGACTGG - Intronic
1134891311 16:17843977-17843999 CTGGATAATTACCTGTTGCAGGG + Intergenic
1137540361 16:49357467-49357489 TTGGATATTTTGATGCTGCAGGG + Intergenic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1138976609 16:62214929-62214951 ATGGCCAATTAGATGCAGCAGGG - Intergenic
1139172380 16:64647724-64647746 ATGGCCAATTAGATGGAGCTAGG + Intergenic
1139826157 16:69758856-69758878 ATGGATAATTAGGTGGCTCAGGG - Intergenic
1139982774 16:70872968-70872990 ATGGATGAGTAGATGATGGATGG - Intronic
1141319501 16:82994080-82994102 ATGGGTAATTAGATGGAGGGTGG - Intronic
1141658052 16:85426538-85426560 ATGGATGATTGAATGGTGGATGG + Intergenic
1141899305 16:86980085-86980107 ATAGATAGTTAGATGATGGATGG + Intergenic
1141899339 16:86980379-86980401 ATGGATAAATAGATGATAGAGGG + Intergenic
1142244761 16:88964981-88965003 ATGGATAAATAGATGGTGGGTGG - Intronic
1143815018 17:9506073-9506095 ATGGATTATTAGAGGGAGTAAGG - Intronic
1144103368 17:11963495-11963517 CTGGATTATTAGAGGGTGTAGGG + Intronic
1146596344 17:34172465-34172487 ATGGATAATTAGATGGACAGGGG + Intronic
1147356554 17:39902930-39902952 ATAAAAAATTAGATGGGGCATGG + Intergenic
1149381643 17:56100261-56100283 ATGGAAAATGAGATTGTGGAAGG + Intergenic
1149954558 17:61034108-61034130 ATGGAGAGTTAGACAGTGCAAGG - Intronic
1150900616 17:69272718-69272740 ATGGAAAATTACCTGGAGCATGG - Intronic
1153319389 18:3757420-3757442 ATAAATAAATAAATGGTGCAAGG + Intronic
1153613851 18:6915950-6915972 CTGGATAATTCTATGTTGCAGGG - Intergenic
1154439870 18:14379936-14379958 ATGGATAGTTAGATGGATAAGGG - Intergenic
1155203831 18:23540070-23540092 ATGGAGAATAAGAGGGTGCCAGG + Intronic
1155902972 18:31413626-31413648 ATTGATGATTACAAGGTGCAAGG - Exonic
1157993196 18:52522147-52522169 ATGGATAATTACATGGTCCAGGG + Intronic
1158140951 18:54255100-54255122 ATGGTGAAATAGATTGTGCAGGG - Intergenic
1158506075 18:58046296-58046318 ATGGAGAAGTAGAGGATGCAAGG - Intronic
1160692456 19:466252-466274 ATGGTTAGGTAGATGGTGGATGG + Intronic
1160692521 19:466493-466515 ATGGTTAGGTAGATGGTGGATGG + Intronic
1161105279 19:2440752-2440774 ATGGATAGATAGATGATGGATGG - Intronic
1161641119 19:5423916-5423938 ATGGATGATTGGGTGGTGGATGG - Intergenic
1161908855 19:7177681-7177703 ATACAAAATTAGATGGGGCATGG - Intronic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1162479274 19:10919298-10919320 ATGTATAATTAGATTGTCCGTGG - Intronic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163382641 19:16978969-16978991 ATAGATGATTGGATGGTGGATGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163609877 19:18295284-18295306 GTGGATGGGTAGATGGTGCATGG - Intergenic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1165190325 19:34057497-34057519 ATGGATAAATGGATGATGGATGG + Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
926732465 2:16046815-16046837 ATGTATACTTACATGGTGAAAGG - Intergenic
928305669 2:30168452-30168474 GTGGATAATTAGATGGCTGATGG + Intergenic
931794260 2:65694225-65694247 ATGGTTAATGAGATGGTGTGTGG + Intergenic
934607038 2:95703684-95703706 ATGGTTAAATAGTTGTTGCAGGG + Intergenic
935462398 2:103353757-103353779 ATGGATAATTGCTTGGGGCAGGG + Intergenic
935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG + Intergenic
936816621 2:116468883-116468905 ATGTTCAATTTGATGGTGCAAGG + Intergenic
937463265 2:122107967-122107989 ATGGTAAATCAGATGCTGCATGG - Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
939679296 2:145110468-145110490 ATGAATAAATAGATGATGAATGG + Intergenic
940247161 2:151632050-151632072 ATGGACAATTTCATTGTGCAGGG + Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
941870813 2:170383657-170383679 GTGGAGTATTAGATGGTCCAGGG + Intronic
945600075 2:211850648-211850670 ATGTATGATTAGAAGGAGCAAGG + Intronic
946173743 2:217910339-217910361 TGGGATGTTTAGATGGTGCAGGG - Intronic
947429445 2:230013236-230013258 ATGGAAAATGAGATGGGGGAGGG - Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
1168984470 20:2036341-2036363 AAGGATAAGTAGATGGTGTTTGG + Intergenic
1169888017 20:10423045-10423067 ATGGAGAAGTAAATGGTGAATGG - Intronic
1172849031 20:37947358-37947380 ATGGATAGATAGATGATGGATGG + Intergenic
1172853007 20:37980130-37980152 ATGAATAAGTAGATACTGCAAGG - Intergenic
1173976600 20:47191490-47191512 ATGGATTAGTGGATGGTGGATGG + Intergenic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175817391 20:61890448-61890470 ATGGATAAATGGATGATGGAAGG + Intronic
1176455875 21:6909835-6909857 ATGGATAGTTAGATGGATAAGGG + Intergenic
1176834049 21:13774883-13774905 ATGGATAGTTAGATGGATAAGGG + Intergenic
1177058435 21:16339067-16339089 TAGGATAATTAGCTGGAGCATGG + Intergenic
1178706828 21:34882541-34882563 ATAGCTAATTAGAGGGTGCTTGG - Intronic
1179715331 21:43283631-43283653 ATGGATGAATAGATGATGGATGG - Intergenic
1179715348 21:43283755-43283777 ATGGATGAATAGATGATGGATGG - Intergenic
1179715408 21:43284296-43284318 ATGGATGAATAGATGATGGATGG - Intergenic
1185018792 22:48361149-48361171 ATGGATAGATAGATGATGGATGG + Intergenic
1185018805 22:48361283-48361305 ATGGATGAGTAGATGATGGATGG + Intergenic
1185053519 22:48566102-48566124 ATGGATAGATAGATGATGGATGG + Intronic
1185146233 22:49138287-49138309 ATGGATGAGTAGATGATGGATGG - Intergenic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
951441132 3:22725480-22725502 ATGGATGAATAAATGGTGGATGG - Intergenic
952110145 3:30113345-30113367 ATGGAGAATGAGAAGGTGCTAGG - Intergenic
952327168 3:32331869-32331891 AGGGATAAAGAGAGGGTGCAAGG + Intronic
952621299 3:35346388-35346410 ATGGATAAAGAGAGAGTGCAAGG + Intergenic
952697070 3:36278256-36278278 ATGGAAGATTAGATGTTACAGGG + Intergenic
952747043 3:36791246-36791268 ATGGATAATTTGCAGGTGCCTGG - Intergenic
956604074 3:71053882-71053904 CTGGATAAATACATGTTGCATGG - Intronic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
957870613 3:86086704-86086726 ATGGAAAATTATATGGTAAATGG + Intergenic
958955523 3:100461803-100461825 ATGATTAATTAGATGGAGAATGG - Intergenic
959524159 3:107357377-107357399 ATGGATAAAAAGGTGGTGTAGGG + Intergenic
960010017 3:112823525-112823547 TTGGAGAATTAGTTGGTGTAGGG + Intronic
960195929 3:114768037-114768059 ATGGATAATTAGATGGTGCAGGG - Intronic
962695397 3:137942745-137942767 ATGGATAATTAGAAGGCTGAAGG - Intergenic
965384436 3:168029258-168029280 ATGGATAATGATATCGTTCAGGG - Exonic
968039857 3:195579747-195579769 ATGCATAATTAGGTGGGACAGGG - Intronic
969510736 4:7616373-7616395 ATGGATGAGTGGATGGTGAATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
970365656 4:15355484-15355506 ATAGATATTGAGATCGTGCACGG + Intronic
972685439 4:41348255-41348277 ATGGAGAATTAGGTAGGGCATGG - Intergenic
973224893 4:47772471-47772493 ATGGATGATTTTATGGGGCAAGG - Intronic
973814160 4:54603516-54603538 AAGGAAAATTAGATAGTACATGG + Intergenic
973902364 4:55489033-55489055 ATGGATAAATGGATAGTGTAAGG - Intronic
975401339 4:73943294-73943316 GTGAATAATTAGATGGATCAGGG - Intergenic
977194427 4:94041972-94041994 ATGGCTAATTGTTTGGTGCAAGG + Intergenic
981578316 4:146227713-146227735 ATGGGAAATTAGATGGTGGAGGG + Intronic
982066629 4:151660135-151660157 ATGGAGAATTTGATGGTGCTTGG + Intronic
983770262 4:171540140-171540162 ATGGATAGATAGATGATGGATGG - Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
983832136 4:172340754-172340776 ATGGAGAATTAGGTGGAGTATGG - Intronic
985583021 5:709867-709889 AGGGATGATTATATGTTGCAAGG + Intergenic
985596700 5:795118-795140 AGGGATGATTATATGTTGCAAGG + Intergenic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
988190323 5:27922123-27922145 ATGGATATATATATAGTGCAAGG - Intergenic
988214408 5:28252651-28252673 ATAGATAATTAGACAGGGCAGGG - Intergenic
994784063 5:104132956-104132978 ATGGATGACTAGATGGAGCCAGG - Intergenic
996372548 5:122768700-122768722 ATGGATACTTGGACAGTGCAGGG + Intergenic
996750711 5:126885894-126885916 ATGGAAAAATAGATGTTCCATGG - Intronic
999903563 5:156114003-156114025 AGGGATAAATAGATGGAGCCAGG + Intronic
1000051123 5:157563678-157563700 ATGGCTAAGTAGATGGGGAATGG + Intronic
1002470339 5:179431244-179431266 ATGGATTCTTAATTGGTGCAGGG - Intergenic
1002655442 5:180743037-180743059 GGGGATCATCAGATGGTGCAAGG - Intergenic
1002658961 5:180777532-180777554 ATGGATGATTGGGTGGTGGATGG - Intergenic
1011622404 6:89255474-89255496 ATGGGTAATTGGGTGGTACAGGG - Intergenic
1016788288 6:148037404-148037426 ATGGATAATGAAATGCTGAATGG + Intergenic
1017555313 6:155558708-155558730 ATGGTTAATAAGATGGTGTCAGG - Intergenic
1018753950 6:166831889-166831911 ATGGATAGATAGATGATGGATGG + Intronic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019777424 7:2920662-2920684 ATGGATACATAGATGATGGATGG - Intronic
1019949051 7:4356147-4356169 ATGGATAATTTTATGTTACATGG - Intergenic
1025956734 7:66188833-66188855 ATAGATAAATAGATGATGGATGG - Intergenic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1027112883 7:75454768-75454790 ATGGATAAAGAGATGGCACACGG + Intronic
1027285129 7:76639379-76639401 ATGGATAAAGAGATGGCACACGG + Intergenic
1030545870 7:110894275-110894297 ATTGTTAATTAGATACTGCAAGG + Intronic
1030814086 7:114012880-114012902 ATGGAAACTAAGATTGTGCAAGG - Intronic
1034352152 7:150423675-150423697 AGGGATAAATAGGTGGAGCACGG - Intergenic
1034688046 7:152991009-152991031 ATAGATAAATAGATGATGGATGG - Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1038628003 8:29212914-29212936 ATGTATAATCAGATGGCACATGG + Intronic
1040584391 8:48726252-48726274 ATGGATAGATAGATGATGGATGG - Intronic
1042309248 8:67363884-67363906 ATGGGTAATTACATGATTCAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044928366 8:97228533-97228555 ATGGATAACTAGAAGTTGGAAGG - Intergenic
1045052451 8:98339641-98339663 ATGTATGATTTGATGTTGCAGGG + Intergenic
1047306935 8:123659973-123659995 ATGGATGAATAGATGATGGATGG - Intergenic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049364258 8:142229114-142229136 ATGGATAAATGGATGGTGGGTGG + Intronic
1050583319 9:7083953-7083975 ATGGAGAATTATAGTGTGCAGGG + Intergenic
1050702889 9:8360930-8360952 ATGGATTATTAATTGATGCAGGG - Intronic
1050983153 9:12046435-12046457 ATGGATAATTTGGTGGTCAAGGG - Intergenic
1054778718 9:69146827-69146849 CTGGATAATTCGTTGTTGCAGGG - Intronic
1058218562 9:102266323-102266345 ATAGATAGATAGATGGTGCTGGG + Intergenic
1059525066 9:114983868-114983890 CTGGATAATTCTATGTTGCAGGG + Intergenic
1059924926 9:119199496-119199518 ATGGGTAATTACATTGTGCTTGG + Intronic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1061980992 9:134103562-134103584 ATGGATGGTTGGATGGTGAATGG - Intergenic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1062248068 9:135579910-135579932 ATGGATAATGAAAGGGTGGATGG - Intergenic
1185498679 X:580688-580710 ATGGATAAATAGATGATAGATGG + Intergenic
1185498683 X:580749-580771 ATGGATAAATAGATGATAGATGG + Intergenic
1185498692 X:580892-580914 ATGGATAAATAGATGATAGACGG + Intergenic
1185498701 X:581035-581057 ATGGATAAATAGATGATAGACGG + Intergenic
1185498708 X:581152-581174 ATGGATAAATAGATGATAGATGG + Intergenic
1185611433 X:1395688-1395710 ATGGATAATTGGATGGGTAATGG + Intergenic
1185611473 X:1395881-1395903 ATGGATAATGAGTGGGTGGATGG + Intergenic
1185611524 X:1396192-1396214 ATGGATAATTGGATGGGTAATGG + Intergenic
1185625072 X:1475307-1475329 ATGGATGAATAGATGATGCATGG + Intronic
1185780559 X:2840942-2840964 ATGGATAGATAGATGATGGATGG + Intronic
1186955865 X:14681423-14681445 GTGGATAAATACATGGTGGATGG - Intronic
1192921586 X:75712981-75713003 AAGGAAAATTAGATGGTGGGTGG + Intergenic
1193092909 X:77513362-77513384 ATGGATGACTAGATGCAGCAAGG + Intronic
1193553587 X:82928559-82928581 ATTGATAATTTGAGGATGCAGGG + Intergenic
1194029768 X:88798081-88798103 ATGTATTTTTAGATGGTACATGG - Intergenic
1198228126 X:134665414-134665436 ATGGATAAATACATTGTGCTGGG - Intronic
1198272470 X:135067549-135067571 ATGGTTAATTAGGAGGTCCAGGG - Intergenic
1198614503 X:138441431-138441453 ATGGTTAAGTAACTGGTGCATGG + Intergenic
1198626766 X:138584264-138584286 ATGGATCATTAGATTTGGCAAGG - Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1201245112 Y:11995865-11995887 ATAGATAAATAGAAGATGCATGG + Intergenic
1201289494 Y:12408923-12408945 ATGGATAGATAGATGATGGATGG - Intergenic
1201289501 Y:12409055-12409077 ATGGATAGATAGATGATGGATGG - Intergenic
1202248353 Y:22842703-22842725 ATGGATAATGACATATTGCAAGG + Intergenic
1202401341 Y:24476451-24476473 ATGGATAATGACATATTGCAAGG + Intergenic
1202469439 Y:25193635-25193657 ATGGATAATGACATATTGCAAGG - Intergenic