ID: 960195976

View in Genome Browser
Species Human (GRCh38)
Location 3:114768763-114768785
Sequence CTTCCCTCGCTTATGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960195976_960195978 30 Left 960195976 3:114768763-114768785 CCTTTTTTCATAAGCGAGGGAAG 0: 1
1: 0
2: 2
3: 11
4: 113
Right 960195978 3:114768816-114768838 AATATCACAAATCTAACATGTGG 0: 1
1: 0
2: 3
3: 31
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960195976 Original CRISPR CTTCCCTCGCTTATGAAAAA AGG (reversed) Intronic
901826421 1:11864685-11864707 CTCCCCTTGCTTAGGAACAAGGG + Intergenic
903876171 1:26474561-26474583 CTTCTCTCCCTTCTGAAAAAGGG - Exonic
904705606 1:32388225-32388247 CTTCCCAAGCTAATGAAAAGTGG - Intronic
904907667 1:33910212-33910234 CCTCTCTGGCTTATGAACAAGGG + Intronic
911416113 1:97576938-97576960 TTTCCCTTTCTTATGTAAAATGG - Intronic
911567342 1:99478496-99478518 CTTCACTCATTTTTGAAAAATGG - Intergenic
916297476 1:163235630-163235652 CAGCCATTGCTTATGAAAAAAGG - Intronic
917844930 1:179012817-179012839 CTGCCCTCTCATATGAAAAATGG + Intergenic
917872376 1:179253604-179253626 CTTCACTCACATAAGAAAAATGG + Intergenic
918198175 1:182242242-182242264 CTCCCCTAGCTTCTGAAAACTGG - Intergenic
922430163 1:225543893-225543915 CTTACCTAGATTATGAAAACAGG + Intronic
923512907 1:234668174-234668196 CTTCCCGTGCTTATGAACACTGG + Intergenic
1069359397 10:67624448-67624470 CTCCCCTCCTCTATGAAAAAGGG + Intronic
1071560935 10:86646483-86646505 TTTCCCTCCATTATGAACAAGGG - Intergenic
1073233632 10:101994437-101994459 CTTTTCTCTCTTAAGAAAAATGG - Intronic
1077583012 11:3429296-3429318 GTTCCCTCGATGCTGAAAAAAGG - Intergenic
1087329372 11:96760573-96760595 TTTTCCTCACTTATGAAAAAGGG + Intergenic
1090541573 11:127711919-127711941 CTCCCCTAGCTTATTAAATATGG + Intergenic
1091220698 11:133928451-133928473 CTTCCCTCGCTGCTGAGAAGTGG + Intronic
1091363210 11:134994622-134994644 CCTCCCTCCTTTGTGAAAAAGGG - Intergenic
1093370814 12:18362945-18362967 CATCCCTTGCTTTTAAAAAAAGG - Intronic
1093390147 12:18608784-18608806 TTTCCATTGCTTATGAAAAAAGG - Intronic
1093474961 12:19544523-19544545 CATCCCAGGCTTATGAACAAGGG - Intronic
1094018507 12:25889231-25889253 CCTCCCTCTCCTCTGAAAAAAGG - Intergenic
1095229126 12:39716147-39716169 GTTCCCTTGTTTATGAAAATGGG - Intronic
1098611918 12:72469088-72469110 ATTCCCTCACCTATGAAATAAGG - Intronic
1100190028 12:92180405-92180427 CCTCCTTCCCCTATGAAAAAGGG + Intergenic
1100683160 12:96952318-96952340 TTTTCTTCTCTTATGAAAAAGGG - Intronic
1104019108 12:124980097-124980119 CTTCCCGCGCATCTGTAAAATGG - Intronic
1106847869 13:33756177-33756199 CTTCCCTCCTTTATGATAACTGG + Intergenic
1108960031 13:56215141-56215163 CTTCCTTTGCTTATTAAAGAAGG + Intergenic
1113024694 13:105927893-105927915 CTTCTCTCAAATATGAAAAAGGG - Intergenic
1119762503 14:77161338-77161360 CTACCCTCGGTTAGGAACAAGGG + Intronic
1138618122 16:58188346-58188368 GCTCCCTCGTTAATGAAAAAGGG - Intronic
1140549875 16:75854355-75854377 CTTTTCTGGCTTATGCAAAAGGG - Intergenic
1143476483 17:7206358-7206380 CTCCCCTCTCTTCTGAAAATTGG + Intronic
1143736708 17:8916356-8916378 CTTGCCCAGCTTTTGAAAAAAGG - Intronic
1156783256 18:40877937-40877959 CTTCCCTGGCATAAGAAACAGGG - Intergenic
1158861733 18:61599031-61599053 CTTCCCTCCCCTAAGGAAAAGGG + Intergenic
1160619059 18:80157714-80157736 CTTCTCTTGCTTAGGAACAAAGG + Exonic
925477765 2:4237431-4237453 CTTACCTGGCTTATGAAAAAAGG + Intergenic
925649845 2:6078227-6078249 CTTCCCTCCCTTAGGTAACAGGG + Intergenic
929689434 2:44062168-44062190 CCCCCCTCCCTTATGAAAAAAGG + Intergenic
935651583 2:105386711-105386733 CCGCCCTAGCTAATGAAAAAAGG - Intronic
938038416 2:128055546-128055568 CCTCCCTCCCCTATGAAAAAGGG + Intergenic
943586267 2:189744280-189744302 CTTCCCTGGCTTATAAAATTAGG - Intronic
946442813 2:219711199-219711221 CTTTCCTAGCTTCTGGAAAAAGG + Intergenic
1170493710 20:16904058-16904080 CTTCTCTTGCATATCAAAAAGGG - Intergenic
1170978932 20:21192737-21192759 CTCCCCTCCCCTATGAAGAAGGG - Intronic
1175488375 20:59362137-59362159 GTTCCCTCATTTATGAAAAGGGG - Intergenic
1176071571 20:63229430-63229452 CTCCCCTCCCTGATGAAGAAGGG + Intergenic
1184913690 22:47552487-47552509 CCTCCCTCGCTAATGAAACCCGG - Intergenic
951753882 3:26067903-26067925 CTTGCCTCACTTAAGAAAAAAGG + Intergenic
954999011 3:54909487-54909509 TTTCCCTCCCTTGGGAAAAAAGG + Intronic
955698648 3:61661236-61661258 CTCCCCTCACTTAAAAAAAATGG + Intronic
955956361 3:64293777-64293799 CTTCCCTCTTTTATGATAAATGG - Intronic
956371407 3:68566405-68566427 ATTCCCTCACTCCTGAAAAATGG - Intergenic
956420997 3:69086007-69086029 CTTCTCTCGCTTATGCAGGATGG + Intronic
958055229 3:88401987-88402009 CTTTCCTTGCTTTTGAAAGAGGG + Intergenic
959324666 3:104921321-104921343 CTTCCATGGCTTAAGAAGAAGGG - Intergenic
959914718 3:111803735-111803757 CTTCCCTCAGCTATAAAAAATGG + Intronic
960195976 3:114768763-114768785 CTTCCCTCGCTTATGAAAAAAGG - Intronic
962576182 3:136757036-136757058 CCCCCTTCCCTTATGAAAAAGGG + Intergenic
966485458 3:180464187-180464209 CTTACCTCCATTATGAAAATTGG + Intergenic
969456688 4:7304293-7304315 CCCCCGTCGCTAATGAAAAAGGG - Intronic
969562556 4:7958929-7958951 CCACCCTCCCCTATGAAAAAGGG + Intergenic
969815680 4:9685634-9685656 GTTCCCTCGATGCTGAAAAAAGG + Intergenic
980415040 4:132476574-132476596 CCTCCCTAACTTATGAAAATAGG + Intergenic
982177742 4:152722158-152722180 CTTCCCTCACCTATAAAACAAGG + Intronic
982307568 4:153948989-153949011 CTTCCCTCACTTTTCCAAAAAGG - Intergenic
982610875 4:157573669-157573691 TTTCCCTCCTTTATGAATAATGG - Intergenic
983859168 4:172683340-172683362 CTTCCCTTGATAATGAGAAATGG + Intronic
984730562 4:183064579-183064601 CTTCCCTAGCATGTGAAAAGGGG + Intergenic
987018086 5:13841257-13841279 TTTCCATAGGTTATGAAAAAAGG - Intronic
990557911 5:56953061-56953083 CTTCCCTCACTTCTCCAAAAAGG + Intronic
990808379 5:59693243-59693265 CTGGCACCGCTTATGAAAAAGGG - Intronic
993533844 5:89056794-89056816 TTTCCTTTCCTTATGAAAAAAGG + Intergenic
993833024 5:92782874-92782896 CCTCCCTCCCCTATGAAGAAAGG + Intergenic
995242859 5:109904654-109904676 CTTCACTCTCTTATTACAAATGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
1000605773 5:163326126-163326148 CTTTCCTCAATTATGAAAGATGG - Intergenic
1001300314 5:170528774-170528796 CTTCCTTCCCAAATGAAAAATGG - Intronic
1003234524 6:4283663-4283685 CTTCCCCTGCTAAGGAAAAATGG + Intergenic
1007797325 6:44360345-44360367 TTGCCCTCGCTTATGAGAACTGG - Intronic
1008023310 6:46604722-46604744 GTTCACTCAGTTATGAAAAATGG - Intronic
1010507418 6:76677336-76677358 CTGCCCTCCTTTATGAAAGACGG + Intergenic
1011630327 6:89316973-89316995 CATCTCTTCCTTATGAAAAAGGG - Intergenic
1015239047 6:131003785-131003807 CTGCCCATGCTTTTGAAAAAAGG - Intronic
1017523901 6:155226173-155226195 TTTTCATCGCTTATGAAGAATGG - Intronic
1018659130 6:166068759-166068781 CCTCCCTCACTTATTAAATAAGG + Intergenic
1023154496 7:37234654-37234676 CTTTCCTCATTTATTAAAAATGG + Intronic
1023852262 7:44157091-44157113 GTTTCCTCACTTATAAAAAAAGG - Intronic
1024378386 7:48665300-48665322 CTTCCCCCCCATATGAAAAAAGG + Intergenic
1026060914 7:67025166-67025188 CTCACCACGCTCATGAAAAATGG - Intronic
1026717453 7:72802234-72802256 CTCACCACGCTCATGAAAAATGG + Intronic
1028505118 7:91561907-91561929 CTACCCTCGCTGATGTAAAATGG + Intergenic
1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG + Intronic
1030222487 7:107111070-107111092 CTTCAGTCGCTTATGATGAAGGG - Intronic
1030470585 7:109958197-109958219 CTTCCCTGGCTTACAAAAGATGG - Intergenic
1031798826 7:126215420-126215442 GTTCCCAGGTTTATGAAAAATGG - Intergenic
1032259005 7:130319614-130319636 CCTCCCTCCTGTATGAAAAAGGG - Intronic
1034149943 7:148907159-148907181 CTTCCCTTGCTTAGAGAAAATGG - Intergenic
1035003540 7:155637228-155637250 CTTATCTCACTTATGGAAAAAGG - Intronic
1035586924 8:783712-783734 CTTCCCCCTCTTATGAAAGAGGG + Intergenic
1038483298 8:27916617-27916639 CTACCCTGGCTTTTGAACAAGGG - Intronic
1039193196 8:35000545-35000567 ATTCCCAGGCTTTTGAAAAAGGG - Intergenic
1042384291 8:68154863-68154885 CTCCCATCGCCTATGAAGAAGGG - Intronic
1044233064 8:89801181-89801203 CTTCCCTCCCCTATGAAAAAGGG + Intergenic
1046412392 8:113863120-113863142 TTTCCCTGGCCTATTAAAAATGG - Intergenic
1048704635 8:137139347-137139369 GTTCCCTTGCTTGTTAAAAATGG + Intergenic
1052729027 9:32263861-32263883 TTCCCTTCACTTATGAAAAAGGG - Intergenic
1055624632 9:78163211-78163233 CTATTCTGGCTTATGAAAAAAGG + Intergenic
1056527652 9:87458143-87458165 GTTTCCTCACTTATGAAATAAGG - Intergenic
1056845745 9:90036662-90036684 CTTCTCTCACTTATGCTAAATGG + Intergenic
1059139443 9:111838460-111838482 CTCCCCGATCTTATGAAAAATGG - Intergenic
1061763083 9:132863857-132863879 CTTCCCTCTCCTATGGGAAAAGG + Intronic
1185431062 X:12339-12361 CTTCTCTAGTTTATGAAACAGGG + Intergenic
1185440328 X:224736-224758 CTTCTCTAGTTTATGAAACAGGG + Intergenic
1186614554 X:11173048-11173070 CTTCCCTCGTCTATAAAATAGGG - Intronic
1187378457 X:18778666-18778688 CTTCCTTCTCTTCTGAAAAGAGG - Intronic
1187567136 X:20462022-20462044 CTTCCCTGTCTTTTAAAAAATGG + Intergenic
1188138510 X:26519920-26519942 CTTCCCTCACATTTGAGAAAAGG + Intergenic
1190370556 X:49736418-49736440 CAACCCTCCCTTATGTAAAATGG - Intergenic
1195484974 X:105393881-105393903 GTTTCCTCACTTATGAAATAGGG - Intronic
1196018467 X:110964711-110964733 TTTCCCTCACAAATGAAAAATGG + Intronic
1200946689 Y:8848044-8848066 CATCCCTCTCTAATGATAAAGGG - Intergenic
1201505068 Y:14689556-14689578 CATTCCTCTCTTATGAAAAGAGG + Intronic