ID: 960196864

View in Genome Browser
Species Human (GRCh38)
Location 3:114779168-114779190
Sequence GTGTTAAAGCAAATAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960196864_960196867 10 Left 960196864 3:114779168-114779190 CCTTGTTCTATTTGCTTTAACAC 0: 1
1: 0
2: 1
3: 25
4: 371
Right 960196867 3:114779201-114779223 TAACTTATCTTTAGAAGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 160
960196864_960196865 5 Left 960196864 3:114779168-114779190 CCTTGTTCTATTTGCTTTAACAC 0: 1
1: 0
2: 1
3: 25
4: 371
Right 960196865 3:114779196-114779218 ACACCTAACTTATCTTTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960196864 Original CRISPR GTGTTAAAGCAAATAGAACA AGG (reversed) Intronic
901488670 1:9584030-9584052 GTTTTAAAGCAAATTTAATAAGG + Exonic
902240337 1:15084099-15084121 CTGTCAAAACAAGTAGAACAGGG + Intronic
904076363 1:27845678-27845700 GACTTAAAGCAAATAAACCAGGG + Intronic
905541886 1:38766457-38766479 GTATTAAAGCACAAAGAGCAGGG + Intergenic
905942133 1:41872502-41872524 GTGTTAAAGCAAACTGCATATGG - Intronic
906313200 1:44768499-44768521 GTGTTAAAAAAAAAAGAAGATGG + Intergenic
906399096 1:45491568-45491590 TTGATAAAGCCAATAGAAAATGG + Intergenic
907941606 1:59093586-59093608 GTGCTAGGGCAAATAGAGCAAGG + Intergenic
908733652 1:67253082-67253104 GTGTTAAAGCAAACTAAATATGG - Intronic
908928809 1:69290694-69290716 AAGTTAAAGCACATAAAACAAGG - Intergenic
909954182 1:81757306-81757328 GTGTTAAAGCAAACTAAATATGG + Intronic
910312691 1:85843095-85843117 GTCTCAAAACAAATAGAAGATGG + Intronic
911158680 1:94660932-94660954 ATGTTAAAGGAAAAGGAACAGGG + Intergenic
911513947 1:98843996-98844018 GTGTTAAGTTAAATATAACAAGG - Intergenic
912019127 1:105082960-105082982 GTGTAAAGGAAAATAGAATATGG + Intergenic
912033454 1:105280260-105280282 GTGAGAAAGAAAATAGGACAAGG + Intergenic
912478242 1:109956806-109956828 GAGAGAAAGCAAATACAACATGG + Intergenic
915709480 1:157881219-157881241 GTGTATAAGCAAATAAAATAGGG - Intronic
915808040 1:158875936-158875958 CTGTTAAAGCAAACTAAACATGG - Intergenic
916545493 1:165800378-165800400 GTGTTAAAGCAAACTAAATATGG + Intronic
919160058 1:193817466-193817488 GTGTTAAAGCAAACTAAATATGG - Intergenic
919224430 1:194676799-194676821 GTGTGAAGGCAAATATAAAACGG - Intergenic
920571875 1:207023614-207023636 TTGTAAAAGCAAAGAAAACAAGG - Intronic
921429403 1:215046437-215046459 GTATTTAAGCATATAGAACTTGG + Intronic
922203322 1:223425374-223425396 GTGTGAAAGAAACTAGCACAAGG - Intergenic
923783422 1:237044967-237044989 TTTTTAAAGCAAATAGCCCAAGG + Intronic
924466353 1:244302197-244302219 GAGTAAAACCAAATAGAAAAAGG - Intergenic
1063802960 10:9602457-9602479 GGGTTAAAACAAAAAGAACCTGG + Intergenic
1064302527 10:14135161-14135183 GTGTTAAAGCAAACTTAATATGG + Intronic
1065457911 10:25926878-25926900 ATGTGAAAATAAATAGAACAGGG - Intergenic
1066179545 10:32946629-32946651 GTGCTAAAGCAAATGAAACAAGG + Intronic
1067953436 10:50766272-50766294 TTGTTAAAGCATCTGGAACATGG + Intronic
1069176318 10:65293257-65293279 GTGTTAAAGCAAACTAAAAATGG + Intergenic
1069374948 10:67784310-67784332 GTGTTAAAGCAAACTAAACATGG + Intergenic
1070554598 10:77517897-77517919 GTGTTAAGACAAATATAAGATGG + Intronic
1070963839 10:80517559-80517581 GGGTTAAACCAAAAATAACAGGG - Intronic
1074860645 10:117507535-117507557 GAGATAAAGCACTTAGAACAGGG + Intergenic
1075791689 10:125089046-125089068 CTATTAAAGAAATTAGAACATGG - Intronic
1076407045 10:130219363-130219385 GTGTTAAATCAAACTAAACATGG + Intergenic
1077581645 11:3421044-3421066 GCTTTAAAGCCAATAAAACAGGG - Intergenic
1077878808 11:6331180-6331202 GTGTTAAAGCAAACTAAATATGG - Intergenic
1078796945 11:14601569-14601591 GGCTTAATGTAAATAGAACAAGG + Intronic
1079523066 11:21351791-21351813 GTGTTAAGAAAAATAGAACTTGG - Intronic
1079892060 11:26068095-26068117 TTGTTAAAGCAAATTAAATATGG - Intergenic
1080311559 11:30898972-30898994 GTGTTAAAGAGAATGGAAGAAGG + Intronic
1080711147 11:34749120-34749142 GTGTTGTAGGAAAGAGAACAAGG + Intergenic
1081230269 11:40577768-40577790 GTTTTAAAGGATGTAGAACAGGG - Intronic
1082879036 11:58020196-58020218 GTGTTAAAGCAAACTAAATATGG + Intergenic
1082966378 11:58970095-58970117 GTGTTAAAGCAAACTAAATATGG + Intronic
1082972716 11:59040636-59040658 GTGTTAAAGCAAACTAAATATGG + Intronic
1082977172 11:59084533-59084555 GTGTTAAAGCAAATTAAATATGG + Intergenic
1083140847 11:60720218-60720240 GTGTTAAAGCAAACTAAATATGG - Intergenic
1084238555 11:67803866-67803888 GCTTTAAAGCCAATAAAACAGGG - Intergenic
1084833860 11:71788967-71788989 GCTTTAAAGCCAATAAAACAGGG + Intronic
1086236795 11:84641094-84641116 GTGTTAAGGAAAAGAGACCATGG - Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087797415 11:102469170-102469192 GTGTTAAAGCAAACTAAACGTGG - Intronic
1088102697 11:106172529-106172551 TTTTTAAAGCAAAGGGAACAAGG - Intergenic
1088331232 11:108654581-108654603 GTGTTAAAGCAAACTAAATATGG - Intergenic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1088953538 11:114595097-114595119 GAGTTTAAGGGAATAGAACAGGG - Intronic
1089704825 11:120270392-120270414 GTGTAAAATCAAATAGAAATAGG + Intronic
1089865123 11:121624934-121624956 GTGGTAATGTAAAAAGAACAAGG + Intronic
1090441433 11:126728399-126728421 GTGTTAAAGCATGTTGACCATGG + Intronic
1092409243 12:8241491-8241513 GCTTTAAAGCCAATAAAACAGGG - Intergenic
1092885029 12:12917427-12917449 GAGTTAATGCAACTAGATCAGGG + Exonic
1093434771 12:19123876-19123898 ATGTGAAAGGAAAAAGAACAAGG - Intergenic
1096430848 12:51541652-51541674 GTGTTTTAGCCAATAGAACATGG + Intergenic
1098502102 12:71205214-71205236 CTGTTAAAGCAAACTAAACATGG + Intronic
1098540075 12:71645169-71645191 GTGTGAAGGCAAATATGACAAGG + Intronic
1099168303 12:79334623-79334645 GGGTTGCAGGAAATAGAACAAGG - Intronic
1099742471 12:86658175-86658197 GTGTTAAATCAAATATAACTTGG + Intronic
1100057187 12:90526031-90526053 ATGTGATAGAAAATAGAACAAGG - Intergenic
1100578837 12:95919511-95919533 CTGTTAAAGCAAACTAAACATGG - Intronic
1100702360 12:97161831-97161853 GTGTTAAAGCAAACTAAATATGG + Intergenic
1101545993 12:105713301-105713323 GTGTTAAAGCAAACTAAATATGG + Intergenic
1102683071 12:114703574-114703596 TTGTTAAAGCAAAGCAAACAAGG - Intergenic
1102791442 12:115649726-115649748 GTCTTAATGCAAATGGAAGATGG - Intergenic
1102829592 12:115984875-115984897 TTTTTAAAGTAAATAGGACAAGG + Intronic
1104283600 12:127401905-127401927 GTGTTAAAGCAAACTAAATATGG - Intergenic
1104303644 12:127589641-127589663 GTGTTAGAGCAAAGATCACAAGG - Intergenic
1104310426 12:127649796-127649818 GTGTTGAAGCAAACTAAACATGG + Intergenic
1104543957 12:129694421-129694443 GTGTTAAAGCAAAATAAATATGG + Intronic
1104985936 12:132597352-132597374 GTTTTTCACCAAATAGAACAAGG - Intergenic
1105346252 13:19575249-19575271 GGGTTGAAGAAAATAGAAAAAGG + Intergenic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1107568422 13:41630425-41630447 GTGTTCAAGCAGAAAGAAGAAGG - Intronic
1107775840 13:43840202-43840224 GTGTTAAAGCGAACAAAATATGG - Intronic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1108283255 13:48880344-48880366 GTGTTAAAGCAAACTAAATATGG + Intergenic
1108390126 13:49938713-49938735 GTGTTAAAGCAAACTAAATATGG - Intergenic
1109296991 13:60545769-60545791 GTATTAAAGCAAATGGAAAAAGG + Intronic
1109689696 13:65869700-65869722 GTCTTAAAGTTAATAAAACAGGG - Intergenic
1109925883 13:69138069-69138091 GTATTAGTGGAAATAGAACATGG + Intergenic
1110403836 13:75125914-75125936 ATGGTAAAGCAAATAGTACTGGG + Intergenic
1110757078 13:79187964-79187986 GTTTTGAGCCAAATAGAACATGG - Intergenic
1111649562 13:91072328-91072350 CATTTAAAGCAAATAGAAAATGG - Intergenic
1111657483 13:91171828-91171850 GTCTTAAAGAATATAGAAGATGG - Intergenic
1111841113 13:93452717-93452739 GTGTTTATTCAAACAGAACATGG + Intronic
1112595154 13:100801196-100801218 TTGTTAAAGCAAACTAAACATGG - Intergenic
1113336808 13:109384366-109384388 TTGTTAAAGCAAACTGAAGATGG + Intergenic
1116165652 14:41331156-41331178 GTCTCTAAGAAAATAGAACAAGG + Intergenic
1116585957 14:46704723-46704745 TAGTTAGAGCAAATAGCACATGG + Intergenic
1117502373 14:56366075-56366097 GTGTTAAAGCAAACTAAATATGG - Intergenic
1118261995 14:64256436-64256458 GTGTTAAAGCAGATCGGGCATGG + Intronic
1118841188 14:69513648-69513670 GTGTTAAAGCAAAATAAATATGG - Intronic
1119591657 14:75894187-75894209 GTGTTCAAACCAATAGAGCAGGG + Intronic
1119973096 14:78994343-78994365 GTGTTAAACCAAACAAAGCAGGG - Intronic
1120349638 14:83338464-83338486 ATTTTAACGAAAATAGAACAAGG + Intergenic
1121213144 14:92224466-92224488 GTGTTAAAGCAAACTAAATACGG + Intergenic
1121228266 14:92337534-92337556 GTGTTAGAGCTCAAAGAACATGG + Intronic
1121969928 14:98346738-98346760 GTGATAAAGCATATTGACCATGG + Intergenic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1202928001 14_KI270725v1_random:10703-10725 TTTCTAAAGCAAATAAAACAAGG + Intergenic
1123509753 15:20985264-20985286 GTGTTAAAGCAAACTAAATATGG + Intergenic
1123566973 15:21559003-21559025 GTGTTAAAGCAAACTAAATATGG + Intergenic
1123603237 15:21996296-21996318 GTGTTAAAGCAAACTAAATATGG + Intergenic
1124025767 15:25964145-25964167 GTGTTAAAGAATATATAACAGGG - Intergenic
1126334099 15:47567397-47567419 ATGTTAAAGGACATAGTACATGG + Intronic
1126486821 15:49190572-49190594 TTGTTAAAGCAAATTAAATATGG + Intronic
1127430902 15:58907245-58907267 GTGCAAAGGCAAATAGAAAAAGG + Intronic
1127500799 15:59552463-59552485 GTGTTAAAGCAAACTAAATATGG - Intergenic
1128531522 15:68452456-68452478 ATGTTAAACAAAAGAGAACAGGG + Intergenic
1128848068 15:70919027-70919049 CTGTTAAAGAAAATAGGAGAAGG - Intronic
1128959097 15:71981747-71981769 GTGTGAAAACAAATATACCATGG - Intronic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1130644836 15:85715115-85715137 TTGTTAAAGTAAATACAACTTGG + Intronic
1202975333 15_KI270727v1_random:286097-286119 GTGTTAAAGCAAACTAAATATGG + Intergenic
1133350214 16:5096294-5096316 GCTTTAAAGCCAATAAAACAGGG - Intronic
1133560160 16:6943297-6943319 GTGTTAAAGCAAACCAAATATGG + Intronic
1133566884 16:7004347-7004369 GGGTAAAAGCAAAGACAACATGG + Intronic
1134354813 16:13471861-13471883 GTGTTATAGCAAGAAAAACAAGG + Intergenic
1137658226 16:50179852-50179874 CTGTTAAATCAAATAAAACCAGG + Intronic
1138810271 16:60140841-60140863 ATGTAAAAGCAACCAGAACAAGG + Intergenic
1140832370 16:78763910-78763932 GTGCTAAAGGAAATAGAAGAGGG - Intronic
1140966185 16:79968302-79968324 GTGCTTGAGCAAAGAGAACAAGG - Intergenic
1141279103 16:82614542-82614564 CTGTTCCAGGAAATAGAACAGGG - Intergenic
1146448593 17:32953500-32953522 GTGTTAAAGCAAATTAAATATGG - Intergenic
1147930180 17:43974761-43974783 GAGTTACAGCAAATTGAAAAAGG + Intronic
1148514069 17:48199716-48199738 TTGAAAAAGCAAATAGAAAAAGG + Intronic
1149636571 17:58175407-58175429 GTGTTAAAGCAAGGTGAAGAGGG - Intergenic
1149730487 17:58941380-58941402 TTTTTAAAGGAAATAGAATAAGG - Intronic
1150680302 17:67279141-67279163 GTGTTAAAGCAAACTAAATATGG + Intergenic
1150935854 17:69634706-69634728 ATGGTAAAGTAAATAGATCATGG - Intergenic
1152047993 17:77951161-77951183 ATGTTACAGAAAAGAGAACAAGG + Intergenic
1152993163 18:381079-381101 ATGTCAAAGCAAACAGAACCAGG + Intronic
1153174861 18:2359468-2359490 GTGTTAAAGCAAACTAAATATGG + Intergenic
1154365779 18:13707618-13707640 CTGTTAAAGCAAACTAAACATGG + Intronic
1155455023 18:26002652-26002674 GTGATTAAGCACATAGAACCTGG - Intergenic
1155674654 18:28415840-28415862 GTGTTTAATTAAATAGAAAAAGG + Intergenic
1156161044 18:34358664-34358686 GTGTGACAGCAAAATGAACACGG - Intergenic
1157159798 18:45303443-45303465 GTGTTAAAGCAAACTGAATATGG - Intronic
1157627719 18:49065244-49065266 GTTTTAAAGCAAATAGGAATGGG - Intronic
1157674004 18:49554749-49554771 GTGTTACAGCAAACTAAACATGG - Intergenic
1159133339 18:64306729-64306751 GTGTGAATGCAAATAGGAAAAGG + Intergenic
1159282422 18:66303968-66303990 GTCTTAAAGCAAAGAGTTCAGGG - Intergenic
1159533861 18:69690878-69690900 GTGTTAAAGAATATAGAATTGGG + Intronic
1159632479 18:70764757-70764779 GAGTGAAAGCAAAAAGATCATGG + Intergenic
1163039776 19:14593657-14593679 GTCTTTAAAAAAATAGAACACGG + Intronic
1163050077 19:14676419-14676441 GTGATAAAGAAAAGGGAACATGG + Intronic
1164693426 19:30226901-30226923 GTCTTGAAGCAAACAGAAAAAGG - Intergenic
1166140439 19:40802474-40802496 GTTCTAAAGCAAAAAGAAAAAGG - Intronic
1166963124 19:46511635-46511657 GTGTTAAAGCAAACTAAATATGG + Intronic
1168026995 19:53649589-53649611 GTGTTAAAGCAAACTAAATATGG + Intergenic
925540431 2:4960808-4960830 TTGGTAAAGAAAATAGAACTTGG + Intergenic
925633026 2:5914872-5914894 GTGTTACAGTGAAAAGAACATGG - Intergenic
925642608 2:6000624-6000646 GCTTTAAAGTAAATAAAACAAGG - Intergenic
926521515 2:13921757-13921779 GTGTTAAAGCAAACTAAATATGG + Intergenic
928817251 2:35312988-35313010 TCTTTAAAACAAATAGAACAAGG + Intergenic
929275467 2:40020585-40020607 ATGTGAAAGCAACTAGAACTGGG + Intergenic
930173056 2:48271321-48271343 TTGTCAAAACAAATATAACAAGG + Intergenic
930498064 2:52174351-52174373 GTGTTAAAGCAAACTAAATATGG + Intergenic
930613107 2:53564823-53564845 GTGTTGAAGAAAATAAAACATGG - Intronic
930699476 2:54445045-54445067 GTGATTAAGTAAAAAGAACAAGG + Intergenic
930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG + Intergenic
932558698 2:72848468-72848490 GTTATAAAGAAAATAGAGCAAGG + Intergenic
932818187 2:74878331-74878353 GTGGTAAAGCACCAAGAACAGGG + Intronic
932834611 2:75024402-75024424 CTGTGAAAGAAAATAAAACAGGG - Intergenic
936920151 2:117680177-117680199 GTGTGTATGCAAATAGAAGAGGG - Intergenic
937379611 2:121364819-121364841 GTGTTAAAGCAACTAGATGCAGG + Intronic
937796172 2:126023651-126023673 GTGTAACAGCAAACAGAAGATGG + Intergenic
938572297 2:132571714-132571736 GTGTCAAAGCAACAAGATCATGG + Intronic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
939325980 2:140689105-140689127 GTGTTAAAGCAAACTAAATATGG + Intronic
939841496 2:147194679-147194701 TTATAAAAGCAAAAAGAACATGG - Intergenic
940584553 2:155629129-155629151 GTATTAAAGCAAATAGAAATTGG - Intergenic
942242003 2:173971481-173971503 GTGCTTAAACATATAGAACATGG - Intergenic
943547869 2:189303535-189303557 GTGTTAAAGCAAACTAAATATGG + Intergenic
944376219 2:199045274-199045296 TTGTTAAAGCAAACAAAATATGG - Intergenic
944929492 2:204501709-204501731 GTGTAAAAGAAAATAGAGAAGGG - Intergenic
944964654 2:204916963-204916985 ATGTTAAAACCAAGAGAACAGGG - Intronic
945523236 2:210855322-210855344 GTCTTCGAGTAAATAGAACATGG - Intergenic
945609545 2:211982436-211982458 GTGTTAAAGCTCTGAGAACAAGG + Intronic
946711105 2:222506834-222506856 GTGTTAAAGAAATAATAACATGG + Intronic
946832365 2:223739769-223739791 GTTATAAAGAAAATAAAACAGGG + Intergenic
948718096 2:239878987-239879009 GTGTTAAAGCAAACTAAATATGG + Intergenic
1169988568 20:11473927-11473949 GTAATAAAGCAAATAGAAGAGGG + Intergenic
1171965139 20:31524062-31524084 GTCTTAAAGCAAATAAGATATGG - Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1174988412 20:55481820-55481842 GTAATAGAGCAAAGAGAACAAGG + Intergenic
1175587170 20:60150368-60150390 TTTTTAAAGCAAAGAGAATAGGG - Intergenic
1176590025 21:8639364-8639386 TTTCTAAAGCAAATAAAACAAGG + Intergenic
1177056544 21:16311341-16311363 TATTTAAAGCAAATAGAACATGG - Intergenic
1177358841 21:20043514-20043536 ATGTTAAAGCGAACAGAATATGG + Intergenic
1177630717 21:23723980-23724002 GAATAAAAGCAAATAGAAGAGGG - Intergenic
1180272857 22:10616357-10616379 TTTCTAAAGCAAATAAAACAAGG + Intergenic
1180946765 22:19698972-19698994 GTGTTAAATCTAACAAAACATGG - Intergenic
1181612085 22:24022074-24022096 TTGTTAAAAAAAATAGCACAGGG - Intronic
949137257 3:582333-582355 TTTCTAAAGCAAATAAAACAAGG - Intergenic
949265275 3:2149928-2149950 GTTTTAATGCAAATTCAACAGGG + Intronic
949663892 3:6314309-6314331 GAGTTAAAGAATATAGAACAAGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952070333 3:29626741-29626763 GTAATATAGTAAATAGAACAAGG + Intronic
953449347 3:42993142-42993164 GTGTTAAAGCAAACTAAATATGG - Intronic
953742842 3:45552042-45552064 GTGGCAAAGCACTTAGAACAGGG - Intergenic
956019553 3:64919535-64919557 TTGTTAAAGCAAATTTAAAATGG + Intergenic
957054509 3:75433657-75433679 GCTTTAAAGCCAATAAAACAGGG - Intergenic
957630694 3:82712547-82712569 TTGTTAAAGCAAATTTAATATGG + Intergenic
957817883 3:85326121-85326143 GATTTAAAGCTAAAAGAACATGG + Intronic
957968383 3:87351284-87351306 TTGTGAAAGCAAAAAGAATAAGG - Intergenic
958636852 3:96755837-96755859 GTGTTAAATCCTTTAGAACAAGG + Intergenic
958653246 3:96965279-96965301 GTGTTAAAGCAAACTAAATATGG - Intronic
958905120 3:99933579-99933601 GTGTTCAAGAAAATACAATAGGG - Intronic
958979785 3:100708048-100708070 GTGTTAAAGCAAACTAAATATGG + Intergenic
960166104 3:114403269-114403291 GTGTTAGAGGAGAAAGAACATGG - Intronic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
961145988 3:124593689-124593711 CTGTGAAAGCAAATAGCAAATGG - Intronic
961300339 3:125918048-125918070 GCTTTAAAGCCAATAAAACAGGG + Intergenic
961531512 3:127543040-127543062 GTGTTAAAGCAAACTAAAAATGG + Intergenic
962151461 3:132897777-132897799 GGGTTAAAGAAAATAGAAACTGG + Intergenic
963424173 3:145103322-145103344 GTGCTGAAGAAAATAGAAAAGGG + Intergenic
965128564 3:164663414-164663436 GTGTCAAAGCAAAAATTACATGG - Intergenic
965550189 3:169956567-169956589 CTGTGAAAGCATATAAAACATGG - Intergenic
965841053 3:172906159-172906181 GGCTTAAAGTAAATAGAAAAAGG - Intronic
966916960 3:184590198-184590220 CTGTTAAAGCGATTATAACAGGG - Intronic
967497440 3:190157319-190157341 GTGAAAAAGCAAGTAGAAAAAGG + Intergenic
967537455 3:190623319-190623341 GTGTTAGAGGAAATAAAAAAGGG - Intronic
968738819 4:2316567-2316589 ATGTTAAAGAAAATAGAAGGGGG - Intronic
969816666 4:9692284-9692306 GCTTTAAAGCCAATAAAACAGGG + Intergenic
970796884 4:19923495-19923517 TTGTTAAAGCAAACTAAACATGG - Intergenic
971037300 4:22707755-22707777 GTTTTCAAGCAAATCTAACAAGG + Intergenic
971858428 4:32073039-32073061 GTGTAATGACAAATAGAACATGG + Intergenic
971905896 4:32725496-32725518 CTGTTAAATGAAAAAGAACAAGG + Intergenic
972159609 4:36207096-36207118 GTTGTAAAGAAAAGAGAACATGG - Intronic
972447826 4:39163292-39163314 GTGTAATAGCAAATTGAACTTGG - Intergenic
975144432 4:70952343-70952365 GTGTAAAAGCAAATAAAAACAGG + Intronic
975366058 4:73529152-73529174 GTGTTTCAACAAATAGAGCATGG - Intergenic
975688585 4:76943522-76943544 GTGGTAAAGCAAATTGAACTTGG + Intergenic
975794749 4:77995241-77995263 CTGTTAAACCATACAGAACAAGG + Intergenic
976560263 4:86492888-86492910 GTGTTAAAGCAAACTAAATATGG + Intronic
976580775 4:86733898-86733920 TTGTTAAAGCACACAGTACACGG - Intronic
976632857 4:87256892-87256914 GTTTTAAAGAAAAGAAAACAGGG - Intergenic
976669286 4:87634202-87634224 ATGTTAAAGCACATGGAACTTGG - Intergenic
978611450 4:110545577-110545599 AAGTTAAGGCAAAGAGAACAGGG + Intronic
979049731 4:115914888-115914910 TTGTTAAAGCAAATTAAAAAAGG + Intergenic
979076430 4:116276399-116276421 ATGTTAAAGCAACTAGAGAAAGG + Intergenic
979779172 4:124627851-124627873 GAGGTAAAGAAAATAGAACTGGG + Intergenic
979983641 4:127288308-127288330 CTTTTATAGCAAATAGAAAATGG + Intergenic
980002263 4:127503708-127503730 GTGTTAAAACAGATAAAAGAAGG - Intergenic
980267664 4:130540009-130540031 GTGTGAAAGCAAATAAAAACTGG + Intergenic
980662777 4:135885954-135885976 CAGTTAAAACAAAAAGAACAAGG - Intergenic
980772074 4:137387536-137387558 TTGTTAAAACACATAGATCAGGG - Intergenic
981165090 4:141548354-141548376 CTGTAAAATAAAATAGAACAAGG + Intergenic
982139935 4:152307619-152307641 GTGTTAAAGGAAAGAGACCTTGG - Intergenic
982474915 4:155838299-155838321 GTGTGAAAGCAAAAAAAAGAGGG + Intronic
983987510 4:174078071-174078093 GTGTTAAAGCAAACTAAATATGG - Intergenic
986556570 5:9015938-9015960 GTGATAATGCAAATAGGAAAAGG - Intergenic
986602260 5:9484356-9484378 GTGTTAAAATAAAGAGATCATGG - Intronic
986640333 5:9865553-9865575 GTGTTAAAGAAAACAGCAAAGGG - Intergenic
986681841 5:10240613-10240635 GAGGTAAAGCACTTAGAACAGGG + Intronic
987206444 5:15631852-15631874 GTTTTAAAGAAAAATGAACATGG + Intronic
987947278 5:24627744-24627766 GTGTTAAAGCAAATAAATAAAGG - Intronic
989174177 5:38505004-38505026 GTGTTAATGCACATGGACCATGG + Intronic
989642693 5:43598788-43598810 GTGTTAAAGCAAACTAAATATGG + Intergenic
989770165 5:45135354-45135376 TTGATAAGGTAAATAGAACAGGG + Intergenic
990290420 5:54345136-54345158 GTGTCAAAGCAAATGAAATATGG + Intergenic
990331809 5:54734768-54734790 GTGTCAAAGCATATAAAAGAAGG - Intergenic
991214167 5:64142839-64142861 GTGTTAAAGCAAACTAAATATGG + Intergenic
991601050 5:68351474-68351496 GAGAGAAAGCAAATAAAACAGGG - Intergenic
992737067 5:79732732-79732754 GTGGAAAAGCAAGTTGAACATGG + Exonic
992937514 5:81724676-81724698 ATTATAAAGCAAATAGAAAATGG + Intronic
993118640 5:83747305-83747327 GTGTTAAAAAAAATAAATCATGG - Intergenic
993359448 5:86955945-86955967 ATGTAAGAACAAATAGAACAAGG - Intergenic
993474481 5:88347497-88347519 GTGCTAAACCCAAAAGAACAGGG + Intergenic
995682093 5:114731509-114731531 GTGTCAAAGAAAACAGGACAAGG + Intergenic
996180745 5:120416779-120416801 ATTTTAAAGCAAATAGAAAGGGG - Intergenic
996657832 5:125962719-125962741 GCTTTTAAGCAAATAGAAGAAGG + Intergenic
996677258 5:126190794-126190816 GTGTCAAAGCAAACTGAATATGG - Intergenic
998543339 5:143004299-143004321 GTGTTAAAGCAAACTAAATATGG - Intronic
998611038 5:143688568-143688590 ATGTTAAAGATAATAGAATAGGG + Intergenic
1000501273 5:162054039-162054061 TTGTTAAAGCAAAGTAAACATGG - Intergenic
1000874866 5:166624337-166624359 GTGTTAATGAGAAAAGAACATGG - Intergenic
1000917562 5:167100565-167100587 CTATTAAAGCAAAAAGAACAGGG - Intergenic
1000975400 5:167758928-167758950 GTGGAAAAGCAAATAGAATAGGG - Intronic
1001369426 5:171182419-171182441 GTGGTACAGCAGAAAGAACATGG + Intronic
1001835460 5:174827542-174827564 GTGCTAAGGCACACAGAACATGG - Intergenic
1002327541 5:178419648-178419670 GTGTTAAAGCAAACTAAATATGG + Intronic
1002772115 6:298924-298946 GTGGTGAAGAAAATAAAACAAGG + Intronic
1002832694 6:837306-837328 GTGTTAAAGCATCTAAAAGAAGG - Intergenic
1002907427 6:1461722-1461744 GTGTTAAAGCAAACTAAATATGG + Intergenic
1003240557 6:4341746-4341768 GTGGTGAAGAAAACAGAACATGG - Intergenic
1003702534 6:8484753-8484775 ATGATAAAGCAAGTAGAATATGG + Intergenic
1005400206 6:25424187-25424209 GTGTTAAAAGAACTAGGACAAGG - Intronic
1006009959 6:31034542-31034564 GTGGTAAAGAGAAGAGAACATGG + Intronic
1006819280 6:36878575-36878597 GTGTTAAAGCAAACTAAATATGG + Intronic
1006946478 6:37787864-37787886 GTCTTAAAGCAAAAACCACATGG + Intergenic
1008286013 6:49651550-49651572 GTATTTAAGAGAATAGAACATGG - Intergenic
1010917453 6:81637850-81637872 GTGTAAGTGCAAATATAACAGGG - Intronic
1011581465 6:88871485-88871507 ATGTTACAACAAATAGAATATGG + Intronic
1011604577 6:89090252-89090274 GTGTTAAAGAAAATAGAGTTAGG + Intergenic
1012181755 6:96163324-96163346 GTGTTAAAGCAAACTAAATATGG + Intronic
1013446528 6:110234287-110234309 ATATTAAAACAAATAAAACATGG - Intronic
1013661614 6:112303398-112303420 TTGTTAAAGCAAACTAAACATGG + Intergenic
1014105120 6:117552552-117552574 GTGTCACAGCAAAAAGAAAAAGG - Intronic
1014500555 6:122183713-122183735 GAGAGAAATCAAATAGAACATGG + Intergenic
1014726450 6:124977376-124977398 GTATTAAAATAAATTGAACATGG + Intronic
1015745637 6:136506713-136506735 GTGTTAAAGCAAACTAAATATGG + Intronic
1015830821 6:137366622-137366644 TTTTTAAAGCAAATAGGAAAAGG - Intergenic
1016848995 6:148597599-148597621 GTGTTAAAGCAAACTAAATAGGG - Intergenic
1018456612 6:163959489-163959511 GTGTTAAAGTAAAAAGAATCAGG - Intergenic
1021749672 7:23783382-23783404 CTGCTAAAGCAAATTAAACATGG - Intronic
1021852761 7:24824753-24824775 GTGTTAAGGAAAATAAAGCAGGG + Intronic
1022007326 7:26278040-26278062 TTGTTAAAGCAAACTAAACATGG - Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1025580663 7:62711740-62711762 GTGATAAAGCAAATATCCCAGGG - Intergenic
1025596935 7:62941447-62941469 GTGATAAAGCAAATATCTCAGGG - Intergenic
1026013421 7:66654366-66654388 GTCTAAGAGCAAATAGAAGAGGG - Intronic
1026235844 7:68526717-68526739 ATGTAGAAGGAAATAGAACAAGG - Intergenic
1026683938 7:72492203-72492225 GTGTTTAAGCCAATAGCTCATGG + Intergenic
1027989515 7:85339181-85339203 GAAGTAAAGCAAATAGCACATGG - Intergenic
1028637316 7:93004157-93004179 GTGTTAAAGCAAACTAAACATGG + Intergenic
1028763591 7:94523968-94523990 GTGCTAAAGCAATTAGCACATGG + Intronic
1031198424 7:118646423-118646445 GTGTTAAAGCAAACTAAATATGG - Intergenic
1031304814 7:120113204-120113226 GTGTTAAAGCAAACTAAATATGG + Intergenic
1031465298 7:122102594-122102616 GTATTAAAATAAATAGAAAATGG + Intronic
1031743079 7:125458448-125458470 GTGTTAAAGCAAACTAAATATGG - Intergenic
1031800186 7:126233441-126233463 ATGTTAAAGGAAATACAATAGGG + Intergenic
1032179004 7:129659469-129659491 ATGTTAAAGCAAATATTAAATGG - Intronic
1032392504 7:131565088-131565110 GTGTTAAAGCAAACTAAACATGG - Intergenic
1032536967 7:132672446-132672468 GTGTAAAAGGAAACAGAAGAAGG + Intronic
1033088440 7:138363643-138363665 TTGTTAAAGCGAATAAAATACGG - Intergenic
1033404321 7:141057299-141057321 ATGTTAAGGCAAACAGGACACGG - Intergenic
1034196476 7:149252227-149252249 GAGGTAAAGGAAATAGAAAATGG + Intronic
1034594092 7:152171875-152171897 ATGTTAAAGCAAATCAAAAATGG + Intronic
1036189784 8:6659831-6659853 GTGTTAAAGCAAACTAAATATGG - Intergenic
1036440094 8:8774280-8774302 GTGTTAAAGCAAACTAAATATGG - Intergenic
1036849627 8:12192627-12192649 GCTTTAAAGCCAATAAAACAGGG - Intronic
1036870990 8:12434900-12434922 GCTTTAAAGCCAATAAAACAGGG - Intronic
1037396858 8:18452346-18452368 GTGTTAAAGCCAACTCAACATGG + Intergenic
1037900307 8:22684313-22684335 GAGCTAATGCAAACAGAACATGG - Intergenic
1040799029 8:51321106-51321128 GTGTTAAAAAATATTGAACATGG + Intronic
1041604760 8:59768505-59768527 TTGTTAAAGCAAATTAAATATGG - Intergenic
1043034117 8:75176061-75176083 ATGATAAAGCAAATATAATAAGG - Intergenic
1043581095 8:81716219-81716241 GTGTTAGAACACATTGAACATGG + Intronic
1046035170 8:108832118-108832140 GTGTTAAAGCAAACTAAATATGG + Intergenic
1046038751 8:108876691-108876713 CTGTTAAAGCAAACTAAACATGG + Intergenic
1046297397 8:112238889-112238911 GTGTTAAAGCAAACTAAATATGG + Intronic
1046561748 8:115846632-115846654 CTGTTAAAGAAATGAGAACATGG - Intergenic
1047901642 8:129429594-129429616 GTGTTAAAGCAAATTAAATATGG + Intergenic
1048195230 8:132327174-132327196 GTGTTAAAGGCCATAAAACAGGG - Intronic
1048712232 8:137225063-137225085 GTGTAAAAGCAAAGGGAAAATGG - Intergenic
1048890099 8:138939226-138939248 GTGTTAAAGGACATGAAACAGGG + Intergenic
1051625653 9:19098069-19098091 GTGTCAAAGAGAAGAGAACAAGG - Intronic
1052045167 9:23785544-23785566 GTGTGAAAACAAAAATAACAAGG + Intronic
1052069337 9:24062950-24062972 GTGTGACAGAGAATAGAACATGG + Intergenic
1052698604 9:31910597-31910619 GAGTCAAAGCAAATAGAACAAGG - Intergenic
1054892218 9:70263054-70263076 GTATTTAAGAAAACAGAACAGGG - Intronic
1054965326 9:71019830-71019852 GTGTCAGTGCAAATAGAACAAGG + Intronic
1055278537 9:74647567-74647589 GTGTTAAAGACAATATAAGAAGG - Intronic
1057447231 9:95125357-95125379 ATTTTAAAGAAAATATAACAGGG - Intronic
1057529068 9:95828159-95828181 GTGTCCAAGGAAATAGAGCAAGG - Intergenic
1058241303 9:102564627-102564649 GATTTAAAACAAATAGAACTGGG - Intergenic
1058823842 9:108757473-108757495 GTGTTAAAGCAAACTAAATACGG - Intergenic
1059369821 9:113819206-113819228 ATGTTCAAGAAAATAGAAGAAGG + Intergenic
1059571072 9:115436428-115436450 GTGTTAAAGCAAACTAAATATGG + Intergenic
1059871266 9:118580680-118580702 GTGCTAATGCAACTAGAATATGG + Intergenic
1060189858 9:121585447-121585469 GGATTAAAGCACTTAGAACAGGG + Intronic
1060810129 9:126607109-126607131 ATTTTAAAGCAAATAAATCAAGG + Intergenic
1061773932 9:132948094-132948116 TTGTTAAAGCAAATGAAATATGG - Intronic
1062132199 9:134903772-134903794 GTGTTGAAGAAAATGGAAGATGG + Intergenic
1203620040 Un_KI270749v1:118017-118039 TTTCTAAAGCAAATAAAACAAGG + Intergenic
1187029826 X:15474441-15474463 GTGTTAAAGCAAACTAAATATGG - Intronic
1187567017 X:20460862-20460884 GTGTTAAAACTCATAGAACTGGG - Intergenic
1187898276 X:24003112-24003134 CTGTTACAGCTAATAGAATAGGG - Intronic
1189363092 X:40368528-40368550 TTGTTAAAGCAAAGAGTACCAGG + Intergenic
1192048364 X:67700219-67700241 GTGATAAAGCAAAGAGAAAGGGG - Intronic
1192763496 X:74120254-74120276 GTGTTAAAGCAAACTAAATATGG - Intergenic
1193803642 X:85968430-85968452 CTCTTAAAGCAAAGAGAAAAAGG - Intronic
1193979540 X:88164895-88164917 GTGTTAAAGCAAACTAAATATGG + Intergenic
1196008836 X:110864970-110864992 GTGTTACAGAAAAAAGTACAGGG + Intergenic
1198500956 X:137245976-137245998 GTTTTCAAGCAGATAGAATATGG - Intergenic
1198896521 X:141461650-141461672 TTGATACAGCAAAAAGAACATGG - Intergenic
1199133302 X:144220214-144220236 GGGTTAAAGCAAGTACAAGATGG + Intergenic
1199986411 X:152955228-152955250 TTGTTAAAGCAAATTAAATACGG - Intronic
1200826312 Y:7646979-7647001 GAGGTAATGTAAATAGAACAAGG + Intergenic
1202117673 Y:21487307-21487329 GAGGTAATGTAAATAGAACATGG - Intergenic
1202194552 Y:22285734-22285756 GAGATAATGTAAATAGAACAAGG + Intergenic
1202200903 Y:22346471-22346493 GTGGTAATGTAAATAGAACAAGG - Intronic