ID: 960198592

View in Genome Browser
Species Human (GRCh38)
Location 3:114802588-114802610
Sequence TCCTCTCATTCAGTTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960198592_960198596 5 Left 960198592 3:114802588-114802610 CCAGGGACAACTGAATGAGAGGA 0: 1
1: 0
2: 1
3: 15
4: 149
Right 960198596 3:114802616-114802638 GTGCACATTATTTCCTTATAAGG 0: 1
1: 0
2: 2
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960198592 Original CRISPR TCCTCTCATTCAGTTGTCCC TGG (reversed) Intronic
902984754 1:20148669-20148691 TCCTCTCTCTCAGGTCTCCCCGG - Exonic
907185557 1:52606671-52606693 TTCTGTCATACAGGTGTCCCTGG + Exonic
907667886 1:56449290-56449312 GCCTCTCCTTCAGCTGCCCCAGG - Intergenic
909093022 1:71251118-71251140 TCCTCTCAAGCATTTTTCCCAGG - Intergenic
910110256 1:83675292-83675314 TTCTCTCAGTCAGTCTTCCCTGG + Intergenic
911798198 1:102100263-102100285 TACTGTCTTTCAGTTGTGCCTGG + Intergenic
915511225 1:156388140-156388162 GCCTCTTATCCAGATGTCCCTGG - Intergenic
915728934 1:158039065-158039087 TCCTCTCAATCAGAAGTCTCCGG - Intronic
917222885 1:172749916-172749938 TCCTCACATCCAGTCCTCCCTGG - Intergenic
917385114 1:174464227-174464249 TCCATTCATTCATTTGTCCTTGG - Intronic
918744759 1:188185153-188185175 TCCTTTCTATCAGTGGTCCCAGG - Intergenic
919157663 1:193787546-193787568 TCCTCTCCTTCATTTGATCCAGG + Intergenic
920654353 1:207864593-207864615 CCCTCTCATTCTGATTTCCCTGG - Intergenic
920673966 1:208026109-208026131 TCCAATCATCCAGTGGTCCCTGG - Exonic
920693873 1:208166966-208166988 CTCTCTCATTCAGTAGCCCCAGG - Intronic
923971337 1:239206257-239206279 TTCTGTCATTCTGTTGTCCTAGG - Intergenic
1065007480 10:21393290-21393312 AACTGTAATTCAGTTGTCCCAGG + Intergenic
1065473733 10:26111365-26111387 TGCTCTAATTCTGATGTCCCAGG + Intronic
1065936796 10:30527647-30527669 TCATGTCTTTCAGTTCTCCCTGG - Intergenic
1068686064 10:59870878-59870900 TGCTCTCATTTAATAGTCCCGGG - Intronic
1070391885 10:75978080-75978102 TCCTCTCAGTGAGTTATTCCTGG + Intronic
1071693740 10:87850454-87850476 CCCTCTCTTGCAGTTGTCCTTGG + Intergenic
1072271015 10:93776660-93776682 GCCTCTCATTCAGTTCTCCAAGG + Intronic
1073506900 10:104003078-104003100 TCTTCACCTTCAGTTGTTCCTGG - Exonic
1074107098 10:110396521-110396543 TCCTCACATGCTGTTCTCCCAGG - Intergenic
1074554964 10:114480198-114480220 TCCACCCATTCAGATGTCCAGGG + Intronic
1076058751 10:127396536-127396558 TCCTCTCCTCCTGTTGTCTCTGG + Intronic
1081427220 11:42938581-42938603 TCCCCAAGTTCAGTTGTCCCTGG - Intergenic
1086900491 11:92362009-92362031 TGGTCTCATTCAGTCATCCCAGG + Intronic
1089974821 11:122723440-122723462 TCCCATCTATCAGTTGTCCCAGG + Intronic
1093500942 12:19811306-19811328 TTCTGTCTTTCAGTTGTCCCTGG - Intergenic
1097013794 12:55971267-55971289 TTCCCTCATTCATTTCTCCCAGG + Intronic
1100338974 12:93660028-93660050 TCCTCTCTCTCAGTCCTCCCAGG + Intergenic
1103000181 12:117379473-117379495 CCTTCTCAATCAGTTGTCCAAGG + Intronic
1104262909 12:127201082-127201104 TCCTCTCCTTCTCTTGCCCCAGG - Intergenic
1106179833 13:27361149-27361171 TCCTCTCATTCCCTGGTCCCTGG - Intergenic
1107158014 13:37192375-37192397 TTCTCCAATTGAGTTGTCCCTGG - Intergenic
1109142251 13:58728841-58728863 TCTTCTCATGAAGTTGTCTCTGG - Intergenic
1111112691 13:83734756-83734778 TCCTCTCATTCCTCTTTCCCCGG - Intergenic
1112590277 13:100757131-100757153 CCCTCTCATTCAGTTCTCCTGGG - Intergenic
1114401854 14:22417475-22417497 TCCTCTGATGAAGTTGTCCCAGG + Intergenic
1117279648 14:54225935-54225957 TCCTCTTATTCAGTTAACCCTGG + Intergenic
1122230767 14:100305546-100305568 TCCTCCCATGCAGTTGTCCCCGG - Intronic
1122893645 14:104744579-104744601 TCCTGTCATTCAATTCTCACAGG - Intronic
1123463065 15:20492304-20492326 TCCTCTACTTCAGGTGTCACAGG - Intergenic
1123654996 15:22508110-22508132 TCCTCTACTTCAGGTGTCACAGG + Intergenic
1123759233 15:23420003-23420025 TCTTCCCATTCAGTTGTTTCAGG + Intergenic
1124273907 15:28309707-28309729 TCCTCTACTTCAGGTGTCACAGG - Intronic
1124308904 15:28603311-28603333 TCCTCTACTTCAGGTGTCACAGG + Intergenic
1126374907 15:47987968-47987990 TTATCTGATTCAGCTGTCCCTGG + Intergenic
1126386181 15:48095774-48095796 TCTTCTCATACAGCTGTACCAGG + Intergenic
1127793437 15:62418247-62418269 TCCTCTCTCCCAGTTGTGCCTGG + Intronic
1132575911 16:663972-663994 TCCCATCATCCAGTTGCCCCTGG + Intronic
1133563908 16:6974843-6974865 TACTCGCATTCAGTGCTCCCTGG + Intronic
1134377910 16:13695629-13695651 GCCACTCTTTCAGATGTCCCAGG + Intergenic
1134518070 16:14903071-14903093 TCCTCTCAATCACTTGACTCTGG - Intronic
1134705741 16:16301725-16301747 TCCTCTCAATCACTTGACTCTGG - Intergenic
1134961800 16:18410389-18410411 TCCTCTCAATCACTTGACTCTGG + Intergenic
1134966098 16:18492988-18493010 TCCTCTCAATCACTTGACTCTGG + Intronic
1136147123 16:28322214-28322236 TCCTCCCAGGCAGCTGTCCCAGG + Exonic
1137462021 16:48672992-48673014 TCCTCTTCTTCAGTTGCCCAAGG - Intergenic
1141040210 16:80666697-80666719 TTCTCTCCTTGAGTTGTCCTGGG - Intronic
1141523872 16:84598918-84598940 TCCTCTGTTTCTGTTGTCACTGG - Intronic
1142736761 17:1905851-1905873 CCCCCTCATTCAGATGTTCCTGG - Intergenic
1143051228 17:4127678-4127700 TTCTCACTTTCAGTTGTGCCTGG - Intronic
1143123542 17:4625437-4625459 TCCTCACCTCCAGTTGTGCCTGG - Intergenic
1147908625 17:43840794-43840816 TTCTGTCATTTAGGTGTCCCAGG - Intergenic
1150015571 17:61553413-61553435 TCCTTTCCTTCACCTGTCCCCGG - Intergenic
1150717287 17:67582864-67582886 GCCTCTCATTCAGCTGAACCAGG - Intronic
1154037200 18:10814667-10814689 TCTTCTCATACCGTTTTCCCTGG + Intronic
1154435725 18:14340161-14340183 TCCATTCATTCATTTGACCCTGG - Intergenic
1157889632 18:51403361-51403383 TACTCCCATTCACTTTTCCCAGG - Intergenic
1157943999 18:51958451-51958473 TGCTGGCATTCAGTTGTCCAGGG - Intergenic
1160004416 18:75059317-75059339 TCCTCTTCTTCAGTAGTCTCAGG - Intronic
1160310678 18:77787092-77787114 TCTTCTCACTCATGTGTCCCAGG + Intergenic
1162626337 19:11887960-11887982 TCCTGGCTTTCAGATGTCCCGGG - Exonic
1163235409 19:16026929-16026951 TCCTATCATCCACTTGGCCCTGG - Intergenic
1164562549 19:29302618-29302640 TCCTCACATTCAGTTTCCACAGG + Intergenic
1167197576 19:48041250-48041272 TGCTCTCATTTAGTGGTCTCAGG - Intronic
1168089069 19:54070151-54070173 TTCTCTCTTTCAGTTCCCCCAGG - Exonic
925576034 2:5361092-5361114 TCCTCTCATTCATTTCTATCTGG - Intergenic
928786868 2:34898264-34898286 TCCCCTCATTCATTGTTCCCTGG + Intergenic
929228051 2:39531161-39531183 TCCTCTCACTCAGCTGTCAGAGG + Intergenic
930100877 2:47601854-47601876 TGCTTTCATTTACTTGTCCCTGG + Intergenic
930772384 2:55141213-55141235 TCCTCTTCTTCAGGTGTCCTTGG + Intergenic
932046649 2:68356840-68356862 CCCACTCATTCAGTTGCCCCAGG - Intergenic
932852060 2:75197412-75197434 TTCTCACATTCAGTTATCTCAGG + Intronic
936707629 2:115094018-115094040 TCCTCTCATTCAGTTTTAAAAGG - Intronic
938381306 2:130837763-130837785 TCCTTTCATGCAGTTGCTCCCGG - Intronic
941879996 2:170471661-170471683 TCCTCCCATTGAATTGTCCTTGG + Intronic
942756812 2:179351158-179351180 CCCTCTCATTTACTTCTCCCTGG - Intergenic
946020261 2:216635721-216635743 TTCTCCCATTCACTTTTCCCTGG + Intronic
946700817 2:222411504-222411526 TGCTCTCATTCAGGTCTCCAAGG + Intergenic
947559232 2:231132316-231132338 TCCTGTGAGTCAGTTTTCCCTGG + Intronic
948865671 2:240773546-240773568 TCCTCTCCCCCAGTGGTCCCAGG + Intronic
1170187299 20:13605166-13605188 TCCTCTCCCTCAGTGGCCCCTGG - Intronic
1170801074 20:19590810-19590832 TCTTCTGATTCAGTTGGCCTTGG - Intronic
1171086355 20:22241470-22241492 TCCTGTCATTCTCTGGTCCCAGG + Intergenic
1172208946 20:33184241-33184263 TCCTTGCTTTGAGTTGTCCCCGG - Intergenic
1176841308 21:13845471-13845493 TCCATTCATTCATTTGACCCTGG + Intergenic
1178623852 21:34199467-34199489 TCCTCCCATTCAGTTTTCAGGGG + Intergenic
1181620121 22:24085264-24085286 CCCTCTCATTCCGTTTTCCCTGG - Intronic
952638457 3:35560929-35560951 TCCTCTGATTCAGTTTTCATAGG - Intergenic
953057131 3:39396933-39396955 TCCTCACATCCAGTCTTCCCTGG - Exonic
954090950 3:48283619-48283641 TCCTCTGGTTTAGTGGTCCCAGG - Intronic
959392278 3:105790979-105791001 CCCACTCATGCAGTTCTCCCTGG - Intronic
960198592 3:114802588-114802610 TCCTCTCATTCAGTTGTCCCTGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
964492344 3:157250170-157250192 TTCTCACATTCAGTTCTTCCTGG + Intergenic
970466947 4:16333660-16333682 TCCTCTCTGTCATTAGTCCCAGG + Intergenic
970868001 4:20781321-20781343 TCATCTCATTTATTTGTACCTGG - Intronic
973963912 4:56140943-56140965 TTCTCTCATTCATTCATCCCTGG - Intergenic
977836864 4:101655406-101655428 TCCTCTCATTCATTTGTTCTGGG - Intronic
978562708 4:110050507-110050529 TCCTTTTGTTCAGTTGCCCCGGG - Exonic
980739171 4:136928766-136928788 ACCTCTCCTTCTGTTGTTCCTGG - Intergenic
982678869 4:158406543-158406565 ACCTCTGATTCAGTTCTCCTTGG + Intronic
985347500 4:189022049-189022071 CCCTGTCATTCCTTTGTCCCTGG - Intergenic
985627058 5:994631-994653 TCCTCTACTTCAGTGGACCCTGG + Intergenic
990319005 5:54611549-54611571 TCCTCCCCTTAAGTTGTTCCTGG - Intergenic
993530527 5:89018977-89018999 TCCTGTCATTCAGCTATACCAGG - Intergenic
997603493 5:135156451-135156473 TCCTGTCCTTCACTAGTCCCTGG - Intronic
998838030 5:146222751-146222773 TTCTCCCATTCAGTTGTCTGAGG + Intronic
1006460001 6:34152716-34152738 TACCCTCATTCTGATGTCCCAGG - Intronic
1006875049 6:37288290-37288312 TCCTCCCATACAGTTTTCCATGG + Intronic
1011567476 6:88692144-88692166 TCCTCTCTTTCAGTTATCACTGG - Intronic
1015522201 6:134142786-134142808 TTCTCTCTTTCAGTTTTCCAAGG + Intergenic
1016085991 6:139915475-139915497 TGATGTCATTCAGTTGTCCTTGG - Intergenic
1019997294 7:4732982-4733004 TCCTGTCCTTCAGTTCTCCTGGG + Intronic
1026316776 7:69234123-69234145 TCCTCTCACTCAGCTATTCCTGG - Intergenic
1028257008 7:88611222-88611244 TTCTCTCATTCCCTGGTCCCAGG - Intergenic
1028466179 7:91154800-91154822 TCTTCTCATTAATTTGACCCAGG - Intronic
1030274068 7:107700734-107700756 TCCTCTGAATCAGTTTGCCCTGG - Intronic
1032477592 7:132222950-132222972 GCTTCTCATTCAGTTGGCCTAGG + Intronic
1032592499 7:133205022-133205044 TCTTCTCAATCAGTGGTCTCAGG - Intergenic
1032846071 7:135753059-135753081 TTATGTCATTCAGTTTTCCCAGG + Intergenic
1035747282 8:1971497-1971519 TCCTCTCCTTCAGTCCTCTCAGG + Intergenic
1036425755 8:8643991-8644013 TCTTCACATGGAGTTGTCCCTGG + Intergenic
1036689999 8:10939333-10939355 TCCTCTCAGTCACTGGTCCTTGG - Intronic
1037486976 8:19356921-19356943 TGCTCCCATTTAGTTGGCCCTGG - Intronic
1038180248 8:25220901-25220923 GCCTCTCATTCAGTTTTTACAGG + Intronic
1039495702 8:37978479-37978501 TCCTCTCATGCTGGTGTACCAGG - Intergenic
1043504299 8:80887264-80887286 TTTTCTCATTCAGTTGGCCTGGG - Intergenic
1043602643 8:81959494-81959516 TTCTCTCATTCTGTAGTCCATGG + Intergenic
1045466510 8:102475483-102475505 TCCTATCATTCTGTAATCCCTGG - Intergenic
1048344389 8:133565932-133565954 CCCTCTCTAACAGTTGTCCCAGG + Intronic
1049102269 8:140588256-140588278 TCCTTTCATTCAGGAATCCCAGG + Intronic
1049387784 8:142353080-142353102 CACTCTCATTCAGGTCTCCCGGG + Intronic
1049784181 8:144442774-144442796 TCATCTCATTCAGCTCTCCCTGG + Exonic
1051880403 9:21834183-21834205 TTGTCTCATTCAGTTTTCACGGG + Intronic
1053653785 9:40195453-40195475 TCCTTTCATACAGTGTTCCCAGG + Intergenic
1053904169 9:42824615-42824637 TCCTTTCATACAGTGTTCCCAGG + Intergenic
1054530815 9:66180898-66180920 TCCTTTCATACAGTGTTCCCAGG - Intergenic
1054857285 9:69914560-69914582 ACCTCTCACCCAGTTTTCCCTGG - Intergenic
1055026009 9:71722267-71722289 ACCACTTATTCTGTTGTCCCAGG - Intronic
1058140080 9:101348331-101348353 TCCTCTAAGTCAGTGGTCTCTGG + Intergenic
1058578074 9:106424978-106425000 TCCTCTCTATCAGGTGTCCTGGG - Intergenic
1059226700 9:112679547-112679569 TCCTCTCATCCCGTTGTCTCTGG - Intergenic
1059494457 9:114697966-114697988 TCCTCACTCTCAGTTGTCCATGG - Intergenic
1060883515 9:127135052-127135074 TCATCACATTCAAGTGTCCCAGG - Intronic
1186553905 X:10536752-10536774 TCCTCTCTTTCTGTTTTCCCAGG - Intronic
1187995946 X:24926792-24926814 TACTCTCATTTAGTTGTTCTGGG + Intronic
1191997362 X:67110064-67110086 CCCTCTCATCCAGATGTCCCAGG + Intergenic
1192785411 X:74330159-74330181 TCCTCTCATTCACTGCTCTCGGG + Intergenic
1196728496 X:118918794-118918816 TCCTCTCAGTCAAGTTTCCCTGG - Intergenic
1197116590 X:122840976-122840998 TCCTCTCATCAAATTATCCCAGG - Intergenic
1197290078 X:124645085-124645107 TTCTCTCACTCAGTTGTCCAAGG - Intronic