ID: 960201505

View in Genome Browser
Species Human (GRCh38)
Location 3:114842406-114842428
Sequence AAGTTTTTAAAGAAGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960201505_960201510 25 Left 960201505 3:114842406-114842428 CCTTACCCCTTCTTTAAAAACTT 0: 1
1: 0
2: 2
3: 29
4: 384
Right 960201510 3:114842454-114842476 ATTAAGATAATTTGTGGATATGG 0: 1
1: 0
2: 3
3: 42
4: 691
960201505_960201509 19 Left 960201505 3:114842406-114842428 CCTTACCCCTTCTTTAAAAACTT 0: 1
1: 0
2: 2
3: 29
4: 384
Right 960201509 3:114842448-114842470 TTAGTTATTAAGATAATTTGTGG 0: 1
1: 0
2: 2
3: 42
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960201505 Original CRISPR AAGTTTTTAAAGAAGGGGTA AGG (reversed) Intronic
900761832 1:4477626-4477648 AAATTCTTAAAGACAGGGTATGG - Intergenic
901991074 1:13114404-13114426 AATTTTTTAAAAAAGAGGCAGGG + Intergenic
906354005 1:45087177-45087199 AAAATTTTAAAGAAGGGGCCAGG - Intronic
906429932 1:45748363-45748385 AATTTTTTAAAGAGGGTGAAAGG + Intronic
906446878 1:45908356-45908378 AAGTTTTTAATGCAGAGGTATGG + Intronic
907228021 1:52967662-52967684 CTGTTTTGAAAGAAGGGGTCAGG + Intronic
907914104 1:58853093-58853115 AATTTTGTGAAAAAGGGGTAGGG - Intergenic
909815347 1:79985326-79985348 AAGCTTGTAAATAAGGGGGAAGG + Intergenic
911010509 1:93276035-93276057 AATTTTTTAAAGCAGTGGTAGGG + Intronic
911944288 1:104086518-104086540 TAGTTTTTAAAGAAGGGACAAGG + Intergenic
912880341 1:113406114-113406136 ATTTTTTTAAAGATGGGGTTTGG - Intronic
913092262 1:115484815-115484837 AAGTTTTTAAAGAAGACAGAGGG + Intergenic
914241218 1:145854358-145854380 AAGTTGTCAAAAAAGAGGTATGG + Intronic
914293382 1:146296309-146296331 AAGTTTTTAAAGGACTGCTAAGG + Intergenic
914554426 1:148747092-148747114 AAGTTTTTAAAGGACTGCTAAGG + Intergenic
915527176 1:156483109-156483131 AAGCTATTACAGAAGGGGAAGGG - Intronic
918568236 1:185955816-185955838 AAGTAATGAAAGAAGGGCTAGGG - Intronic
918995883 1:191758952-191758974 AAAATTTTAAAAAAGGGATATGG - Intergenic
919663214 1:200268349-200268371 TAATTTTTAAAGACAGGGTAGGG - Intergenic
919958481 1:202441736-202441758 AAGTTACTACAGAAGGGGAAAGG - Intronic
922024725 1:221739784-221739806 CAGTCTGTAAAGAAGGGGAAGGG + Exonic
922121572 1:222674453-222674475 AAGTTTGGAAATTAGGGGTAAGG - Intronic
922391829 1:225151575-225151597 AAGTTTTTAAACTGGGGCTAGGG + Intronic
922970107 1:229729036-229729058 GGGTTGTTAAAGAAGGGGTTTGG - Intergenic
1063981200 10:11453254-11453276 AAGTTTTTATTGTAGTGGTAGGG - Intergenic
1067463845 10:46479010-46479032 AAGTTGTTAATGGAGGGGAAGGG - Intergenic
1067623350 10:47905641-47905663 AAGTTGTTAATGGAGGGGAAGGG + Intergenic
1067818300 10:49501415-49501437 AAGATTTTAAATAAGGAATATGG + Intronic
1068702986 10:60039703-60039725 ATTTTTTTAAAAAAGGGGTTGGG + Intronic
1068799907 10:61128490-61128512 AAGGTTTCATAGAAGAGGTAGGG + Intergenic
1070694236 10:78550180-78550202 AAGATTTTATACAAGGGGTGTGG + Intergenic
1070952173 10:80440248-80440270 TATTTTTTAAAGATGGGGTGTGG - Intergenic
1073308064 10:102518837-102518859 CAGCTTTTAAAGAAAGGGTCTGG + Intronic
1074630135 10:115244903-115244925 AAATTATTTAAGAATGGGTAGGG + Intronic
1076126358 10:127977302-127977324 AATTTTATAAAGAAAGGATATGG - Intronic
1076712165 10:132343474-132343496 AGCTTTTTAAAGAAGGAGTTTGG + Intronic
1078184240 11:9038252-9038274 AAGATTACAAAGAGGGGGTAGGG + Intronic
1079118588 11:17658284-17658306 CAGTTTTTAAAAATGGGCTAAGG + Intergenic
1080142661 11:28941518-28941540 AAGTTCTAGAAGAAGGGGTTAGG - Intergenic
1081521365 11:43884910-43884932 AATTTTTTAAAAAAGGAGCAAGG - Intronic
1082631355 11:55545915-55545937 AAGATTGTAAAGATGGAGTAAGG - Intergenic
1082801485 11:57418154-57418176 AATTTTCTAGAGAAGGGGTGAGG - Intronic
1082835542 11:57648040-57648062 AAGTCTTTAACCAAGGGCTAAGG - Exonic
1083078730 11:60068554-60068576 AAATTTTTAAAAAATTGGTAAGG - Intronic
1084134150 11:67162888-67162910 AATTTTTTAGAGATGGGGTCTGG + Intronic
1084617579 11:70246644-70246666 AAGTTTTGCAAGAGGGAGTAAGG - Intergenic
1085138213 11:74114006-74114028 AAGGCTTTGAAGAAGAGGTAGGG - Intronic
1085672751 11:78484214-78484236 TAGTTTTTATATAAGGTGTAAGG - Intronic
1085686620 11:78628999-78629021 AAATTTTTTAAAAAGGGGCAGGG - Intergenic
1085807085 11:79646260-79646282 GAGTTTTTACAGTAGGGGAAAGG - Intergenic
1085840705 11:80008735-80008757 AGGTTCATAAAGAAGGGGAAAGG - Intergenic
1086430271 11:86730616-86730638 AATTTTTTATATAAGGTGTAAGG + Intergenic
1087767305 11:102169600-102169622 AAGTTTTTAAAAAAGGTATTTGG - Intronic
1088782718 11:113151697-113151719 AAGCTTTTAATGCAGGGGCAAGG + Intronic
1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG + Intronic
1090627782 11:128621095-128621117 AAATTGTTAATGAAGTGGTATGG + Intergenic
1091471986 12:736742-736764 AACTTTTTAAAGTAGTGGTCAGG + Intergenic
1092302493 12:7265185-7265207 CTGTTTTAAAAGAAGGGGTGGGG + Intergenic
1092619117 12:10244120-10244142 AATTTTTTAAAGGATTGGTAAGG + Intergenic
1092967864 12:13662202-13662224 TAGATTTTAGAGAATGGGTATGG - Intronic
1093282755 12:17215835-17215857 AAGATTTGAAAGAAGGAGCAGGG - Intergenic
1093884991 12:24449184-24449206 GAGGTTTGTAAGAAGGGGTAAGG - Intergenic
1094559923 12:31542658-31542680 AAATTTTTTAAAAATGGGTAGGG + Intronic
1094758339 12:33497921-33497943 AATTTTTTATATAAGGTGTAAGG - Intergenic
1095162307 12:38932860-38932882 AGGTTTTGGAAGAAGGCGTAGGG + Intergenic
1097005249 12:55912025-55912047 AAGTTTTTAAAATAGAGATAGGG - Intronic
1097598682 12:61665869-61665891 AAATTTTTTAAGAAGGAGTTTGG + Intergenic
1099987210 12:89680553-89680575 GATTTTTTAAAAAAGGAGTAAGG + Intronic
1100638560 12:96459161-96459183 AAGGTTTAAAAAATGGGGTATGG - Intergenic
1101354813 12:103966723-103966745 AAATTTTTAAAAAATGGATATGG + Intronic
1105550864 13:21394730-21394752 ATCTGTTTAAATAAGGGGTATGG + Intronic
1105613984 13:21995985-21996007 AAGATTTTAAAGACAGGGTAAGG + Intergenic
1106253082 13:27998070-27998092 AATTTTTTAAAGAAGTGCTAGGG + Intergenic
1106638154 13:31553273-31553295 AAGTTTTGTAGGAAAGGGTAGGG - Intergenic
1106682053 13:32018244-32018266 AAGATTTTATAGAAAGGGAAAGG + Intergenic
1107010852 13:35669529-35669551 CTGTTTTTAAAGAAGGTTTAAGG + Intronic
1107339353 13:39389403-39389425 AAACGTATAAAGAAGGGGTATGG + Intronic
1108560366 13:51637251-51637273 AAATTTTTAAAAAAGGGGATGGG + Intronic
1109715459 13:66216135-66216157 AAGTTTTTAGAGAAGCAGAATGG - Intergenic
1109733091 13:66442381-66442403 AAGTTTCTAAACAAAGGTTATGG + Intronic
1109847764 13:68019227-68019249 AAATTTTTAAAGTAGATGTATGG + Intergenic
1110384523 13:74893281-74893303 AAATATTTAAATAAGGGATAGGG + Intergenic
1111867238 13:93784461-93784483 ATGTTTTTGAGGAAGGGGTTTGG - Intronic
1112746318 13:102531234-102531256 AATTTTTTAAAGAGGGTGCAGGG + Intergenic
1114565520 14:23629773-23629795 GAGTTTTCAAAGAAAGGGTTTGG - Intergenic
1116075909 14:40110620-40110642 AAGTTTTTAAAAAATGATTATGG + Intergenic
1117232325 14:53733279-53733301 CAGTTTTTAAAGATGGGCAAAGG + Intergenic
1117850968 14:59968950-59968972 CAGTTTTTAAAGACTGAGTATGG + Intronic
1118018765 14:61689535-61689557 AAATCTTGAAAGAAGGGGCAAGG - Intergenic
1119368774 14:74119798-74119820 CAGTTTTTAAAGATGGGCAATGG - Intronic
1119839303 14:77779475-77779497 AAGATTTTCAAGAATGTGTATGG - Intergenic
1120194760 14:81469427-81469449 AAGTTTATACATAAGGGGTCGGG - Intergenic
1120359916 14:83486160-83486182 AAAATTTTAAAGGAGGGGTGGGG + Intergenic
1120961454 14:90128790-90128812 AGATTTTTAAAAAAGGGGAATGG - Intronic
1121239925 14:92421806-92421828 AAGTTTTAAAACATGGTGTATGG - Intronic
1122188853 14:100023763-100023785 AAGTTTTTAAAAAAGGCAAAAGG - Intronic
1124611307 15:31211130-31211152 ATGTTTTTAAAAAGGGTGTATGG + Intergenic
1124945014 15:34257192-34257214 AAATTTCTAAGGAAGGGATAAGG + Intronic
1125141233 15:36410225-36410247 CATTTTTTAAAAAAGGGGCATGG - Intergenic
1126343515 15:47669231-47669253 AAATTTTAAAATAAGCGGTAAGG - Intronic
1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG + Intronic
1127715840 15:61648627-61648649 AATTTTTTAAAAAATGTGTATGG - Intergenic
1127984349 15:64057881-64057903 AATTTTTTAAAGGAGAGGGAAGG + Intronic
1128446373 15:67764937-67764959 AAGTTTAAAAAGAAAAGGTAAGG - Intronic
1128814183 15:70594247-70594269 AATTTTTCAGAAAAGGGGTAAGG - Intergenic
1129040096 15:72678477-72678499 AAGTTTGTAGAGATGGGGTCTGG + Intronic
1129145103 15:73639910-73639932 ACCGTTTTAAAGAAGGGGTCCGG - Intergenic
1130137321 15:81192303-81192325 AAATTTTTAAAAAAGTGGTTGGG + Intronic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1133547769 16:6824737-6824759 AAGTTTTTAAAGAAAGCTTTTGG - Intronic
1134117560 16:11560685-11560707 AAGGTTATAGAGAAGGGGAAAGG + Intronic
1135252376 16:20911900-20911922 AAGTTTTTAAATAAGTTGTTGGG + Intronic
1135560556 16:23473115-23473137 AAGTTTTTAAAGAACAACTAAGG + Intronic
1136524750 16:30821861-30821883 CTGTTTTGAAAGAAGGGGTCAGG - Intergenic
1136934057 16:34442615-34442637 AAGTTTGTAAAGAACAGGGATGG - Intergenic
1136970515 16:34969199-34969221 AAGTTTGTAAAGAACAGGGATGG + Intergenic
1138423424 16:56914697-56914719 AGAGTTTTAAAGAAGGGGCAAGG + Exonic
1138801028 16:60030168-60030190 AAGTTTTTAAAGAAATGAAATGG + Intergenic
1139345316 16:66299406-66299428 AAGCTCTTAAAGAAGGAGCATGG - Intergenic
1139746933 16:69082410-69082432 AGATTTTTAAAGTAGGGGCAAGG + Intronic
1140604403 16:76517192-76517214 AGGAGGTTAAAGAAGGGGTAAGG + Intronic
1141312238 16:82925594-82925616 AAGGTTTTTAGGAATGGGTATGG + Intronic
1144056969 17:11551855-11551877 AAATTTTTAAAGAAGAGTTCAGG - Intronic
1145931396 17:28688326-28688348 AATGTTTTAAAGAAAAGGTAAGG + Intronic
1146861914 17:36310081-36310103 AAATTTTTAATGAAAGAGTAAGG + Intronic
1147092242 17:38114185-38114207 AAATTTTTAATGAAAGAGTAAGG + Intergenic
1147104967 17:38206314-38206336 AAATTTTTAATGAAAGAGTAAGG - Intergenic
1148424533 17:47582150-47582172 AAATTTTTAATGAAAGAGTAAGG + Intronic
1148659230 17:49314458-49314480 AATTTTTTAAAGAAACAGTAAGG - Intronic
1150770503 17:68036692-68036714 AAGATTTCAAAGATGGAGTATGG + Intronic
1150958250 17:69885948-69885970 AAGTACTTAAAGAAAAGGTAAGG - Intergenic
1150980770 17:70139183-70139205 AAGTATTTAAAGAAGTGGCCGGG + Intergenic
1151514602 17:74584708-74584730 CTGTTTTGAAAGAAGGGGTCAGG - Intronic
1151980560 17:77506112-77506134 AAATTTTAAAAGTAGAGGTAGGG + Intergenic
1155622450 18:27795092-27795114 AAATTTTTAAAGCTGGGGTTGGG + Intergenic
1155993460 18:32304903-32304925 TATTTTTAAAAGGAGGGGTATGG + Intronic
1156798955 18:41085024-41085046 AAATTTTTAAAAAAGTAGTAGGG + Intergenic
1156975014 18:43210407-43210429 AACTTTTTAAAAAATGGGCAAGG + Intergenic
1157208823 18:45723496-45723518 AAATTTAAAAAGAAGGGGGAAGG + Intergenic
1158380980 18:56929690-56929712 AAATTTTTAAATAATGGGGATGG + Intronic
1158407525 18:57173349-57173371 GAATTTTTAAAGAAGGGTTCTGG - Intergenic
1159686775 18:71431476-71431498 AAATTTTTCACGAAGGGGTCTGG + Intergenic
1161787966 19:6339971-6339993 AGGTTTTTAAAAGAGGGGTTTGG + Intergenic
1162257944 19:9508098-9508120 CTGTTTTAAAAGAAGGGGTCAGG + Intergenic
1162258694 19:9514701-9514723 CTGTTTTAAAAGAAGGGGTTGGG + Intergenic
1162684264 19:12368661-12368683 GGGTTTTTAAAGAAAGGGTTTGG - Intergenic
1163222071 19:15929007-15929029 AAGATTTTAAAGCAAGGGGAAGG - Intronic
1163906618 19:20154300-20154322 TTGTTTTAAAAGAAGGGGTCAGG + Intergenic
1164973405 19:32551551-32551573 AACTTTTTAAAAAAGAGGCAGGG - Intergenic
1165327036 19:35120053-35120075 AAGTTTTTAGAGAACTGGCAGGG - Intronic
1165407746 19:35641460-35641482 AAGGATTCAATGAAGGGGTATGG + Intergenic
1167820139 19:51920324-51920346 ACATTTTAAAAGAAGGGGTCAGG - Intronic
925534161 2:4899041-4899063 ATGTTTTAAAAGAAGGTGCATGG + Intergenic
925700586 2:6633324-6633346 GAGATTTCAAGGAAGGGGTAAGG - Intergenic
925861980 2:8187476-8187498 AAGATTTTGAAGAAGGGGAATGG + Intergenic
926185075 2:10683973-10683995 AAGTTTCTTAAGAAGGAGAAAGG + Intronic
927814736 2:26204970-26204992 AAGTGTTTAAGGAAGGGATAAGG - Intronic
928704126 2:33929420-33929442 AAGTTTTAAAAGAAGGTGGAAGG - Intergenic
929176118 2:38978030-38978052 CAGTTTTTCAAATAGGGGTATGG + Intergenic
930228296 2:48817042-48817064 TAGTTTTTAAAGCAGCGATAAGG + Intergenic
931271518 2:60707967-60707989 TTGTTTTTAAAGAAGTGGGATGG - Intergenic
931800314 2:65751524-65751546 TAGTGTTTGAAGAAGGGCTAAGG + Intergenic
933026374 2:77264410-77264432 GAGTTTATAAGGATGGGGTATGG - Intronic
933040597 2:77460765-77460787 AAGTTTTAAAACAAAAGGTAAGG + Intronic
933786756 2:85849219-85849241 AATTTTTTAAAAAATGGGTCAGG + Intronic
934077221 2:88438624-88438646 TTGTTTTTAAAGGAGAGGTAGGG - Intergenic
934157069 2:89213262-89213284 AAGTTTTGGTAGAAGGGGTCAGG - Intergenic
934161454 2:89253383-89253405 CAGTTTTCATAGAAGGGGTAAGG - Intergenic
934205825 2:89929032-89929054 CAGTTTTCATAGAAGCGGTAAGG + Intergenic
934210247 2:89969483-89969505 AAGTTTTGGTAGAAGGGGTCAGG + Intergenic
935000717 2:99011767-99011789 AATTTTTTAAATAATGAGTATGG + Intronic
935973726 2:108556967-108556989 ACTGTTTTAAAGAAGGGGTCAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936582279 2:113711883-113711905 ATGTTTTTAAAGAAGGATAAAGG - Intronic
937165347 2:119809403-119809425 AAGTTTTTTAAAAAAGGGAAGGG + Intronic
937981006 2:127615395-127615417 AACTTTTAAAGGAAGGGGTCAGG + Intronic
938641288 2:133283172-133283194 GAGATTTTAAAGAAGAGGAAGGG + Intronic
938722881 2:134081928-134081950 AAATTTTAAAAGAAGGGGAGCGG - Intergenic
938868387 2:135448758-135448780 AACTTTGTAAAGAAGGGGAGAGG + Intronic
939145084 2:138403912-138403934 CTGTTTTAAAAGAAGGGGTCAGG - Intergenic
939167110 2:138651947-138651969 AAGGTTTTAAATAAGGGGTTGGG + Intergenic
939732096 2:145797248-145797270 AAATTATTAAAGAAAGGGAAGGG + Intergenic
939762874 2:146206079-146206101 AACATTTTCAAGAAGGGATACGG + Intergenic
940971145 2:159898278-159898300 AAGTTTTAAAAGAAGAAGAAAGG - Intronic
941545006 2:166838349-166838371 AAGAATTTAAAAAAAGGGTAAGG + Intergenic
943090434 2:183367807-183367829 TAATTTTTGTAGAAGGGGTAAGG + Intergenic
943884742 2:193201933-193201955 AATTTTTTAAAGAAGCTGTGAGG + Intergenic
944347846 2:198689730-198689752 TAATTTTTGAAGAAGGTGTAAGG - Intergenic
944497683 2:200325145-200325167 AATTGTTTAAATGAGGGGTAAGG - Intronic
944876951 2:203972045-203972067 AACTTTCTCAAGAAGGGGTATGG - Intergenic
945085806 2:206131036-206131058 AATCTTTTAAAGAAGAGGTCTGG + Intronic
945319012 2:208399999-208400021 GGGTTATTAATGAAGGGGTAAGG - Intronic
945842487 2:214904773-214904795 GGGTTTTTAAAGAAAGGGTTTGG + Intergenic
945956666 2:216092644-216092666 ACATCTTTAAAGAAGGAGTAAGG + Intronic
946096607 2:217279878-217279900 AAGGTTTTAAAGAAGGGATGGGG - Intergenic
946221850 2:218234349-218234371 TAGTTATTAAAGAGGGTGTACGG + Exonic
946477333 2:220020277-220020299 AAGGGTTTCAAGAATGGGTAAGG + Intergenic
946993745 2:225366741-225366763 CAATTTTTAAAGAATGGGTGAGG - Intergenic
947855104 2:233318679-233318701 CAGTTTTTAAAGTAGGTGTCTGG + Intronic
948023817 2:234759731-234759753 AAGTTTTTAAAAAATGGGTAAGG - Intergenic
948661971 2:239513093-239513115 AGGTTTTTAATGAACCGGTATGG + Intergenic
1168777979 20:463870-463892 TAGTTTTTATAGAGGGGGTGGGG + Intergenic
1169721211 20:8678697-8678719 AAGTTTAGAAGGAAGGAGTAGGG - Intronic
1170284889 20:14695949-14695971 AAGTTTATAAAGCAGGGGAAAGG + Intronic
1170610484 20:17908741-17908763 AAAATTTTAAAAAAGGTGTATGG + Intergenic
1170740886 20:19054958-19054980 AAGTTTTTAGAGGAGGGAGAAGG - Intergenic
1171139643 20:22729713-22729735 GAGGGTTTAATGAAGGGGTATGG + Intergenic
1172423858 20:34841848-34841870 AAATTTTTAAAGAAGTGGCCAGG + Intergenic
1174236046 20:49092839-49092861 GATTTTTTAAAAAAGGGGGAAGG - Intronic
1176963708 21:15188335-15188357 AACCTCTTAAAGATGGGGTATGG + Intergenic
1177970671 21:27785740-27785762 AATTTTTAAAATAAGGGTTAGGG - Intergenic
1178003452 21:28190534-28190556 ATATTTTTAAAGAAGAGTTATGG - Intergenic
1178219657 21:30641842-30641864 AACTTTTTAAAGAATGCTTAAGG + Intergenic
1179112053 21:38455845-38455867 AATTTTTTAAATAATTGGTACGG + Intronic
1181283655 22:21736647-21736669 ATTTTTTTAAAGAAGGGATACGG - Intergenic
1181840164 22:25650608-25650630 AAGTTTTACAAGAAGAGGGATGG + Intronic
1182720754 22:32397136-32397158 AAACTTTTAAAGAAGGAGTCAGG - Intronic
949118040 3:352752-352774 AAGCTTATAAAGAAGGGTTAAGG + Intronic
951636568 3:24785008-24785030 AATTTTTTAAAGAAGGTCTTGGG + Intergenic
951842247 3:27046968-27046990 AGGTTTTTAAAGAGAGGGTTTGG - Intergenic
953475332 3:43201190-43201212 AAGTTTTTAAAGAATGAGGAAGG - Intergenic
954326623 3:49867599-49867621 AAGTTTTAAAACAAGGGGAGGGG + Intronic
955402853 3:58605727-58605749 AAGATTATAGAGAGGGGGTAAGG - Intronic
955761902 3:62294491-62294513 AAGTTTTTAAAAGAGGGAGATGG + Exonic
956264385 3:67380660-67380682 AACTTGTTACAGAAGGGGAAAGG + Intronic
956386645 3:68726146-68726168 ATCTTTTTAAAGAAGAGGAATGG + Intergenic
956872789 3:73434887-73434909 AAGTTTTTAGAAAAGGTGTCAGG - Intronic
957839386 3:85647754-85647776 CATTTTTTTAATAAGGGGTAGGG - Intronic
958773197 3:98450332-98450354 AAGTTGTTAAAGCAGCGGCAGGG - Intergenic
958915529 3:100046037-100046059 TATTTTTTAAGGAAAGGGTATGG + Intronic
959395482 3:105832091-105832113 AATTCTTTAAAGAAGGTATAAGG + Intronic
959558054 3:107746050-107746072 AAGTTCTAAAAAAAGGGGGAGGG - Intronic
960201505 3:114842406-114842428 AAGTTTTTAAAGAAGGGGTAAGG - Intronic
960256162 3:115513403-115513425 AATATTTTAAAGAAGTGGCATGG - Intergenic
960899103 3:122536536-122536558 AATTTATTAGAGAAGGGGCAGGG - Intronic
962109926 3:132433900-132433922 AGGTTTTTAAAGACGGGGACTGG - Intronic
962611281 3:137078634-137078656 AAGTTTTAAAATAAGAAGTAAGG + Intergenic
963743151 3:149099003-149099025 AAGTTTATAAAAATAGGGTAAGG + Intergenic
964528472 3:157641657-157641679 CAGTTTTTAAAAAAGAGCTATGG + Intronic
964540750 3:157776674-157776696 AAGTTTTTAAAAAATGTGTGTGG + Intergenic
966237904 3:177722856-177722878 AAGTTATTGAAGAAGGCTTAGGG + Intergenic
966845245 3:184123726-184123748 AAGTTTTCATAGGAGGGGCATGG - Intergenic
967540996 3:190667677-190667699 AAGTTTTTGAAGATCGGCTAAGG - Intergenic
967908839 3:194524415-194524437 AAGTTTTTAAAACAGAGGCAGGG - Intergenic
968888469 4:3351931-3351953 AAGATTCTAAATAATGGGTATGG - Intronic
969063639 4:4460029-4460051 CAGTTTATAAAGAAGGATTAGGG - Intronic
970142717 4:12999700-12999722 ACGTTGTTAACTAAGGGGTAAGG + Intergenic
970494754 4:16614231-16614253 AAGGTGTTAAGGAAGGGGTCTGG - Intronic
970739021 4:19210970-19210992 AAGTTTTTAAAAAAGGGACAGGG + Intergenic
970774885 4:19661889-19661911 ATGCTTTTAAAGAAGGGGCTGGG + Intergenic
970870108 4:20806824-20806846 GGGTTTTGAAACAAGGGGTATGG + Intronic
971534121 4:27726833-27726855 AATTTTTTAAAGCAGCAGTATGG - Intergenic
972930212 4:44063284-44063306 AAGTGTTCAAAGAAGTGGCATGG + Intergenic
973080649 4:45988338-45988360 AATTTTTTAAAGAAAAGATAAGG + Intergenic
973181341 4:47272319-47272341 ATTTTTTTAAAGAAGGGGAGGGG - Intronic
973233055 4:47864762-47864784 GAGGTATGAAAGAAGGGGTATGG - Intronic
973857588 4:55028829-55028851 AATTTTTAAAAGCAAGGGTATGG - Intergenic
974120850 4:57637232-57637254 TAGTTTTTAAAGACAGGGTAAGG - Intergenic
975280813 4:72560156-72560178 TAATTTTTAAATAAGGTGTAAGG - Intronic
977236624 4:94515239-94515261 AAGATATTAAAGAAGAGGCAAGG - Intronic
977924760 4:102687359-102687381 AGGATTTTAAGGAGGGGGTAAGG - Intronic
978232196 4:106413144-106413166 AAATTTTTAAAGAAAAGGAAGGG - Intergenic
978815611 4:112901435-112901457 AAGTTTTTAAATAAAGTTTAGGG + Intronic
979918670 4:126472217-126472239 AACTTTTTAACGAAGGAGTTTGG + Intergenic
979998257 4:127459287-127459309 TAATTTTTACATAAGGGGTAAGG + Intergenic
980025397 4:127760267-127760289 AAGTTTTTTAAAAAATGGTAAGG + Intronic
980331767 4:131419775-131419797 AAGTTGTCAAATAAGTGGTATGG + Intergenic
980353298 4:131711303-131711325 AAATTTTTAAAGATAGAGTAAGG - Intergenic
980947873 4:139340790-139340812 AAGCTTAAAAAGAAGGGGAAGGG - Intronic
981087759 4:140701455-140701477 AAGTTTTAAAAGAAGCGTTAGGG - Intronic
981712852 4:147726030-147726052 ATGTCTTTAAGGAAAGGGTATGG + Intergenic
982573457 4:157078097-157078119 AAGTCTTCAAAGAAAGGGAAGGG + Exonic
983256051 4:165401891-165401913 ATGTGTTTAAAGTAGGGGTCGGG + Intronic
983939051 4:173522827-173522849 ATGTTTAGAAAGAAGGGGGAGGG - Intergenic
984769664 4:183426447-183426469 AAGTTTTTAAAGAAAGAATTTGG - Intergenic
988008885 5:25456813-25456835 AAGTTTATAAAGAAAGGCAAAGG + Intergenic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
989412509 5:41136654-41136676 TAATTTTTATATAAGGGGTAAGG + Intergenic
989967219 5:50478598-50478620 CAGGTTTTATAGAAGGGGGAAGG + Intergenic
990353485 5:54941628-54941650 AATTTTTTAAAGAGGGGAAAAGG + Intergenic
992240375 5:74763406-74763428 TTGTTTTTGAAGGAGGGGTAGGG - Intronic
992469053 5:77037127-77037149 AAGTTTTTAAAATAAGGTTAAGG + Intronic
992851624 5:80815670-80815692 AATTTTTTAAAAAAAGGGTGTGG - Intronic
993492504 5:88569265-88569287 GAGTTTTTAGAAAAGGGGGAAGG - Intergenic
994149994 5:96436046-96436068 GAGATGTTAAAGAATGGGTAAGG + Intergenic
994579101 5:101615852-101615874 AAGTTTCAAAAAAAGAGGTAAGG + Intergenic
995795051 5:115932249-115932271 AAGCTTTTAAAAAGAGGGTAGGG + Intergenic
995933162 5:117475593-117475615 TATTTCTTAAAGAAGGGATAAGG + Intergenic
995979871 5:118088441-118088463 AAGTGTTTTAAGAAGGGAAATGG - Intergenic
996203701 5:120704143-120704165 AGCTTTTTAAAAAAGGGGTATGG + Intergenic
996240891 5:121199912-121199934 AAGTTTGTAATGAAGGATTAGGG + Intergenic
996549131 5:124711875-124711897 AGGATTTTAAAGTAGGGGCACGG + Intronic
997914069 5:137906707-137906729 ACATTTTTTAAGTAGGGGTAGGG - Intronic
998462730 5:142321545-142321567 GAGTTTTTAAGGAAGGGAAATGG - Intronic
998970691 5:147588810-147588832 AAATTTTTGAAAAAGTGGTATGG - Exonic
1000645331 5:163754615-163754637 GGGTTTTTAAAGAAAGGGTTTGG - Intergenic
1000709052 5:164548101-164548123 TAGTTTTTGTAGAAGGTGTAAGG + Intergenic
1000855041 5:166387695-166387717 AAATTATTAATGTAGGGGTAGGG + Intergenic
1001452484 5:171837113-171837135 AAATTTTTAAAAAAGGGATTTGG + Intergenic
1001953719 5:175833790-175833812 AAGTTTTCAAAGAAGGGGCCTGG - Intronic
1003529475 6:6925856-6925878 AAGTTCAAAAAGAAGGGTTAGGG - Intergenic
1004014732 6:11721604-11721626 AACTTTTTAAAGAAGAGAAAGGG - Intronic
1004089505 6:12486710-12486732 AATTTTTTAAAGAAGGGTATTGG - Intergenic
1004254107 6:14047132-14047154 AAGTTTCTACTGAATGGGTATGG + Intergenic
1004463739 6:15863497-15863519 AAATTTTTAAAGAAGGTGATAGG + Intergenic
1004565925 6:16797779-16797801 AACTTTTTGAAAAAGGGGTTAGG + Intergenic
1005467814 6:26132193-26132215 AAGTTTTTCTTGAAGAGGTATGG - Intronic
1005731674 6:28703254-28703276 AAGTTTTTAAAGAAAAGTTGAGG + Intergenic
1008835023 6:55816295-55816317 AGTTTTTTAAAGAAGAGATAAGG - Intronic
1008838723 6:55870515-55870537 AAGTTTTTTTTGAAGGGGGATGG - Intronic
1009772859 6:68165504-68165526 AATTTATTAGGGAAGGGGTAAGG + Intergenic
1010327100 6:74577099-74577121 AAATATTTAAGGAAGGGCTAGGG + Intergenic
1010485641 6:76409954-76409976 AAGTTTTCAAAGAAGAGCTCAGG - Intergenic
1010897916 6:81388789-81388811 AATTTTTTAAAAAAGAGGGAGGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011389672 6:86838177-86838199 GAGTTTTTAAAGAGAGGGTTTGG + Intergenic
1012064248 6:94529344-94529366 AAGCTATTAAAGAAGGAGAAAGG - Intergenic
1012349675 6:98234890-98234912 TAGTTTTTATATAAGGTGTAAGG + Intergenic
1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG + Intergenic
1014627203 6:123741559-123741581 AAGTTTTTGAAGGAGGCATAAGG - Intergenic
1015225615 6:130853694-130853716 AAGTGTTGAAAGTAGGGGGAGGG - Intronic
1015329947 6:131965436-131965458 AACTTTTTAAAATAGGGTTAGGG - Intergenic
1016094068 6:140014641-140014663 GAGTTTTGTAAGAATGGGTAAGG - Intergenic
1016227910 6:141762832-141762854 AAATTTATAAAGCAGTGGTAGGG + Intergenic
1016449035 6:144162150-144162172 AGCTTTTTAAAGAAGTGGGAGGG - Intronic
1016509035 6:144819299-144819321 ATGTTTTGATAGAAGGGGAATGG + Intronic
1016515131 6:144884673-144884695 AAGATTTTAAATAAGGGCTCTGG - Intergenic
1018179900 6:161213907-161213929 AATTTTTTAAAGTGGGGGTGGGG + Intronic
1018394513 6:163367374-163367396 AAGTTTTCAAGGAAAGGGAATGG - Intergenic
1018444501 6:163842731-163842753 AAGTTTTCACAGAATGGCTAGGG + Intergenic
1018642817 6:165920357-165920379 AATTTTTGAAAGAAGGAGTAAGG - Intronic
1021619330 7:22536103-22536125 CAGCTTTTAAAGAAGGAGCATGG - Intronic
1022259253 7:28688491-28688513 AAGTTTTTAAAGGAGATTTAAGG + Intronic
1022334405 7:29408668-29408690 AAGAATTTAATGAAGGGGCAAGG + Intronic
1022376940 7:29822969-29822991 AATTTTTTAAAGTAAGGATATGG - Intronic
1022733004 7:33048805-33048827 AAGTTTAAAAAGATGGGATATGG - Intronic
1023603173 7:41900871-41900893 AAGTATTTAATTAAGGAGTAAGG - Intergenic
1023840878 7:44096891-44096913 GTGATTTTAAAGAAGGGGCAGGG + Intergenic
1024999464 7:55302903-55302925 GGGTTTTTAAAGAAAGGGTTTGG + Intergenic
1026073999 7:67149111-67149133 AAATTTTTAAACAAGTGGTGAGG - Intronic
1026626113 7:71994082-71994104 AAATTTTTATAGTAGGGGTTGGG - Intronic
1026642331 7:72138795-72138817 CAGTTCTGAAAGAAAGGGTAAGG - Intronic
1027143388 7:75676815-75676837 AAGTTTTAAAAGAAAGGCTAAGG - Intronic
1027808808 7:82865646-82865668 AAGTTTTTAAAAAATGGTGAAGG + Intronic
1028148354 7:87344422-87344444 AAGATTTTAAATAAGGGATTAGG - Intergenic
1028371930 7:90101487-90101509 CAGCTTTTAAAGAAGGAGCATGG + Intergenic
1028893237 7:96012131-96012153 AAGTTTTGACAGAAGGTATATGG + Intronic
1028984360 7:96998223-96998245 AAGGTTTTCAAGAAGGGGGTGGG + Intergenic
1029083604 7:97994187-97994209 AAGTTTCTAAAGATTGGGTGTGG + Intergenic
1029919309 7:104245585-104245607 AATTTTTTATATAAGGTGTAAGG + Intergenic
1030840342 7:114344291-114344313 AAGTTTTTAAAGTGGGTATAGGG - Intronic
1031772032 7:125856115-125856137 AAGTTCTTAACAAAGGGATATGG - Intergenic
1032341638 7:131079401-131079423 AAGTTTTAAAATCAGGGGAATGG - Intergenic
1034358770 7:150475781-150475803 CAGGTTTTAGAGAATGGGTAGGG + Intronic
1036574629 8:10015206-10015228 AAGTTCTTAAAGAAGGGGAAAGG - Intergenic
1036680657 8:10870526-10870548 AAGTCTTTGAAGAAGGAGTGTGG + Intergenic
1037433770 8:18841861-18841883 AAGTCTTTAATGAAGGGATTAGG - Intronic
1038468205 8:27786239-27786261 ATCTTTTTAAAGAAGGGGTCGGG + Intronic
1042675928 8:71321836-71321858 TAGTTTGTGAGGAAGGGGTAGGG + Exonic
1043006804 8:74829991-74830013 AAGATTTTAGAGAAGGATTAGGG + Intronic
1043292589 8:78621606-78621628 AATTTTTGAAAGAAGGCGGAGGG - Intergenic
1044438635 8:92196349-92196371 AAGTTTTATCTGAAGGGGTAGGG + Intergenic
1044969846 8:97608150-97608172 AAGTTTTTAAAAAATTGGTCTGG + Intergenic
1045206933 8:100053080-100053102 AAGTTGTTAGAAAAGAGGTATGG - Intronic
1045429901 8:102103861-102103883 AAGTTTTTAAATAAGTGAGAAGG + Intronic
1045507663 8:102789915-102789937 AATTTTTTAAAGTAGAGGCAAGG - Intergenic
1046120217 8:109836949-109836971 AATTTGTTAAAGAAGGTGTAAGG + Intergenic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1047473804 8:125205577-125205599 TAGTTTTTGAAGTAGGGTTATGG - Intronic
1049909401 9:250856-250878 AAGCTTTTACAGAAGGGTGAGGG + Intronic
1051240969 9:15055276-15055298 AAGATTTTAACGAAGGTTTATGG + Intergenic
1051285309 9:15490028-15490050 AAGGTTTTAATGAAGGTTTATGG - Exonic
1051467685 9:17399109-17399131 AACTATTTAAAGAAGTGATAAGG - Intronic
1052480883 9:29024210-29024232 AAGTTTCTAAATATGGGGTTTGG - Intergenic
1052543974 9:29848917-29848939 AAGTTTCTAAAGAATAGGTAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053866519 9:42443543-42443565 AAGGTGTGAGAGAAGGGGTAGGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055471972 9:76620981-76621003 AAGGTTTTAAAGAAAAGATAAGG + Intronic
1056387848 9:86113830-86113852 AAATTTTTAAAGAAAGTGTTGGG - Intergenic
1059243880 9:112833014-112833036 AAATTTTTAAAGAAAAGATAAGG - Intronic
1059551048 9:115229475-115229497 ACTGTTTTAAAGAAGGGGTCCGG + Intronic
1059932784 9:119277912-119277934 AAGTTTTCTAAGCAGAGGTAGGG - Intronic
1059946991 9:119419196-119419218 AAATTCTTAGAGAAGGGGTCCGG - Intergenic
1060363323 9:122982240-122982262 TAGTTTTTAAGGAAGAGTTAAGG + Intronic
1060963159 9:127695713-127695735 CTGTTTTAAAAGAAGGGGTCGGG - Intronic
1186327916 X:8499952-8499974 AAGTTCTTAAATAAGGGTTTAGG - Intergenic
1186886103 X:13915253-13915275 CATTTTTTAGAGACGGGGTATGG - Intronic
1187077407 X:15948660-15948682 AAGTTTTTAAAAAATAGGGATGG - Intergenic
1188039554 X:25356272-25356294 ATGTCTTTAAAGAATGGCTAGGG + Intergenic
1188307112 X:28572128-28572150 GGGTGTTTGAAGAAGGGGTACGG - Intergenic
1190388496 X:49908877-49908899 AAGTTTTTAAGGAAAAGTTAAGG + Intergenic
1190501363 X:51081815-51081837 AACTTTTTAAAGAAGTTGTCAGG - Intergenic
1190728479 X:53208339-53208361 AAGTTTTTTAAAAAGCGGTAAGG + Intronic
1193125967 X:77870412-77870434 AAAATTTTAAAAAAGAGGTAAGG + Intronic
1194177941 X:90674710-90674732 AAGAATTTAAAGGAGTGGTATGG + Intergenic
1195606492 X:106811222-106811244 AAGTTTTAAAACAAGGTATAGGG + Intronic
1195695751 X:107665937-107665959 AAGTTTTAAAAGAAAATGTAGGG - Intergenic
1196243648 X:113372760-113372782 TAGTTTTTATATAAGGTGTAAGG - Intergenic
1197320669 X:125025776-125025798 AAGTTATTATACAAGGGGTTTGG - Intergenic
1197564345 X:128063377-128063399 AAATTTTTATATAAGGTGTAAGG - Intergenic
1197857759 X:130934880-130934902 AAGTTTTAAAAGCAGGGTTGAGG + Intergenic
1197895471 X:131309009-131309031 TAGTTTGTAAAGAGGGAGTAAGG + Intronic
1198587904 X:138143093-138143115 AAATTTGTAAAGAAGTGGCAAGG - Intergenic
1198873432 X:141199114-141199136 CTGTTTTAAAAGAAGGGGTCGGG + Intergenic
1199017521 X:142836059-142836081 CTCTTTTTAAAGCAGGGGTAGGG - Intergenic
1200299843 X:154962311-154962333 CAATTTTTAAAGAAGTGGAAAGG - Intronic
1200524608 Y:4256867-4256889 AAGAATTTAAAGGAGTGGTATGG + Intergenic
1200977412 Y:9227814-9227836 ATGGTTTTAAGGTAGGGGTAGGG - Intergenic
1201792043 Y:17852557-17852579 AAGTTAGAAAAGAAGGGTTAGGG + Intergenic
1201809511 Y:18053432-18053454 AAGTTAGAAAAGAAGGGTTAGGG - Intergenic
1202353642 Y:24022172-24022194 AAGTTAGAAAAGAAGGGTTAGGG + Intergenic
1202517137 Y:25647943-25647965 AAGTTAGAAAAGAAGGGTTAGGG - Intergenic