ID: 960203212

View in Genome Browser
Species Human (GRCh38)
Location 3:114863195-114863217
Sequence ACATATATCCATAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960203209_960203212 22 Left 960203209 3:114863150-114863172 CCAGGAGGACATTATAGCAAAAA 0: 1
1: 0
2: 1
3: 28
4: 320
Right 960203212 3:114863195-114863217 ACATATATCCATAAAGTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960203212 Original CRISPR ACATATATCCATAAAGTGGA GGG Intronic
900915846 1:5638045-5638067 ACAAATAACCATAAACTGGGGGG - Intergenic
907660195 1:56384648-56384670 AAATGAATCCATAAAATGGAGGG + Intergenic
908567302 1:65370394-65370416 ACACATATGCATGGAGTGGATGG - Intronic
908571397 1:65414388-65414410 AAATATATCCACAAAGCAGATGG + Exonic
909239776 1:73197540-73197562 ACATATATCCATATATTGAAAGG + Intergenic
909306677 1:74089379-74089401 AAAAATATCCATAAATTAGAAGG + Intronic
909509006 1:76429881-76429903 ACATATATCAATAAAAGGAATGG - Intronic
911654281 1:100425180-100425202 ACATACATACATACAGTAGAAGG + Intronic
912197578 1:107417258-107417280 ACATATATCCACAAAGGCAAAGG - Intronic
913005351 1:114624938-114624960 AGATATATTAATAAAATGGAAGG + Intronic
913992644 1:143628829-143628851 ACATGTAGCCATGAAATGGATGG - Intergenic
915758435 1:158286401-158286423 ACATCTATCCCTAAAAAGGAAGG - Intergenic
916940676 1:169673974-169673996 ACATATGTACATACAATGGACGG - Intronic
919384380 1:196900748-196900770 ACAAATATCCAAACAGTGGTCGG + Intronic
920197450 1:204238512-204238534 CCATCTAGCCATAAAGTGGGTGG + Intronic
924371251 1:243352767-243352789 GCATATGTACAAAAAGTGGAAGG - Intronic
1063234553 10:4099381-4099403 ACATTTAGCCATAAAGATGATGG + Intergenic
1063419163 10:5897518-5897540 ACATATATCCAATAAGTCCAAGG + Intronic
1063727945 10:8659953-8659975 AGATATATGCATAAAGAGGCAGG + Intergenic
1064835175 10:19519326-19519348 ACATATAAGCATGAAGTGAAAGG + Intronic
1066379638 10:34890337-34890359 ACATATATACAGAAAGAGGCCGG - Intergenic
1066551126 10:36558414-36558436 ACATATATATATAAAGTGTGTGG + Intergenic
1067361051 10:45579198-45579220 ACATATATGCATAAAAAGAAAGG + Intronic
1067531501 10:47077460-47077482 ACAAATATCCACAAATTGGGTGG + Intergenic
1068189709 10:53635393-53635415 ACATATAAACAAAAAGAGGAAGG - Intergenic
1068890810 10:62146790-62146812 ACATACATCCATACAATAGAAGG - Intergenic
1069985447 10:72279901-72279923 ACATATTTCCCCCAAGTGGAGGG - Intergenic
1072302361 10:94073605-94073627 ACTTAAAACCCTAAAGTGGAAGG - Intronic
1075126375 10:119703334-119703356 ACAAATGACCATAAAGTGGGTGG - Intergenic
1075177132 10:120175727-120175749 ACATGTATACCTAATGTGGAGGG - Intergenic
1078467406 11:11560426-11560448 AAAAATATCCTTAATGTGGAAGG + Intronic
1080712866 11:34767607-34767629 ACAAATAGACAGAAAGTGGAAGG - Intergenic
1085597759 11:77825591-77825613 ACAAATATCCAGAAAATGGTTGG - Intronic
1085763691 11:79263837-79263859 ACAGATTTCAATAAACTGGAGGG - Intronic
1087690130 11:101311255-101311277 ATATATATATATAAAATGGATGG - Intergenic
1091242161 11:134060516-134060538 ACATATAGACAAAAAGAGGAAGG - Intergenic
1091818306 12:3455755-3455777 ACAAATAGCCAGAAAGTGGAGGG + Intronic
1092122694 12:6055733-6055755 ATATATATATATAAAGTAGATGG - Intronic
1093307941 12:17542981-17543003 ACATATAGACATAAAGGGAAGGG - Intergenic
1093492611 12:19722545-19722567 CCAAATATCCATGAAGTGGTGGG + Intergenic
1093922338 12:24872891-24872913 ACATATGCCTAAAAAGTGGAAGG + Intronic
1096299644 12:50415586-50415608 ACATATAACAAAAAATTGGAAGG - Intronic
1096371559 12:51073243-51073265 ACATACATACATAAAATTGAGGG + Intronic
1097399045 12:59107748-59107770 ACCTATATCCATGATGTGAATGG - Intergenic
1097594716 12:61614921-61614943 ATATATATCTATAAACTGTAAGG + Intergenic
1097676770 12:62611498-62611520 ACATATATAAATAAGGTTGAAGG + Intergenic
1099925283 12:89009448-89009470 GCATATATACATATTGTGGAGGG + Intergenic
1101832040 12:108265867-108265889 ACATATTTACATCAAGTCGATGG + Intergenic
1103190752 12:118999871-118999893 ACAAATATACATAAAGTGTTTGG - Intronic
1104392011 12:128398865-128398887 AAAAATATCCGTTAAGTGGAAGG - Intronic
1106374217 13:29168871-29168893 ACACAGATTCATAAAGTGAAAGG - Intronic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1106912461 13:34477390-34477412 ACAAATACCCAAAAAGTGTAGGG - Intergenic
1109080207 13:57889589-57889611 TCATATTTCAATAAAGTTGAAGG - Intergenic
1109176030 13:59156841-59156863 ACATATATCAATAGAATAGAGGG + Intergenic
1109423181 13:62139737-62139759 AGATATATGCCTAAAGTGGGTGG - Intergenic
1110059857 13:71027505-71027527 ACATATTTCCATAAAACTGAAGG + Intergenic
1110485366 13:76034922-76034944 ACATACATGCATACAATGGAAGG + Intergenic
1111752751 13:92355710-92355732 ACATATGCCCATGCAGTGGATGG - Intronic
1112422241 13:99262859-99262881 ACATGTATCTATAAGGTTGAGGG + Intronic
1112731293 13:102365719-102365741 ACATATATACATAAACAGGTTGG - Intronic
1115027853 14:28764791-28764813 AGATACATACATACAGTGGAAGG + Intergenic
1115052805 14:29085143-29085165 ACATTTATCTATTAAGTGCATGG + Intergenic
1116232386 14:42234262-42234284 ACAAAGTACCATAAAGTGGATGG + Intergenic
1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG + Intronic
1120102357 14:80460051-80460073 ACATATGTCTGTAAATTGGATGG + Intergenic
1126860560 15:52878615-52878637 ACATATAAACACAAAGTAGAAGG - Intergenic
1130212668 15:81939573-81939595 ACATTGATCTAAAAAGTGGAAGG + Intergenic
1131745894 15:95446821-95446843 ATATATATATATAAAGTTGAAGG + Intergenic
1134483002 16:14634336-14634358 CCCTATATCCATAAACTTGATGG + Intronic
1135067424 16:19322281-19322303 ACACATCTCCATAATGTGGGTGG + Intergenic
1135080766 16:19432958-19432980 AAATATATACATAAATTGTATGG + Intronic
1138825008 16:60308570-60308592 ACAAATTTCCATAAATTGGGTGG + Intergenic
1139146979 16:64337238-64337260 ACATATATAAATAAAATGGCAGG - Intergenic
1140959022 16:79894929-79894951 ACATATAACCAAAAATGGGAGGG + Intergenic
1141684121 16:85560689-85560711 ACATACATACATACAGAGGAAGG - Intergenic
1149189058 17:54036642-54036664 ACAAATTACCATAAACTGGATGG + Intergenic
1151297179 17:73193899-73193921 ACATACATACATAAAGTTAAGGG - Intronic
1156874306 18:41988793-41988815 TCCTATATACATAAACTGGAAGG + Intronic
1159236213 18:65676381-65676403 ACCTATTACCATAAAATGGATGG - Intergenic
1164081078 19:21861916-21861938 AAATATATGCATCAAGTGCAAGG - Intergenic
1164292952 19:23883752-23883774 ACATCTTTCCATAAAATTGAAGG + Intergenic
1164819318 19:31233036-31233058 ACATATGTCCATAAAGAGACTGG - Intergenic
1165993481 19:39828914-39828936 ACGTATATCCTTAAAGTAAACGG - Intronic
928762852 2:34605028-34605050 AGATATATCAATTAAGTGGTGGG + Intergenic
929276812 2:40034756-40034778 ACATATAACCCAAGAGTGGAGGG + Intergenic
929389010 2:41446607-41446629 AAATATATACATATAGTTGAAGG - Intergenic
930826047 2:55698079-55698101 AAATACATTAATAAAGTGGAAGG - Intergenic
932174072 2:69583690-69583712 ACACATATCAAGAAAGTGGCAGG - Intronic
933039868 2:77450820-77450842 ACATATATATATAAAATAGATGG - Intronic
933136963 2:78749775-78749797 ACAGATAATCATAAAATGGAAGG + Intergenic
936696636 2:114957762-114957784 ACATATATCCTTAAAAAAGAAGG + Intronic
937515371 2:122649147-122649169 ACAAATATCCATAAATTGGGTGG + Intergenic
939097769 2:137854315-137854337 ACATACATGCATAAAGTATATGG - Intergenic
939097945 2:137857343-137857365 ACATATATGCATAAAGTATATGG + Intergenic
939200607 2:139030165-139030187 ACATATAGACTTAAAGTGAAGGG - Intergenic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
940968836 2:159871786-159871808 ACATATATACACAGAGAGGAAGG - Intronic
941429502 2:165396065-165396087 AAATATATTCATAAAATTGAAGG - Intergenic
941789475 2:169535604-169535626 ACAAAAATCCATAAATTGGCTGG - Intronic
942549740 2:177102662-177102684 CCAAATATCCAAAAACTGGAAGG + Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943820996 2:192320778-192320800 ATATATATGCATAGAGTGGCTGG - Intergenic
944063916 2:195599097-195599119 ACATATATCAATAAATTTGTAGG - Intronic
944997445 2:205309988-205310010 ATATATATACACAATGTGGAAGG + Intronic
945146661 2:206745337-206745359 ACAAATTACCACAAAGTGGATGG - Intronic
945807365 2:214506177-214506199 GTATATATCTTTAAAGTGGAAGG - Intronic
946685850 2:222268922-222268944 ACATATATACATAAAGGAGTAGG - Intronic
947064255 2:226202880-226202902 ACAATTTTCCATAAAGTAGAAGG + Intergenic
1169515154 20:6308963-6308985 AAATATACCCAGAAATTGGATGG + Intergenic
1170399481 20:15964874-15964896 ACACACATCAATAAAGTAGAAGG - Intronic
1175450472 20:59061452-59061474 ATATATACCAATAATGTGGAGGG + Intergenic
1175484908 20:59338898-59338920 AAATATTTCCATTGAGTGGAGGG - Intergenic
1175487940 20:59358733-59358755 AAATATTTCCATTGAGTGGAGGG + Intergenic
1177790463 21:25716960-25716982 ACACAAATCCATATTGTGGAAGG + Intronic
1178222924 21:30681438-30681460 GCATATTTCCATAAATAGGAAGG + Intergenic
949285638 3:2400521-2400543 ACAAATATCCACCAAGTGGCAGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951274946 3:20673647-20673669 ACATATATACATAATTTTGAAGG + Intergenic
951816591 3:26761772-26761794 AGCTTTATCCACAAAGTGGAAGG - Intergenic
955930098 3:64047831-64047853 ACATTTATCCAAATAGAGGATGG + Intergenic
958982982 3:100746387-100746409 ACATACAGCCATTCAGTGGAGGG + Intronic
959238392 3:103755141-103755163 ACATAAATCCATAAATGTGATGG + Intergenic
960203212 3:114863195-114863217 ACATATATCCATAAAGTGGAGGG + Intronic
961710967 3:128827897-128827919 CCATCTACCCATAAAGTGGGAGG - Intergenic
962606754 3:137038422-137038444 ACATATTTTCATAAAGTAGAAGG - Intergenic
964102478 3:153004185-153004207 ACATATTTCCTTAAAATAGAAGG + Intergenic
964298155 3:155257072-155257094 GCATATATGCATAAAGTGGTAGG + Intergenic
964519606 3:157550012-157550034 ACATATATACTGAAAGTGAAGGG - Intronic
966007403 3:175032834-175032856 ACATTTGGGCATAAAGTGGATGG + Intronic
966641726 3:182198703-182198725 ACAATAATCCATCAAGTGGATGG - Intergenic
966805778 3:183806333-183806355 ACACTCATCCAGAAAGTGGAAGG + Intronic
967601732 3:191398580-191398602 ACATATTTACAGAAAGTGTATGG - Intronic
969255373 4:5998028-5998050 AAATATATCCAAAAAGTGATTGG - Intergenic
969748642 4:9093852-9093874 ACAAAGAACCATAAAATGGATGG + Intergenic
970878167 4:20896725-20896747 ACAAATTTCCACAAACTGGATGG - Intronic
971206878 4:24579358-24579380 ACAAATATTTATGAAGTGGAGGG - Intronic
972015082 4:34233434-34233456 ACATATATAATTAAAGTGAAAGG - Intergenic
972646001 4:40967893-40967915 ACAGCTACCCATCAAGTGGAAGG + Intronic
974291303 4:59934494-59934516 AAACATTTCCATTAAGTGGAAGG - Intergenic
976554946 4:86439450-86439472 TGGTACATCCATAAAGTGGAAGG - Intronic
976645549 4:87383956-87383978 ACATTTATCCACAGAGAGGATGG + Intronic
977213891 4:94256045-94256067 ACAAAAATCCAGTAAGTGGATGG - Intronic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977631365 4:99247328-99247350 ACATAAATCCACAAAGCTGAGGG - Intergenic
977962305 4:103099926-103099948 ACATACATTTATAAAGTGTATGG - Intergenic
979421508 4:120510131-120510153 AGATAAATCCATAAAGAGGAGGG + Intergenic
980256798 4:130391764-130391786 ATATAATTCTATAAAGTGGAGGG - Intergenic
980387931 4:132111063-132111085 CCATCTAGCCATAAAGTGGGTGG - Intergenic
981418130 4:144517528-144517550 ACATATATATATATAGTAGAAGG + Intergenic
981435320 4:144714170-144714192 ACATATTTTCATAAAGTAAAAGG - Intronic
981547965 4:145914198-145914220 ACATATATCCAGAAAGAAAAGGG + Intronic
981603539 4:146519015-146519037 CCATATATCGAACAAGTGGAGGG - Intronic
983953231 4:173666979-173667001 AAGTGTATCCATCAAGTGGAAGG - Intergenic
984006369 4:174314642-174314664 ACATCTTTCCAAAAAGAGGAGGG - Intronic
984162678 4:176273310-176273332 TCATATACCCATAAATTTGAAGG + Intronic
984554430 4:181197212-181197234 ACAGATATCAATAAATTAGAAGG - Intergenic
986213690 5:5698450-5698472 ACCTTTATCCATGAAATGGAAGG - Intergenic
986775738 5:11012323-11012345 ACTTGGATACATAAAGTGGAAGG + Intronic
988248918 5:28728371-28728393 ACATGTATCCATAAAGTGTAAGG + Intergenic
991093566 5:62716205-62716227 AGATATAACCATAAAGATGATGG - Intergenic
991339062 5:65585528-65585550 GCAGCTTTCCATAAAGTGGATGG + Intronic
995169707 5:109092742-109092764 ATATATATCCAGAAATGGGATGG - Intronic
995351727 5:111184242-111184264 AGATATATGTATAAAGTAGATGG - Intergenic
997025398 5:130054688-130054710 ACTAATATCCATTAAGTGGTAGG - Intronic
997485555 5:134227296-134227318 ACATTTAACCATAAAGGGCAAGG + Intergenic
1001015942 5:168141069-168141091 ACATATGTCCATCAAGCAGAGGG - Intronic
1001785196 5:174405916-174405938 AAATATACCCATAATCTGGAAGG - Intergenic
1004105437 6:12663642-12663664 ACAAATTGCCATAAACTGGATGG + Intergenic
1005351081 6:24936215-24936237 TCATATTTCCTTAAAGAGGAAGG + Intronic
1006250700 6:32781238-32781260 ACAAATATCCAAACTGTGGATGG - Intergenic
1006957044 6:37882904-37882926 AAATATAGCCATACACTGGATGG - Intronic
1007066980 6:39000794-39000816 ACATTTTTCCATAGACTGGAGGG - Intronic
1008289598 6:49697751-49697773 ACATATCTCAATAAAAGGGAGGG - Intronic
1008799533 6:55349388-55349410 TAATGTATCCATAAAGTGGCAGG - Intronic
1008862427 6:56165400-56165422 ACATTAAAACATAAAGTGGAAGG + Intronic
1009603299 6:65832439-65832461 ACACATATACATTAAGTTGAGGG + Intergenic
1009997343 6:70910681-70910703 GCATATACCCAATAAGTGGATGG + Intronic
1011000805 6:82586138-82586160 AAATAATTCCATGAAGTGGAAGG + Intergenic
1011166562 6:84454408-84454430 ACAAATTACCATAAAGTGGCTGG - Intergenic
1011499791 6:87975514-87975536 ACAAATAACCACAAAGTGGGTGG + Intergenic
1015784505 6:136907766-136907788 AAATATTTTAATAAAGTGGAGGG + Intronic
1016524341 6:144984515-144984537 ACATAAAAACATAAAATGGAGGG - Intergenic
1017193432 6:151677021-151677043 ATATATATCCATAAAGATGAGGG + Intronic
1017982316 6:159411145-159411167 ACATGTATCCATATCGTGAAAGG - Intergenic
1021476548 7:21067889-21067911 ACAGATATAGAAAAAGTGGATGG - Intergenic
1021529548 7:21629012-21629034 ACATATATCAAAAAAGTAGAAGG - Intronic
1021890098 7:25179517-25179539 AAACAAATCCACAAAGTGGACGG + Intronic
1021988828 7:26123042-26123064 CCATCTAGCCATAAAGTGGGTGG + Intergenic
1023105375 7:36758784-36758806 ATATATATCCCCAATGTGGATGG + Intergenic
1024352886 7:48385122-48385144 AAATAAATACATAAAGTGAAGGG - Intronic
1025640706 7:63365435-63365457 ACATATGTTCATGAAGTAGATGG + Intergenic
1025641993 7:63382651-63382673 ACATATGTTCATGAAGTAGATGG - Intergenic
1027928000 7:84492529-84492551 ACATTTATCCCTAATCTGGAGGG - Intronic
1029095411 7:98081415-98081437 ACGCATATTCATAAACTGGAAGG - Intergenic
1030668812 7:112311550-112311572 ACATAAATCCACAAAGTAGATGG + Intronic
1030983817 7:116216602-116216624 AAATATATACATAAAGGAGATGG + Intronic
1032898734 7:136281973-136281995 AAACATATACATAAAATGGAAGG + Intergenic
1032923459 7:136575997-136576019 TCATCTAGCCATAAAGTGGGTGG - Intergenic
1033412790 7:141134797-141134819 ACATATAGACTAAAAGTGGAGGG + Intronic
1033662900 7:143415018-143415040 ACATGTATCCTTAAATTGCATGG - Intergenic
1034056152 7:148036794-148036816 ACCTAACTCCATAAAATGGATGG + Intronic
1037064860 8:14565720-14565742 AAACATATCCAGAAAGAGGAGGG + Intronic
1037433307 8:18837149-18837171 ATATATTCCCAAAAAGTGGATGG + Intronic
1037633072 8:20676051-20676073 AAATATACCCAAAAAGAGGATGG - Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038470770 8:27816843-27816865 CCATATATCCATAAATTATACGG - Intronic
1039237535 8:35518322-35518344 AGATATATAAATAAAATGGAAGG - Intronic
1040447363 8:47508931-47508953 ATATATATATATAAAATGGAAGG - Intronic
1040812404 8:51469748-51469770 ATATATATCCTGAAAGTGCATGG - Intronic
1041635086 8:60133839-60133861 ACATACATACATAAATTTGAAGG - Intergenic
1041816402 8:61976851-61976873 AAATATATCCTTATAGTGCAAGG + Intergenic
1043366645 8:79541077-79541099 ACATTTTTCCTTTAAGTGGAGGG - Intergenic
1043812313 8:84756075-84756097 TAATATATCCATAAAGTAGCAGG + Intronic
1043825030 8:84916741-84916763 ACAAATATCCATAAAGAATATGG + Intronic
1044501277 8:92961257-92961279 CCATTTATCGATAAAGGGGACGG + Intronic
1044563310 8:93635821-93635843 AGAAATATCCAAAATGTGGAGGG + Intergenic
1044861307 8:96526409-96526431 GCATATTTCCAGTAAGTGGAGGG + Intronic
1045891005 8:107157090-107157112 CCATATATCCCCAAAGTGGAGGG - Intergenic
1046611878 8:116434911-116434933 CCATATATCCATATAGTTGAAGG - Intergenic
1048687081 8:136916889-136916911 ACCTCTAACCATGAAGTGGAGGG + Intergenic
1049756867 8:144314654-144314676 AGATATATACACACAGTGGATGG + Exonic
1050003673 9:1105070-1105092 ATATATATATATAAAGGGGAAGG - Intergenic
1052492226 9:29184597-29184619 ACATAAATGCATGAAGTGTAAGG - Intergenic
1052702298 9:31951789-31951811 ACATATACCCATTAATGGGATGG - Intergenic
1054904551 9:70403282-70403304 ACATATATCCAGAATGGGGAAGG - Intronic
1055304311 9:74913035-74913057 ACATATAGACTGAAAGTGGAGGG + Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1056080308 9:83086326-83086348 ATAAATATCCATAAAGGGGCTGG + Intergenic
1058400519 9:104612748-104612770 AACTAAATCCATAAAGTGAATGG - Intergenic
1059720465 9:116954940-116954962 ACATATAACCATTACTTGGAGGG - Intronic
1060753853 9:126194598-126194620 TCATATGTCTATAATGTGGATGG + Intergenic
1187431155 X:19226256-19226278 ACATATTTCTTTAAAATGGAGGG - Intergenic
1188303340 X:28532076-28532098 AAATATAACCAAAAAATGGAAGG + Intergenic
1188336495 X:28940810-28940832 AGATATATCCAAAAAGTGATGGG - Intronic
1189201243 X:39197429-39197451 ACAAATATCAATATAATGGAGGG + Intergenic
1190410166 X:50129311-50129333 ACATATATACAAAAAGTAGTCGG - Intergenic
1191069839 X:56388987-56389009 ATATATATCCATTAATGGGATGG + Intergenic
1192354587 X:70388901-70388923 AAAAATATCAATAAATTGGATGG - Intronic
1194472767 X:94317824-94317846 ACATAGTACCATAAAGTGGATGG + Intergenic
1196623264 X:117848325-117848347 TCATATAACCATAAAGGGCATGG - Intergenic
1196646147 X:118119070-118119092 ACATATATGCACATAGAGGAAGG + Intergenic
1197765639 X:130057880-130057902 ATATATATATATAAAGTTGAGGG + Exonic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1200734387 Y:6778283-6778305 ACATATATTCCTAAATTGTATGG - Intergenic