ID: 960203383

View in Genome Browser
Species Human (GRCh38)
Location 3:114865530-114865552
Sequence TCAAATCCATGTATAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960203383 Original CRISPR TCAAATCCATGTATAGGAGG TGG (reversed) Intronic
906932598 1:50184154-50184176 TCAAATACAAGGATAGGAGTTGG + Intronic
907236663 1:53055490-53055512 TCAAGTCCATGTAGAGGTGGGGG + Intergenic
908160451 1:61402760-61402782 TCCAATCCATGTCTTGCAGGTGG - Intronic
908485217 1:64585124-64585146 TCACATCCATATATATGAGATGG + Intronic
915285001 1:154846935-154846957 TCACATCCATGTGTGGGTGGTGG - Intronic
916060638 1:161096371-161096393 CCAAATCCATATTTTGGAGGAGG - Intergenic
919103225 1:193119596-193119618 TCAAATACATGGGTAGGGGGAGG - Intergenic
919729241 1:200902326-200902348 TAAAAGCCATGGATAGGAGCAGG - Intronic
920987795 1:210906869-210906891 TCAAATTCATGGATAGCTGGAGG + Intronic
1071352002 10:84755829-84755851 TCTAATCCATGGAAAGAAGGAGG + Intergenic
1074780572 10:116799124-116799146 TCACATCCATGTCCAGGAGTGGG - Intergenic
1075926232 10:126253907-126253929 TCAACTCCAGGTACAGGATGGGG - Intronic
1077767186 11:5171983-5172005 TCTAATCTATGGATAGCAGGTGG - Intronic
1081368300 11:42264370-42264392 TCAAAAGCAGGTATAGGAGTGGG - Intergenic
1084675832 11:70633881-70633903 TCACCTCCATTTATAGGAAGTGG + Intronic
1085069732 11:73532617-73532639 TCCAATTTATGTAGAGGAGGAGG - Intronic
1087279084 11:96190412-96190434 ACAAATCCATCTAAAAGAGGTGG - Intronic
1088610319 11:111570216-111570238 TCACAACAATGAATAGGAGGTGG - Intergenic
1090714728 11:129420176-129420198 GCTAATACATGTTTAGGAGGAGG - Intronic
1090952292 11:131484383-131484405 TCAAATGCAAGTATTGGAGAAGG + Intronic
1091093538 11:132794682-132794704 TGATATTCATGTGTAGGAGGTGG - Intronic
1091113446 11:132992961-132992983 TCATCTCCGTGTATGGGAGGAGG + Intronic
1094567785 12:31615994-31616016 TCAATACCATGTACATGAGGTGG + Intergenic
1099117612 12:78647286-78647308 TAACATCCATGTATTGGGGGAGG - Intergenic
1099191806 12:79568997-79569019 TAAAATTCATGTATAGGAGGTGG + Intergenic
1104015325 12:124958045-124958067 GCAAATCCATGGAGAGGAGTGGG + Intronic
1104154232 12:126115989-126116011 TCAACTCCATGAAAAAGAGGAGG - Intergenic
1104956655 12:132469838-132469860 TGCAATCCATGTATATGATGAGG + Intergenic
1105717414 13:23081228-23081250 TCCACTCCCTGCATAGGAGGAGG - Intergenic
1106451351 13:29885658-29885680 TCAAATGTATGTATAAGAGAAGG + Intergenic
1108433231 13:50375688-50375710 TCAAAGCCCTGTGTAGGAGAGGG - Intronic
1117543324 14:56769747-56769769 TCAATTCCATTTAGAGGAAGCGG - Intergenic
1118798567 14:69167918-69167940 TCAAAACTGTGTATAGGAGGGGG + Intergenic
1120080456 14:80210659-80210681 TTGAATCAATGTAGAGGAGGTGG + Intronic
1122110983 14:99502311-99502333 CCAAACCCATGTATAGGAGATGG + Exonic
1125626573 15:41114338-41114360 TCAAATTGTTTTATAGGAGGAGG + Intronic
1131519861 15:93106111-93106133 GGAAATCCATATTTAGGAGGTGG + Intergenic
1134338037 16:13319509-13319531 TCAAATCTATGTCAAGCAGGGGG - Intergenic
1135033560 16:19058061-19058083 TCAAATCCAGGTGTAGTAGAAGG - Intronic
1144855436 17:18264815-18264837 TCAAATCCCTGGAAGGGAGGTGG - Exonic
1146251241 17:31345942-31345964 TCAATACCATGTACATGAGGTGG - Intronic
1149086447 17:52722990-52723012 TAAAATTCAAGTATAGTAGGAGG - Intergenic
1151087899 17:71402368-71402390 TCACATACATGTCTAGAAGGTGG + Intergenic
1151271238 17:72997560-72997582 GCAAAACCATGGATAAGAGGGGG - Intronic
1152052000 17:77986752-77986774 TCAAATTCATGTATAACAGATGG - Intergenic
1153651849 18:7248020-7248042 TCAAATCCCTCTGAAGGAGGGGG + Intergenic
1162821813 19:13227700-13227722 TCAAATCAATGGAAAAGAGGAGG + Intronic
1163624988 19:18384069-18384091 TCAAATCCATTTCCAGGAGGAGG + Intronic
1167399548 19:49255768-49255790 TCACCTCCATGTATAAGAGCGGG + Intergenic
925328103 2:3038392-3038414 TCAAATCAATTTAAAGGAGGTGG - Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
936800440 2:116259052-116259074 TCATCACCATGTATAGGGGGAGG - Intergenic
941671402 2:168297842-168297864 AGAAATGCATGTATAGGATGAGG - Intergenic
943698789 2:190966600-190966622 ACACATCCATGGATAGGAGCAGG + Intronic
944432221 2:199645533-199645555 TAAAATAGATGAATAGGAGGGGG - Intergenic
946094502 2:217261395-217261417 TCAAATCTAGCTAGAGGAGGAGG - Intergenic
1172453558 20:35047499-35047521 TCTGATCCATGAATAGGAGAAGG - Intronic
1172685723 20:36752807-36752829 CCAGATCCATGTATGGCAGGTGG + Exonic
1174194795 20:48765611-48765633 TCAAAGTCATGCAGAGGAGGAGG + Intronic
1178548404 21:33513625-33513647 TCAATTCCATTTATAGTAGCTGG + Intronic
1183790964 22:40068896-40068918 TTAAATCCATATATATGAGGTGG + Intronic
951395030 3:22154340-22154362 TCAAACCCATGTCTAGAAGGTGG + Intronic
955681317 3:61505108-61505130 ACAAACCCATCTGTAGGAGGTGG + Intergenic
956388124 3:68742917-68742939 ACAAATCCTTGTATGGAAGGAGG + Intronic
958978399 3:100692466-100692488 TCTTCTCCATGCATAGGAGGGGG + Intronic
959575874 3:107932873-107932895 TCAAAACCAAGTAGAGAAGGAGG - Intergenic
960203383 3:114865530-114865552 TCAAATCCATGTATAGGAGGTGG - Intronic
961643700 3:128381176-128381198 TCCAAGTCATGGATAGGAGGTGG - Intronic
962426194 3:135271268-135271290 TCAAATACATTTAGAGGAAGGGG - Intergenic
964152583 3:153545298-153545320 TCATATCAAGGTGTAGGAGGAGG + Intergenic
964180752 3:153882063-153882085 ACAAAACCATGGATAAGAGGAGG - Intergenic
964435334 3:156645451-156645473 TCAAAACCCTGGATATGAGGAGG + Intergenic
966770239 3:183497676-183497698 TCAAGGCCATGTGTAGGAAGAGG + Intronic
967879967 3:194294872-194294894 TCAAATCGATGGATAGAAGCCGG + Intergenic
971056393 4:22917757-22917779 TCTAATCCATGTATGTGTGGAGG + Intergenic
978045354 4:104118961-104118983 CCAAATCCATGTAGTGGAGTTGG - Intergenic
978118557 4:105050585-105050607 CCAAATGCATCTGTAGGAGGTGG - Intergenic
978339587 4:107707841-107707863 TCAAATCTGTGTATTGGTGGAGG - Intronic
980647896 4:135668058-135668080 TCACATTCATGTATAGGACCAGG - Intergenic
985874838 5:2586773-2586795 TCACAGCCATGCATAGGTGGTGG + Intergenic
986989302 5:13532934-13532956 AAAAATCCATGGATAGGAGAAGG + Intergenic
987705438 5:21458097-21458119 TCAACCCCATGTTTAGGAAGAGG + Intergenic
987906882 5:24088746-24088768 TCAAATGCAACTGTAGGAGGTGG - Intronic
990412149 5:55552108-55552130 TCAATCCCATGTACATGAGGTGG + Intergenic
993243059 5:85415368-85415390 TCGAATGCACCTATAGGAGGTGG + Intergenic
1000290393 5:159864618-159864640 GCAAATCCATGTAGGGGAGGAGG - Intergenic
1009022861 6:57962809-57962831 TCAACCCCATGTTTAGGAAGAGG - Intergenic
1009217213 6:60937116-60937138 GCAAAACCATGCATAAGAGGGGG - Intergenic
1009672168 6:66770040-66770062 TCTAAACCATGTGTAGGAGTAGG + Intergenic
1009975728 6:70668373-70668395 TCAAACCCGTGTCTGGGAGGAGG - Intronic
1010330273 6:74615545-74615567 TCATATCCATGTTTTGGAGAGGG + Intergenic
1010440317 6:75886284-75886306 TCAAATCCTTTTATAGAATGAGG - Intronic
1010792223 6:80077943-80077965 TCAATTCCACATATACGAGGTGG + Intergenic
1011993864 6:93559860-93559882 TCAATGCCATGGACAGGAGGGGG + Intergenic
1015300546 6:131648950-131648972 GCAAATACATATTTAGGAGGGGG - Intronic
1015765504 6:136711811-136711833 TTAAAGCTATTTATAGGAGGAGG + Intronic
1015864420 6:137713187-137713209 TCAAACTGATGTATAGGATGTGG + Intergenic
1018432409 6:163732650-163732672 TCAAATCCATTTTTAGAAGTAGG + Intergenic
1019614211 7:1951629-1951651 TCAGATCCATAGACAGGAGGTGG - Intronic
1021835455 7:24668512-24668534 TGAAATCCAGATATATGAGGAGG + Exonic
1024470381 7:49763838-49763860 TTAAATACAAGTATAGAAGGTGG + Intergenic
1031466958 7:122124662-122124684 CCACATCCATGAATAGGATGTGG - Intronic
1033346143 7:140526829-140526851 TCAAAACCATTTAGAGGAAGGGG + Intronic
1033845129 7:145422447-145422469 TCGAAGCCATGTTTAGGTGGTGG + Intergenic
1035199532 7:157252277-157252299 TCTAATCCATTTAAAGGAAGGGG + Intronic
1035452804 7:158989340-158989362 TCAGAGTCATGGATAGGAGGTGG - Intergenic
1037053720 8:14409289-14409311 TCACATGTATGTATAGGAGGGGG + Intronic
1038178671 8:25205571-25205593 TCAAATCCCTGTAAAAGAGGAGG - Intronic
1038699046 8:29832552-29832574 TGAAAGCCCTGTAGAGGAGGTGG + Intergenic
1042144032 8:65708892-65708914 TCTAATCCATGATTGGGAGGTGG + Intronic
1042864307 8:73344155-73344177 CCAATGCCATGTATAGGAGCTGG + Intergenic
1044198320 8:89404305-89404327 TCAATTCCAAGTTTAGGAGGTGG + Intergenic
1045051283 8:98328389-98328411 TCAAGTCCATGAATAGAATGCGG - Intergenic
1045366253 8:101478843-101478865 TCATATTCAAGTCTAGGAGGTGG + Intergenic
1056162845 9:83914437-83914459 TTAAATGCATGGATGGGAGGTGG - Intronic
1056238568 9:84620519-84620541 TCACATCCATGTGAAGGAAGTGG - Intergenic
1059796416 9:117701919-117701941 TAAAAGCCAGGTAGAGGAGGTGG + Intergenic
1187596766 X:20781775-20781797 TCAAATAAATATATAGGAGTAGG - Intergenic
1188115284 X:26235111-26235133 TCATATACATGGATAGCAGGTGG - Intergenic
1189391399 X:40579997-40580019 TCATATCCAAGGATAGGAGATGG - Intergenic
1191743751 X:64464036-64464058 TCAAATGCACCTGTAGGAGGTGG + Intergenic
1193061461 X:77212561-77212583 CCAGACCCATGTATAGAAGGTGG + Intergenic
1193061756 X:77214703-77214725 TCAAACACATCTGTAGGAGGTGG + Intergenic
1193592329 X:83405354-83405376 TCAAAACCATGTTTTGAAGGTGG + Intergenic
1197428150 X:126323658-126323680 TCAAATGCACCTGTAGGAGGTGG - Intergenic
1198648591 X:138837084-138837106 CTAAACACATGTATAGGAGGTGG + Intronic
1199495266 X:148445806-148445828 TCTAACTCATGAATAGGAGGGGG + Intergenic