ID: 960204885

View in Genome Browser
Species Human (GRCh38)
Location 3:114884880-114884902
Sequence GGTTTGTTAGAGGAGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960204885_960204893 10 Left 960204885 3:114884880-114884902 CCCTGTAGCTCCTCTAACAAACC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 960204893 3:114884913-114884935 AGCAGACAATGAAATTGCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 221
960204885_960204892 9 Left 960204885 3:114884880-114884902 CCCTGTAGCTCCTCTAACAAACC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 960204892 3:114884912-114884934 GAGCAGACAATGAAATTGCTAGG 0: 1
1: 0
2: 0
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960204885 Original CRISPR GGTTTGTTAGAGGAGCTACA GGG (reversed) Intronic
902260977 1:15224679-15224701 GGTTTGTCCTAGGAGCTAAATGG - Intergenic
905180376 1:36161763-36161785 TGTTTCTTAGAGGAGGTACCTGG + Intronic
907697377 1:56745879-56745901 GATATGTTGGAGGAGCTGCAAGG - Intronic
908492043 1:64654822-64654844 TGTTTGCTTGAAGAGCTACAGGG + Intronic
909100425 1:71342030-71342052 GGTGTGTTAAAGGAGTTACATGG + Intergenic
909465498 1:75969527-75969549 GCTTTGTTAGGGAAACTACAGGG + Intergenic
912198152 1:107424292-107424314 GGTGTGTTTGAAGAGCAACATGG + Intronic
913273194 1:117114089-117114111 GGTATGTGAGAAGAGGTACATGG - Intronic
913311956 1:117507778-117507800 GTTTTGTAAGAAGAGCTAAATGG + Intronic
917112412 1:171562241-171562263 GGTTTGTTTGAGGAAGTTCAGGG + Intronic
917552832 1:176053387-176053409 GGGTTGGTAGAGGAGCATCAAGG - Intronic
917743055 1:177980407-177980429 GCTTTCTTAGAGGAGCTATGGGG - Intronic
918598097 1:186317166-186317188 GGTCTTTTAGAGGTGCTACAGGG - Intronic
919854844 1:201698236-201698258 GGTGGGTTAGAGGAGTCACAGGG - Intronic
920933385 1:210409309-210409331 GGTGTGTGAGAGGAGTTAGAGGG + Intronic
921534597 1:216330520-216330542 GGCATGTTAGAGGAGGTGCAAGG + Intronic
921869741 1:220126805-220126827 GGTTTGATAGCGGAACTTCATGG + Exonic
924134335 1:240947918-240947940 GGTATGTTTGAGGAGCAACAAGG - Intronic
1066179284 10:32944055-32944077 AGTTGGTTAGAGGAGCCGCAGGG + Intronic
1069826580 10:71258479-71258501 GGCTTCCTGGAGGAGCTACAGGG - Intronic
1069929431 10:71872628-71872650 GCTTTGTTCTAGGAGTTACAGGG + Intergenic
1071336471 10:84604528-84604550 GTTTTGTCAGAGGAGATAAAAGG + Intergenic
1071973671 10:90933546-90933568 GGTTTGTTAGAGGAAATTTATGG - Intergenic
1082071997 11:47946772-47946794 GGTGTGTTAGAGGAACCCCATGG + Intergenic
1084452174 11:69245663-69245685 GGTGTGTTGGAGGAGCAGCAAGG + Intergenic
1085978614 11:81693878-81693900 GGGTTGTCAGTGGAGCTCCAGGG - Intergenic
1087700728 11:101433625-101433647 GGTTTGTCAGGTGATCTACATGG - Intergenic
1088841257 11:113629428-113629450 GGGCTTTTAGAGGAGCTGCAAGG - Intergenic
1089188093 11:116634670-116634692 AGTTTGTTATAGCAGTTACATGG - Intergenic
1096848357 12:54419817-54419839 AGCTTGCTAGAGGACCTACACGG + Intergenic
1097019321 12:56008431-56008453 GGTTTGTGTGAGGAGGTACAGGG - Intronic
1097269949 12:57767771-57767793 GGGGTGTTAGAGGAGCTAAATGG + Intronic
1100160926 12:91859746-91859768 TCTTTGTTAGAGGAGCTGCCAGG + Intergenic
1101001172 12:100359342-100359364 GTTTGATTGGAGGAGCTACATGG + Intronic
1101252142 12:102946863-102946885 GGTTTTGTAGAGGAGCAATAGGG + Intronic
1103799558 12:123528736-123528758 GATTTGTTACAGCAGCCACAGGG + Intronic
1105934095 13:25082341-25082363 GGTTAACTAGAGGAGATACAGGG - Intergenic
1108341007 13:49497803-49497825 GGTGGCTTAGAGGACCTACAAGG - Intronic
1108746241 13:53397449-53397471 GGCTTGTTTGAGGAGCCTCAGGG + Intergenic
1109804674 13:67423104-67423126 GGTATATTAGAGGAGCTCCTTGG + Intergenic
1110350924 13:74506365-74506387 TGTTTGTTAGTTGAGCTTCAGGG + Intergenic
1110894918 13:80737492-80737514 GGTTTGGGAGAGGAGAGACATGG - Intergenic
1116790552 14:49335541-49335563 GCTTGATAAGAGGAGCTACAAGG - Intergenic
1117002186 14:51382115-51382137 GGTGTGTTGCAGGAGCAACAGGG + Intergenic
1119338244 14:73852670-73852692 GGTTGGTAGGAGGAGCCACAGGG + Intronic
1122148245 14:99706874-99706896 GGTATGTTAGAGGAGCAGGAGGG - Intronic
1122334772 14:100964846-100964868 GGTCTGTTAGAAAAGATACATGG + Intergenic
1122497277 14:102167161-102167183 GGTTTGTGAGAGGAATTAAAAGG - Intronic
1124221802 15:27855912-27855934 GCTTTGTGACAGCAGCTACAGGG - Intronic
1124914103 15:33951620-33951642 GATTTGTTAGAGGAGGGAAAGGG - Intronic
1128155386 15:65388708-65388730 GGTTTGTTCCAGGGGCTACTGGG - Intronic
1129830975 15:78669928-78669950 GCCTTTTTAGAGGATCTACAAGG + Intronic
1129923693 15:79343078-79343100 GGTTTGTTTGAGGAACAGCATGG + Intronic
1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG + Intronic
1130738367 15:86572567-86572589 GGTTGGTGAGAGCAGCAACATGG + Intronic
1132399809 15:101498373-101498395 GGTGTGGTGGAGGAGCTAGAGGG + Intronic
1138238291 16:55404415-55404437 ACTTTGTTAGAGATGCTACAGGG + Intronic
1139057477 16:63202936-63202958 GGTGTGTTTGAGAAGCTTCATGG - Intergenic
1140708539 16:77654445-77654467 GGTGTGTTTGAAGAACTACAGGG - Intergenic
1142779449 17:2169616-2169638 GGTTTGTTTGAGGAACAGCAAGG + Intronic
1142993725 17:3748782-3748804 GGTTTGTTTGAGGAGCACAAAGG + Intronic
1143112692 17:4561036-4561058 GGTTTCTTTGAGGAGCAACTTGG + Intergenic
1144467041 17:15505313-15505335 AGTTTGTTGGTGGACCTACAAGG + Intronic
1149175688 17:53867681-53867703 AGTCTGTGAGAGCAGCTACATGG - Intergenic
1151847605 17:76668244-76668266 GGTTTGTTAGGGGTGCTCCCAGG - Intergenic
1159953719 18:74504825-74504847 GCACTGGTAGAGGAGCTACATGG + Intronic
1165433113 19:35783570-35783592 GGTGTGTTGGAGGAGCTGCAGGG + Intronic
1166209682 19:41298235-41298257 GGTTTCTCAGAGAAGCTATATGG - Intronic
926582048 2:14641549-14641571 GTTTGGATAGAGGAGCTAGAGGG - Intronic
930093755 2:47551200-47551222 GGTTTGCTGGAGGAGCCGCAAGG - Intronic
933041400 2:77471594-77471616 GGTTTGTTTGAGGATCAACAAGG - Intronic
938697678 2:133849254-133849276 GGATTGTTACAGGAGCCACTTGG - Intergenic
943114510 2:183649790-183649812 GGTAGGTCAGAGAAGCTACATGG + Intergenic
943541057 2:189214725-189214747 GGTTGGTTAGTCAAGCTACAAGG - Intergenic
944398303 2:199295608-199295630 GGCTTGTCAGAGGAGGAACATGG - Intronic
947985473 2:234444080-234444102 GATTTGTTACAGCAGCCACAGGG + Intergenic
947989346 2:234474474-234474496 AGTTTGTTACAGCAGCAACAGGG + Intergenic
948658831 2:239494131-239494153 GTTTTTTAAGAGAAGCTACAAGG - Intergenic
1168980426 20:1998874-1998896 GGTGTGTTTGAGGAGCAGCAGGG - Intergenic
1169596878 20:7210494-7210516 AGTTTGTTAGATTAGGTACAAGG - Intergenic
1171381108 20:24734835-24734857 GGTTGGTGAGTGGAGCTAAAGGG + Intergenic
1172114665 20:32566557-32566579 GGTTGGTTTGAGGAACTGCAAGG - Intronic
1172643600 20:36456368-36456390 GGTATGTTACAGGAGTTGCAGGG + Intronic
1174047483 20:47743821-47743843 GGTGTGTTCGAGGAACAACAAGG - Intronic
1177814795 21:25964281-25964303 AGATTGTTAGAGGAAGTACATGG - Intronic
1178630630 21:34257646-34257668 TTGATGTTAGAGGAGCTACAGGG - Intergenic
1178995945 21:37399934-37399956 GATTTGTTACAGGAGCCACAGGG - Intronic
1181770220 22:25119812-25119834 GGTGTGTTTGAGGAGCAGCAAGG + Intronic
949131110 3:502291-502313 GGTATGTTAGAAAAACTACATGG + Intergenic
953164115 3:40449042-40449064 TGTTTGTTAGAAGTGCTATAAGG + Intergenic
953799238 3:46009233-46009255 CGTGTGTTTGAGGAGCCACAAGG + Intergenic
953911646 3:46896314-46896336 AGTGTGTCAGAGGAGGTACATGG + Intronic
957994739 3:87674751-87674773 GGCTTGTAAGTGGAGCTTCAGGG - Intergenic
957996178 3:87692568-87692590 GGTTTTATAGATGAGCTACTGGG - Intergenic
960204885 3:114884880-114884902 GGTTTGTTAGAGGAGCTACAGGG - Intronic
960956798 3:123038022-123038044 GGTATTATAGAAGAGCTACAGGG - Intergenic
962358555 3:134715699-134715721 GGTATGTTATAGGAGCCTCATGG + Intronic
962520884 3:136196387-136196409 GGGTTGTTAGAGGAGAAGCAAGG - Intronic
964354286 3:155835756-155835778 GGTTTTTTAGATGAGCTAGTGGG - Intronic
964387270 3:156161313-156161335 GGTTTTTTAAAGGAAGTACATGG - Intronic
971342156 4:25780507-25780529 GGTGTGCTAGAGGAGCAGCAGGG - Intronic
972213865 4:36872687-36872709 AGTTTGTGACTGGAGCTACAAGG + Intergenic
974444352 4:61960366-61960388 GATATGTTTGAGGAGCTGCAAGG + Intronic
975353486 4:73371949-73371971 GTTTTGTTTGAGAACCTACATGG + Intergenic
975915798 4:79324285-79324307 ATTTTATTAGAGGAGCTAAATGG - Intronic
982312672 4:154002243-154002265 GCTCTGTTAGAGGAGCTCCATGG - Intergenic
983499680 4:168484473-168484495 AGTTTGGCAGAGGAGCTTCAGGG - Intronic
986393914 5:7309606-7309628 AGTTTGTAAGAGGGGCCACATGG - Intergenic
986701096 5:10409442-10409464 GGTCTGTTTGAGGATCTGCAGGG + Intronic
987621128 5:20339463-20339485 GTATTGTGAGAGGAGCTGCAAGG + Intronic
988146235 5:27312357-27312379 GATTGGTTAGACGACCTACATGG - Intergenic
989020806 5:37004942-37004964 GGATTGCTAGGGGATCTACATGG + Intronic
989219391 5:38938877-38938899 CTTTTGTTAGAGGAGCTATTTGG - Intronic
989949117 5:50275788-50275810 GGTTTGTTAGAGAAGGGAGAAGG + Intergenic
995711307 5:115038765-115038787 GCTTTGTGAGATGAGGTACAGGG + Intergenic
997214569 5:132100118-132100140 GGTGTGTTCAAGGAGCAACATGG - Intergenic
997311592 5:132889142-132889164 GGACAGTTAGAGGAGCTACTTGG + Exonic
998446489 5:142202769-142202791 GGTTTGTTAGAGGAACAAAGTGG + Intergenic
999904293 5:156122557-156122579 GGTGTGTTAGAGGAGCAGCATGG + Intronic
1003968398 6:11275242-11275264 GGTTGGGGAGAGGAGGTACAGGG + Intronic
1005602631 6:27443313-27443335 GGTGTCTTAGAGGAGCTAGGGGG - Intergenic
1005899609 6:30206158-30206180 GGTTTGTTAGAGGTGTCTCACGG - Intronic
1005948133 6:30610013-30610035 GGTTTATTAGAGGGCCTACTCGG - Intronic
1006151483 6:31992432-31992454 GGTTTCTAAGTGGAGCTTCACGG - Exonic
1006157784 6:32025170-32025192 GGTTTCTAAGTGGAGCTTCACGG - Exonic
1006435821 6:34025749-34025771 AGTTTGTTAGAAGGGCCACATGG - Intronic
1010445698 6:75946152-75946174 GATTTCTTAGGGGAGCCACAGGG + Intronic
1013040509 6:106428556-106428578 GGGTTGTTAGAGGAATTAAATGG - Intergenic
1014755070 6:125293664-125293686 GGTGTGGTAGAAGAACTACAGGG - Intronic
1014792027 6:125683178-125683200 GGTGAGTTAAAGGAGCAACAAGG - Intergenic
1014945112 6:127488111-127488133 GGTATGTTTGAGGAACTGCAAGG - Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1019957042 7:4423891-4423913 GTGTTGTTAGAGGAGGTAAAGGG - Intergenic
1024877020 7:54037466-54037488 AGCTTGTTAGAGCAGCTGCAGGG - Intergenic
1026890657 7:73979889-73979911 GGTTTGTTATAGGTCCTTCAGGG - Intergenic
1029990801 7:104960915-104960937 TATTTGTTAGGGGAGCTTCAAGG - Intergenic
1030131637 7:106206801-106206823 GATTTATTAGGGGAGCTACTAGG + Intergenic
1031143739 7:117974325-117974347 GTTTTGTTGGAGGAGAAACAAGG + Intergenic
1035256294 7:157630484-157630506 GGTGTGTTAGAGGAGCGGGATGG - Intronic
1035653708 8:1289355-1289377 GGTTTTTCAGTGGAGATACAGGG + Intergenic
1037470712 8:19207094-19207116 GGTTTGTTACCGGGGGTACATGG + Intergenic
1038263951 8:26022430-26022452 GCTTTTTTGGAGGGGCTACATGG + Intronic
1038817003 8:30914100-30914122 GGATTGAAAGAGGAGCTTCAGGG + Intergenic
1044994826 8:97829158-97829180 GGTTTGGTAGGGGAGCTGCGTGG + Intronic
1052384847 9:27810438-27810460 GGTATGGTAGAGGAAGTACAGGG + Intergenic
1052852129 9:33384879-33384901 GGGTTCTTACAGGAGCTCCAGGG - Intronic
1052857982 9:33418714-33418736 GGGTTGCTAGAGGAGTTACAGGG + Intergenic
1053078227 9:35153106-35153128 GGAGTGATAGAGGAGCTACAGGG + Intergenic
1055992760 9:82125250-82125272 GGCTTGATAGAGGGACTACAAGG - Intergenic
1059255398 9:112925908-112925930 GGTGTGCTAGAGGAGCTTTAGGG + Intergenic
1060678984 9:125544625-125544647 CGTTTGTTACATGAGCTACTTGG - Intronic
1187188063 X:17006687-17006709 GCTCTGTTAGAGGAGTAACAAGG + Intronic
1189403944 X:40700612-40700634 AGTTTGTTAGAGTTGCTATAAGG + Intronic
1189430403 X:40941475-40941497 GGTTTGTTAAAAGATCTATAAGG - Intergenic
1190618620 X:52263475-52263497 GGTGTGTTCGCGGAGTTACAAGG - Intergenic
1192560208 X:72123385-72123407 GGTTTTGTAGAGGAGCAGCAAGG + Intergenic
1194052071 X:89081174-89081196 GGTTTGTTAGAAGCTCTACTTGG + Intergenic
1195420430 X:104669450-104669472 GGTTTGTTAAAAGAGTAACAAGG - Intronic
1199875494 X:151924589-151924611 GCTTTGTTAGAGGAGGAAGAGGG + Exonic
1200258174 X:154596902-154596924 GGCTTGTTAGAAGAGCCAAATGG + Intergenic