ID: 960206822

View in Genome Browser
Species Human (GRCh38)
Location 3:114912027-114912049
Sequence ATGTTCACTTATATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960206822_960206826 27 Left 960206822 3:114912027-114912049 CCTTGTTCCATATAAGTGAACAT 0: 1
1: 0
2: 0
3: 40
4: 397
Right 960206826 3:114912077-114912099 GAAAAACCTTGTAAACCAGGAGG 0: 1
1: 0
2: 1
3: 19
4: 203
960206822_960206825 24 Left 960206822 3:114912027-114912049 CCTTGTTCCATATAAGTGAACAT 0: 1
1: 0
2: 0
3: 40
4: 397
Right 960206825 3:114912074-114912096 CAAGAAAAACCTTGTAAACCAGG 0: 1
1: 0
2: 0
3: 24
4: 292
960206822_960206827 28 Left 960206822 3:114912027-114912049 CCTTGTTCCATATAAGTGAACAT 0: 1
1: 0
2: 0
3: 40
4: 397
Right 960206827 3:114912078-114912100 AAAAACCTTGTAAACCAGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960206822 Original CRISPR ATGTTCACTTATATGGAACA AGG (reversed) Intronic
901452109 1:9342179-9342201 AGGCTCACTCACATGGAACATGG - Intronic
902114805 1:14112617-14112639 ATGTTCCCTTACATGGAAAAAGG + Intergenic
902572137 1:17353647-17353669 ATGTTTCCTTATATGGTAAAAGG + Intronic
903655175 1:24944496-24944518 ATGTTACCTTATATGGCAAAAGG + Intronic
905475944 1:38228141-38228163 ATGTTCCCTTATAAGGCAGAAGG + Intergenic
906472206 1:46140467-46140489 ATGTGAACTTATTTGGAAGAGGG + Intronic
907323829 1:53622501-53622523 ATGTTATCTTATTTGGAAAAAGG + Intronic
907619576 1:55962825-55962847 ATGTTACCTTATATGGCAAAAGG - Intergenic
908068045 1:60428978-60429000 ATGTTAAGTTATATGGCAAAAGG + Intergenic
908105889 1:60841947-60841969 ACGTTCCCTTATTTGGAAAAGGG - Intergenic
908266646 1:62385780-62385802 CTGTACGCTTATATGGGACAAGG + Intergenic
909580617 1:77229502-77229524 ATGTTACCTTATATGGCAAAAGG + Intergenic
910004845 1:82383788-82383810 ATGTACACTTATTTGGAAAAAGG - Intergenic
910093525 1:83493474-83493496 ATGTTATCTTACATGGAAAAGGG + Intergenic
911138094 1:94464689-94464711 ATGTTGACTTAGATGAAACATGG + Intronic
911287989 1:96020940-96020962 ATAGTCACTTAGCTGGAACAGGG + Intergenic
911502825 1:98709913-98709935 AAGCTCTCTTATATGGAATATGG + Intronic
913382207 1:118224651-118224673 ATGTTTACTTATTTGAGACAGGG - Intergenic
913674854 1:121131032-121131054 ATGTTACCTTATATGGCAAAGGG - Intergenic
913941018 1:125105737-125105759 ATGGCCACTTATATGGTATATGG + Intergenic
913956320 1:143298749-143298771 ATGGCCACTTATATGGTATATGG - Intergenic
913981111 1:143516690-143516712 ATGGCCACTTATATGGTATATGG + Intergenic
914026693 1:143918664-143918686 ATGTTACCTTATATGGCAAAGGG - Intergenic
914075483 1:144343346-144343368 ATGGCCACTTATATGGTATATGG + Intergenic
914103695 1:144623150-144623172 ATGGCCACTTATATGGTATATGG - Intergenic
914334444 1:146701644-146701666 ATGTTACCTTATATGGCAAAAGG - Intergenic
914665075 1:149826099-149826121 ATGTTACCTTATATGGCAAAGGG - Intergenic
914670690 1:149867722-149867744 ATGTTACCTTATATGGCAAAGGG + Intronic
915512404 1:156393281-156393303 ATGTCCTCTTTTATGAAACATGG + Intergenic
916918349 1:169435886-169435908 ATGCTCAGTTATATCGCACAAGG - Intronic
917043347 1:170830656-170830678 ATGTTTTCTTCTAAGGAACAAGG - Intergenic
918009015 1:180569226-180569248 ATGTTACCTTATTTGGAAAAAGG + Intergenic
918503950 1:185230540-185230562 ATGTTACCTTATTTGAAACAGGG - Intronic
918541337 1:185636382-185636404 ATTTTCTCTTATATGGGACATGG + Intergenic
918731793 1:188006870-188006892 ATGTTCACCTATAGGTAAAAGGG - Intergenic
919029971 1:192228832-192228854 ATGTTAACTTATATGTACCATGG + Intergenic
919569755 1:199232884-199232906 ATGTTAACTTATTTGGAAAAAGG - Intergenic
920218925 1:204381580-204381602 ATGTTCCCTTATTTGGAAAAAGG + Intergenic
920535782 1:206735796-206735818 ATGTTCCCTTACATGGCAAAGGG - Intergenic
920862825 1:209724445-209724467 CTGTGCACTTACAGGGAACATGG - Intronic
921629580 1:217417565-217417587 AAGGTCATTTTTATGGAACATGG - Intergenic
922858374 1:228794643-228794665 ATGTGAGCTTATATGGAAAAAGG - Intergenic
923329759 1:232911867-232911889 CTGTTCACTGTTTTGGAACAGGG - Intergenic
923792668 1:237125789-237125811 ATTTTCATTTATAAGTAACAAGG - Intronic
1064687134 10:17874502-17874524 ATGTTAGCTTACATGGAAAATGG - Intronic
1065765071 10:29021425-29021447 ATGTTCACTGTAATGAAACAGGG - Intergenic
1065837795 10:29675024-29675046 ATGTTCAGTTATATGGCAGTTGG - Intronic
1066955195 10:42161319-42161341 ATGGCCACTTATATGGTATATGG - Intergenic
1067698740 10:48553688-48553710 ATGTTACCTTATATGGCAAAGGG + Intronic
1067825584 10:49570287-49570309 ATGTTAAATTATATGGCAAAGGG - Intergenic
1067983986 10:51121224-51121246 ATATTACCTTATATGGAAAAAGG - Intronic
1068314046 10:55319340-55319362 TTGTTAACATAAATGGAACAAGG + Intronic
1068415790 10:56720462-56720484 ATGTTACCTTATATGGCAAAAGG - Intergenic
1068756043 10:60654338-60654360 ATGTTCACTTCTTTTCAACACGG - Intronic
1069084160 10:64120225-64120247 ATGTTACCTTATTTGGAAAAAGG + Intergenic
1069132517 10:64724386-64724408 ATTTTCACTAATATGGAGAAAGG - Intergenic
1069936276 10:71919423-71919445 ATGTACAGGGATATGGAACATGG - Intergenic
1070362009 10:75699746-75699768 ATGTTACCTTATATGGAAAAAGG + Intronic
1071776033 10:88789122-88789144 ATGTTACCTTATATGGCAAAAGG + Intergenic
1072863581 10:99033007-99033029 ATGTTAACTTACATGGCAAAGGG - Intronic
1073612506 10:104958404-104958426 ATGTTCAGTTATATGGCAAGAGG + Intronic
1073946696 10:108758752-108758774 AAGTTTGCTTATGTGGAACATGG + Intergenic
1074425086 10:113343564-113343586 ATGTTACCTTATATGGTAAAAGG + Intergenic
1074488314 10:113912824-113912846 ATGTTCACTTCTGTCAAACAAGG + Exonic
1075667792 10:124243438-124243460 ATGTTCCCTTACATGGCAAAAGG + Intergenic
1076470069 10:130712313-130712335 ATGGAAACTTACATGGAACAAGG + Intergenic
1077470354 11:2755662-2755684 ATGTTACGTTATATGGAAAAGGG - Intronic
1078415349 11:11160384-11160406 ATGTTACCTTATATGGCAAAAGG - Intergenic
1079022125 11:16917705-16917727 ATGTTACCTTATATGGGAAAAGG - Intronic
1080490471 11:32757891-32757913 ATGTTACCTTATATGGCAAAAGG - Intronic
1080974551 11:37322450-37322472 ATTTTCAACTATATGGAACCAGG - Intergenic
1081296070 11:41391007-41391029 ATGCTTACTTATATGGCCCAAGG - Intronic
1081597994 11:44472519-44472541 ATGTTACCTTATATGGCAAAGGG + Intergenic
1082612319 11:55315883-55315905 ATGTTTACTTATAAAAAACAGGG - Intergenic
1085425867 11:76404067-76404089 ATGTTCACTTGACTGGATCATGG - Exonic
1085885402 11:80515827-80515849 ATGTCGACTTATCTGGAAAAGGG + Intergenic
1086656079 11:89357092-89357114 ATGTTAAATTATTTGGAATACGG + Intronic
1086830210 11:91553005-91553027 ATTTCCACTTTTGTGGAACAGGG + Intergenic
1087570063 11:99915404-99915426 ATATTCACTTCTATGTAAAAGGG - Intronic
1087975311 11:104538207-104538229 ATGTACAGTTATAGGGAACATGG - Intergenic
1088031332 11:105254452-105254474 ATCTTCAATTTTATGGATCATGG - Intergenic
1088444971 11:109916429-109916451 ATGTTTACTTATATGTTACCAGG - Intergenic
1090956334 11:131515952-131515974 ATGTGGACTTATATGGAATTAGG + Intronic
1092033381 12:5308931-5308953 ATGTTAAGTTGTATGGGACATGG - Intergenic
1092332829 12:7601367-7601389 ATGGTCACTTATATGAACTATGG - Intergenic
1093051228 12:14507202-14507224 ATGTTCATTTATTTTGAAAATGG + Intronic
1095673722 12:44891490-44891512 ATCTTAACTTGTAAGGAACATGG - Intronic
1095735142 12:45548059-45548081 ATGTTTACTTACATGGCAAATGG + Intergenic
1096524334 12:52201580-52201602 ATGTTCCCTTACATGGCAGAAGG + Intergenic
1097792471 12:63829483-63829505 ATGTTTTCTTATATGGCAAAGGG - Intergenic
1098078237 12:66756410-66756432 ATGCTCAGTTATACAGAACATGG - Intronic
1098895269 12:76052675-76052697 ATGTTCACATATATGGCATATGG - Intronic
1099488593 12:83258480-83258502 ATTTTCATTTATCTGGAAGAAGG - Intergenic
1100192328 12:92205946-92205968 ATGTGAACTTATCTGGAAAAGGG - Intergenic
1102446045 12:113003520-113003542 ATGTGCCCTTATTTGGAAAAAGG - Intronic
1102611598 12:114117202-114117224 ATGTTCCCTTAACTGGAACTTGG - Intergenic
1106964290 13:35040710-35040732 ATTTTCACATAAATGGAAAAGGG - Intronic
1109887967 13:68567120-68567142 ATGCCCACATATATGGAACAAGG + Intergenic
1110106421 13:71682586-71682608 ATGTTCACTTAAATAGAATAAGG - Intronic
1110225926 13:73119480-73119502 CTGTACACTTATCTGGAAGAAGG - Intergenic
1110408814 13:75181709-75181731 ATGTTCTATTATTTGGAACAAGG - Intergenic
1110838282 13:80110210-80110232 ATGTTACCTTATGTGGAAAAGGG + Intergenic
1111306905 13:86426477-86426499 ATGTTACCTTACATGGAAAAAGG + Intergenic
1111682751 13:91463885-91463907 ATTTTCCCTTTTATGAAACATGG - Intronic
1111893803 13:94116239-94116261 ATGTGCACTGATATGGTAAATGG - Intronic
1111978278 13:94990410-94990432 ATGTTACCTTATCTGGAAAAAGG - Intergenic
1112191787 13:97185429-97185451 ATGTTACCTTACATGGAAAAAGG + Intergenic
1112587159 13:100729202-100729224 ATGTTCAGTTATATGGCATAGGG + Intergenic
1112746770 13:102535713-102535735 ACGTTCCCTTACATGGCACAAGG - Intergenic
1115505992 14:34094686-34094708 ATGTGACCTTATTTGGAACAAGG + Intronic
1116638675 14:47432575-47432597 ATTTTCACTTATATGAACAAAGG + Intronic
1117166663 14:53041251-53041273 TTTTTCATTTATATGTAACATGG - Intronic
1117428335 14:55624502-55624524 ATATCCACTTAAATGGCACAAGG - Intronic
1117598376 14:57346949-57346971 TTGTTCACTTAGATGACACAGGG + Intergenic
1117873557 14:60225722-60225744 ATGTTACCTTATATGGCAAAAGG - Intergenic
1118001302 14:61526216-61526238 ACAGTCACTTATATGGGACATGG + Intronic
1120063753 14:80015501-80015523 ATGTTACCTTATATGGCAAAAGG - Intergenic
1120221878 14:81743592-81743614 ATGTGCACTTCTTTGAAACATGG + Intergenic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1121290807 14:92773446-92773468 ATGTTACCTTATATGCAAAAGGG - Intergenic
1121476586 14:94213498-94213520 ATGTTACCTTATTTGGAAAAGGG + Intronic
1121908516 14:97768638-97768660 ATGTTCATTTACATGGCAAAGGG + Intergenic
1122038202 14:98963657-98963679 ATGTGGACATATATGGAACTTGG - Intergenic
1202938809 14_KI270725v1_random:122268-122290 ATGGCCACTTATATGGTATATGG - Intergenic
1123394384 15:19915613-19915635 ATGGCCACTTATATGGTATATGG + Intergenic
1124987012 15:34629693-34629715 ATGTGTACTAATATGGAAAAGGG + Intergenic
1125446198 15:39759925-39759947 ATGTTACCTTATTTGGAAAAAGG - Intronic
1126551394 15:49934358-49934380 AAGTTCACTTCTTTGGTACATGG - Intronic
1127392224 15:58515225-58515247 ATGTTACCTTATATGGAAAAGGG - Intronic
1128485864 15:68087698-68087720 ATGTTCAATGATCTGTAACAGGG - Intronic
1128879268 15:71228075-71228097 ATGCTAACTTATTTGGAAAAAGG + Intronic
1129505405 15:76077493-76077515 ATGTTACCTTATCTGGAAAAGGG + Intronic
1130620830 15:85460564-85460586 ATTTTACCTTATATGGCACAAGG + Intronic
1131424582 15:92335122-92335144 CTTTTCAGGTATATGGAACAGGG + Intergenic
1131510305 15:93046100-93046122 ATGTTCCCTTAGATGGCAAAAGG + Intronic
1132027943 15:98418882-98418904 AGGGTGAATTATATGGAACATGG - Intergenic
1132292261 15:100712049-100712071 ATATCTACTTATCTGGAACAGGG - Intergenic
1134864088 16:17589502-17589524 CTGTTCTCTTATATGGAAAAGGG + Intergenic
1135122545 16:19778855-19778877 ATGTTCCCTTATATGGCAGAAGG + Intronic
1135408263 16:22213936-22213958 ATGTTACCTTATATGGCAAAAGG - Intronic
1136700412 16:32133712-32133734 ATGGCCACTTATATGGTATATGG + Intergenic
1136767243 16:32793753-32793775 ATGGCCACTTATATGGTATATGG - Intergenic
1136800905 16:33076948-33076970 ATGGCCACTTATATGGTATATGG + Intergenic
1136863506 16:33719144-33719166 ATGGCCACTTATATGGTATATGG - Intergenic
1136869034 16:33786620-33786642 ATGGCCACTTATATGGTATATGG + Intergenic
1136944738 16:34634941-34634963 ATGGCCACTTATATGGTATATGG + Intergenic
1136947684 16:34674081-34674103 ATGGCCACTTATATGGTATATGG + Intergenic
1136955086 16:34774042-34774064 ATGGCCACTTATATGGTATATGG + Intergenic
1136958801 16:34820467-34820489 ATGGCCACTTATATGGTATATGG + Intergenic
1137085365 16:36114268-36114290 ATGGCCACTTATATGGTATATGG - Intergenic
1137087528 16:36145881-36145903 ATGGTCACTTATATGGTATATGG + Intergenic
1137091962 16:36204062-36204084 ATGGCCACTTATATGGTATATGG + Intergenic
1137221867 16:46461558-46461580 ATGGCCACTTATATGGTATATGG - Intergenic
1137886950 16:52115375-52115397 ATGTTAATTTATATGGCAAAAGG - Intergenic
1138888730 16:61114697-61114719 ATGTTAATTTATATGGCAAAGGG + Intergenic
1138894085 16:61181947-61181969 ATGTTTACCTATATCTAACAGGG + Intergenic
1140161468 16:72499349-72499371 ATGTTCACAAAAATGGAAAAGGG - Intergenic
1141674698 16:85511593-85511615 ATGTGAACTTATTTGGAAAAGGG + Intergenic
1203069639 16_KI270728v1_random:1055999-1056021 ATGGCCACTTATATGGTATATGG - Intergenic
1203103139 16_KI270728v1_random:1329448-1329470 ATGGCCACTTATATGGTATATGG - Intergenic
1203124995 16_KI270728v1_random:1567285-1567307 ATGGCCACTTATATGGTATATGG - Intergenic
1143169505 17:4919613-4919635 ATGTTACCTTATTTGGAAAAAGG + Intergenic
1143674400 17:8421303-8421325 ATGTTACCTTATATGGCAAAAGG + Intronic
1143814009 17:9496621-9496643 ATGTTCCCTTACATGGCAAAAGG + Intronic
1143891638 17:10106827-10106849 ATGTTACCTTATATGGCAAAAGG + Intronic
1145324340 17:21788370-21788392 ATGGCCACTTATATGGTATATGG - Intergenic
1145326268 17:21830433-21830455 ATGGCCACTTATATGGTATATGG + Intergenic
1145689327 17:26719915-26719937 ATGGCCACTTATATGGTATATGG + Intergenic
1146542469 17:33709325-33709347 ATGTTACCTTATATGGCAGAAGG + Intronic
1146548042 17:33756050-33756072 ATGTTCAATTACAGGGAAAACGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149137717 17:53389750-53389772 ATATGCATTTTTATGGAACATGG - Intergenic
1150618969 17:66794549-66794571 ATGTTCACATTTAGGGAACCTGG - Intronic
1150836503 17:68568842-68568864 ATGTTACCTTATATGGAAAAAGG - Intronic
1150931310 17:69588375-69588397 ATGTTCATTTCTATGGGAAAGGG - Intergenic
1151271867 17:73003033-73003055 ATGTTACCTTATATGAAAGAAGG - Intronic
1203182510 17_KI270729v1_random:75561-75583 ATGGCCACTTATATGGTATATGG + Intergenic
1203190453 17_KI270729v1_random:181058-181080 ATGGCCACTTATATGGTATATGG + Intergenic
1153872110 18:9331065-9331087 ATGTTGTCTTATATGGCAAAAGG + Intergenic
1154088078 18:11326956-11326978 ATGTTACCTTACATGGCACAGGG + Intergenic
1154284643 18:13041031-13041053 ATTTTCACTCATAAAGAACACGG - Intronic
1155244728 18:23896547-23896569 ATGTATACTTAGATGGAATATGG + Intronic
1155317800 18:24589801-24589823 ATGTTCTGTTATATGGTAGAAGG + Intergenic
1156310427 18:35917474-35917496 ATATTCCCTTATATGGCAAAAGG - Intergenic
1156396835 18:36706597-36706619 ATGTTCAGTGGAATGGAACATGG + Intronic
1156583615 18:38408336-38408358 ATGTTACCTTATTTGGAAAAAGG - Intergenic
1157434820 18:47659514-47659536 ATGTTACCTTATATGGCAAAAGG + Intergenic
1158590467 18:58774673-58774695 ATGTTACCTTATATGGCAAAAGG + Intergenic
1159525836 18:69587501-69587523 ATGTGCCCTTATTTGGAAAAGGG - Intronic
1159790150 18:72768536-72768558 ATGTTACTTTATATGGAAAAAGG + Intronic
1160391882 18:78540233-78540255 ATGTAGACTTATTTGGAAAAGGG + Intergenic
1161458614 19:4382664-4382686 CTGTTCCCTTACATGGAAAATGG - Intronic
1162656555 19:12135685-12135707 CTGTTCATTGATTTGGAACATGG - Intronic
1166148652 19:40854514-40854536 ATGTTCACGTGTATGCAACATGG - Intronic
1166152792 19:40886299-40886321 ATGTTCACGTGTATGCAACATGG - Intronic
1166177440 19:41084659-41084681 ATGTTGACATGTATGCAACATGG + Intergenic
1202668693 1_KI270709v1_random:27463-27485 ATGGCCACTTATATGGTATATGG + Intergenic
926489453 2:13506010-13506032 TTGTTGACTTATACGGTACAAGG - Intergenic
927470591 2:23373091-23373113 ATGTTACCTTATATGGCAAAAGG + Intergenic
930336624 2:50057071-50057093 ATATTGGCTTATATGGAAAATGG - Intronic
930379839 2:50613910-50613932 ATCTTCACTTATATGAACCCAGG - Intronic
931604037 2:64033846-64033868 CTGTTCATTTATTTGGAATAAGG + Intergenic
931940395 2:67245781-67245803 ATGTTCTCTCATATGGAAAAAGG + Intergenic
932376080 2:71237162-71237184 ATGTTAACTTACATGGTAAAAGG - Intergenic
934032885 2:88064369-88064391 ATGTTACCTTATATGGCAAAAGG - Intergenic
934103034 2:88671140-88671162 ATGTTACCTTATATGGCAAAGGG + Intergenic
934252598 2:90372408-90372430 ATGGCCACTTATATGGTATATGG - Intergenic
934256840 2:91430537-91430559 ATGGCCACTTATATGGTATATGG + Intergenic
935323861 2:101916732-101916754 ATATTGAATTATGTGGAACACGG + Intergenic
935932808 2:108147308-108147330 CTGTTCAAATATATGGTACACGG + Intergenic
937330446 2:121024009-121024031 ATGTTACCTTATATGGCAAAAGG + Intergenic
938801793 2:134770640-134770662 ATGTTACCTTACATGGAAAAAGG - Intergenic
938806620 2:134812174-134812196 ATATTCACAAATATGGTACATGG - Intergenic
939104468 2:137933118-137933140 ATTTTCTCTTCTATGAAACAAGG - Intergenic
939512268 2:143122106-143122128 GTGTTCCCTTATCTGGAAAAAGG + Intronic
940600840 2:155857793-155857815 ATATTCACCTAAATGGAACACGG + Intergenic
941512205 2:166425818-166425840 ATATTAACTTATATGGCAAAGGG - Intronic
941956362 2:171209249-171209271 GGGGTTACTTATATGGAACAGGG + Intronic
941957573 2:171220158-171220180 ATGTTATCTTATATGGAAAAAGG - Intronic
942297717 2:174533821-174533843 ATGTTCTCTTATGTGGCAAAAGG + Intergenic
942801949 2:179885660-179885682 CTGTTTGTTTATATGGAACATGG - Intergenic
943069384 2:183122885-183122907 ATGTTACCTTATATGGCAAAAGG + Intronic
944156137 2:196609632-196609654 ATGTTATTTTATATGGAAAAGGG - Intergenic
945060910 2:205908053-205908075 ATGTTACCTTATTTGGAAAAAGG - Intergenic
945230977 2:207589499-207589521 ATGTTACCTTATATGGCAAAGGG - Intronic
945507767 2:210662472-210662494 GTGTCCACTTATCTGGTACATGG - Intronic
945729403 2:213514964-213514986 TTGTTCACTTATAAGCATCAAGG + Intronic
947274188 2:228372256-228372278 CTGTTAGCTTATATGGTACATGG - Intergenic
947274894 2:228379478-228379500 ATGTTATGTTATATGGAAAAGGG - Intergenic
947985413 2:234443687-234443709 ATGTTACCTTATATGGAAAATGG + Intergenic
1168809574 20:695713-695735 GTGATCAATTATGTGGAACAAGG - Intergenic
1169748449 20:8966662-8966684 ATGTTTATTTATATGGAAGAGGG - Intronic
1170594231 20:17793311-17793333 ATGTTACCTTATATGCAAAAAGG + Intergenic
1170632530 20:18077667-18077689 ATATTACCTTATTTGGAACAAGG + Intergenic
1173429167 20:42970534-42970556 CAGTTCCCTTATATAGAACATGG + Intronic
1173474657 20:43350452-43350474 ATGTGCCCTTATTTGGAAAAAGG + Intergenic
1174551923 20:51368392-51368414 ATGTAAACTTATTTGGAAAAAGG - Intergenic
1174711613 20:52711993-52712015 ATGTTACCTTACATGGAAAAGGG - Intergenic
1174972869 20:55296934-55296956 ATGATCAATTAAATGGAATAAGG - Intergenic
1176584508 21:8566868-8566890 ATGGCCACTTATATGGTATATGG + Intergenic
1176883278 21:14224213-14224235 ATGTTACCTTATTTGGAAAAAGG - Intronic
1178933297 21:36838365-36838387 ATGTTTACTTACTTGGAAAAAGG + Intronic
1179530479 21:42015192-42015214 ATGTTACCTTATATGAAAAAAGG - Intergenic
1179944538 21:44662934-44662956 ATGTCAAAATATATGGAACATGG + Intronic
1180267319 22:10543770-10543792 ATGGCCACTTATATGGTATATGG + Intergenic
1182161474 22:28126546-28126568 ATGTTGATTTAGATGGAAAAAGG + Intronic
1184529195 22:45043625-45043647 ATGTTTCCTTATATGGTAAAAGG + Intergenic
1185092495 22:48783893-48783915 AAGTTCCCTTATCTGGAGCAAGG - Intronic
1203287983 22_KI270735v1_random:684-706 ATGGCCACTTATATGGTATATGG - Intergenic
1203325944 22_KI270738v1_random:17881-17903 ATGGCCACTTATATGGTATATGG - Intergenic
950570179 3:13794938-13794960 ATGTTACCTTATATGGCAAAAGG + Intergenic
950796403 3:15513847-15513869 ATGTTACCTTATATGGAAAATGG + Intronic
951460579 3:22947076-22947098 ATGTGCATTTATATGGAAGATGG - Intergenic
952089853 3:29871993-29872015 TTTTTCACTTATGTAGAACATGG - Intronic
952126367 3:30305376-30305398 ATGTTATGTTATATGGAAAATGG - Intergenic
952242340 3:31544989-31545011 AATTAAACTTATATGGAACAAGG - Intronic
954516309 3:51180684-51180706 ATGTTACCTTATTTGGAAAAAGG - Intronic
955264365 3:57427247-57427269 ATGTGATCTTATATGGAAAAAGG + Intronic
955526715 3:59828096-59828118 ATGTTCAATTCTGTGGAAAAAGG + Intronic
957449518 3:80360351-80360373 ATGTTACCTTGTATGGAAAAAGG + Intergenic
959016814 3:101144038-101144060 ATGTTACCTTATATGGCACAAGG + Intergenic
959021214 3:101189272-101189294 ATGTTCACTTACATGGCAAAAGG - Intergenic
959283425 3:104377444-104377466 ATGTTACCTTACATGGAAAAAGG + Intergenic
959284402 3:104389867-104389889 ATGTTAGGTTATATGGAAAAGGG + Intergenic
959425637 3:106184562-106184584 ATGTGCATTTTTATGGTACATGG + Intergenic
960206822 3:114912027-114912049 ATGTTCACTTATATGGAACAAGG - Intronic
960636970 3:119793737-119793759 ATGTTTCCTTATATGGCAAAAGG - Intronic
960748551 3:120918294-120918316 ATGTTAGCTTATATGGCAGAGGG - Intronic
962664863 3:137643768-137643790 ATACTCAAATATATGGAACAAGG + Intergenic
963006820 3:140734252-140734274 ATGTTACCTTATATAGAAAAAGG - Intergenic
964465318 3:156985501-156985523 ATGTTCCCTTACATGGCAAAAGG + Intronic
964466912 3:157003698-157003720 ATGTTTCCTTATATGGGAAAAGG - Intronic
965444282 3:168755305-168755327 ATGGGCACTTACATTGAACATGG + Intergenic
966051631 3:175623506-175623528 ATGTGAACTTATATGGAAGAAGG + Intronic
967264337 3:187677049-187677071 TTGTTCACTTCTATGGCACCAGG - Intergenic
967924916 3:194638487-194638509 ATGTTACCTTATATGGAAAAAGG - Intergenic
968956120 4:3720521-3720543 ATGTTTACTTAAATGGACTATGG - Intergenic
969094736 4:4723753-4723775 ATATACATTTATATGGAAAATGG + Intergenic
970143730 4:13010896-13010918 ATGTTGCCTTATTTGGAAAAAGG - Intergenic
970969673 4:21967165-21967187 ATGTTCACACATATGGATGATGG + Intergenic
971278766 4:25223617-25223639 ATGTTATCTTATCTGGAAAAAGG - Intronic
972247948 4:37265840-37265862 ATGTTACCTTATATGGCAAAGGG - Intronic
973176428 4:47211984-47212006 ATGTTACCTTATATGAAAAAAGG - Intronic
974455350 4:62123506-62123528 ATGTTTCCTTATATGGCAAAAGG - Intergenic
975262092 4:72315282-72315304 ATGTTACCTTATTTGGAAAAAGG + Intronic
975772769 4:77746666-77746688 ATGTTCACTCATATTCAAAAGGG + Intronic
975799035 4:78039464-78039486 ATGTTATCTTATATGGCAAAAGG + Intergenic
976764411 4:88584256-88584278 ATGTGCACTTATTTGGAAATAGG - Intronic
977861048 4:101960224-101960246 ATATTCACTTGTAAGGAAAATGG + Intronic
977928324 4:102726406-102726428 ATATTCACTTTTATAGTACAAGG + Intronic
978017030 4:103757128-103757150 ATGTTATCTTATATGGCAAAAGG - Intergenic
978220939 4:106273534-106273556 ATGTTACCTTATTTGGAAAAAGG + Intronic
978640140 4:110861012-110861034 AGGTTCACTTAACAGGAACATGG - Intergenic
979210347 4:118093449-118093471 ATGTTCAATAATAATGAACATGG - Intronic
981635670 4:146876211-146876233 ATGTACAATTATATGTTACAGGG + Intronic
982066213 4:151657015-151657037 ATTTTCATTTTTATGCAACAGGG + Intronic
982217154 4:153092244-153092266 ATGTGACCTTATATGGAAAAAGG - Intergenic
982632150 4:157844127-157844149 ATTTGCTCTTATATGCAACATGG + Intergenic
982942358 4:161574198-161574220 ATGTTACCTTATATGGCAAAGGG - Intronic
983105747 4:163683598-163683620 ATTTACACTGATAGGGAACAAGG + Intronic
983285874 4:165738398-165738420 ATGTTAACTTATATGGCAACAGG + Intergenic
983986507 4:174066206-174066228 ATTTTCAATTCTATGGAAAAGGG + Intergenic
984086037 4:175312137-175312159 ATGCTCATTTAGCTGGAACATGG + Intergenic
984210893 4:176846411-176846433 ATGTTCACTAATGATGAACAAGG + Intergenic
984358316 4:178693896-178693918 ATGTTAACTTAAAGGGAACTAGG + Intergenic
984476363 4:180240320-180240342 ATGTTCACTAATATGAAATGAGG + Intergenic
986244310 5:5991437-5991459 ATGTTACCTTATATGGTAAAAGG + Intergenic
986992772 5:13572896-13572918 TTGTTCCCTTATATGGAGCTGGG - Intergenic
987022821 5:13892331-13892353 ATGTTACCTTATATGGCAAAAGG + Intronic
987149639 5:15025758-15025780 ATGTCCAGTTCTATGGAACTAGG - Intergenic
987511829 5:18848967-18848989 ATGTTCACTTGTGTGAAGCAAGG + Intergenic
987512551 5:18858175-18858197 ATCTCCCCTTATTTGGAACAGGG - Intergenic
987648097 5:20702412-20702434 TTCTTGACTTATATAGAACATGG - Intergenic
988365960 5:30299384-30299406 ATGTTAAATTATTTGGAAAAAGG + Intergenic
989091152 5:37733333-37733355 ATGTTCTCTCATTTGGAAAAAGG - Intronic
990075363 5:51839386-51839408 AAGAGCACTTACATGGAACATGG + Intergenic
990164783 5:52982438-52982460 AAGTACAGTTATATGGAAGATGG - Intergenic
990220142 5:53579480-53579502 ATGTTACCTTATATGGCAAAAGG + Intronic
990445663 5:55891712-55891734 ATGTTTCCTTATATGGTAAAAGG - Intronic
990516504 5:56535520-56535542 ATGTTACCTTATATGGCAAAAGG - Intronic
990610131 5:57448622-57448644 ATGTTCACTAAAATAGAATACGG - Intergenic
990828551 5:59930225-59930247 ATGTGAACTTATTTGGAAAAAGG + Intronic
991122137 5:63028938-63028960 ATGTTACCTTATATGGCATAGGG + Intergenic
991398203 5:66226423-66226445 ATGTTACCTTATAAGGAAAAGGG - Intergenic
991650247 5:68845246-68845268 ATGTTACCTTGTATGGATCAAGG - Intergenic
993443720 5:87987086-87987108 ATGTTCTCTCATAAGGAAAAAGG + Intergenic
993865914 5:93195272-93195294 ATTTTCAATTCTATGGAACCAGG + Intergenic
994577077 5:101591879-101591901 ATGTTAAGTTATATGGCAAAAGG - Intergenic
995627795 5:114098254-114098276 ATGTTCCCTTACATGGTAAAAGG - Intergenic
996624821 5:125557829-125557851 ATGTTATCTTACATGGTACAAGG - Intergenic
996642779 5:125777089-125777111 ATGTTACCTTATATGGCAAAGGG - Intergenic
997254476 5:132417811-132417833 ATGTTCCCCTATATGGCATAAGG - Intronic
997370769 5:133358243-133358265 ATGTCCCCTTACATGGCACAGGG - Intronic
998745651 5:145256518-145256540 ATGTTAGATTATATGGAAAAGGG - Intergenic
999029143 5:148270679-148270701 ATGTTGACTTGCATGGCACAGGG + Intronic
999965125 5:156801127-156801149 GTCTTCACAAATATGGAACAAGG - Intergenic
1002463851 5:179393895-179393917 ATGTGCTCTCATATGGAACTTGG + Intergenic
1003925420 6:10873158-10873180 ATGTTCAATTAAATGTAATAAGG - Intronic
1004583613 6:16978181-16978203 ATTTTCACTTATATTAAACTTGG + Intergenic
1005199258 6:23324787-23324809 TTGTTCACTTTGATGGAAAAAGG + Intergenic
1005545809 6:26869567-26869589 TTCTTGACTTATATAGAACATGG + Intergenic
1005761841 6:28974570-28974592 ATGTTAACTTACATGGCAAAGGG + Intergenic
1006214989 6:32433610-32433632 ATCTTCAGTTATGTGGCACATGG + Intergenic
1006659880 6:35632012-35632034 ATTTTCACTAAAATGGAAGAGGG - Intronic
1008014339 6:46501481-46501503 ATCTACACTTAAATGGGACAAGG + Intergenic
1008273221 6:49514193-49514215 GTGGTCACTTTTAGGGAACAGGG - Intronic
1008362658 6:50639833-50639855 ATTTTAATTTATATGTAACAAGG - Intergenic
1008457173 6:51724688-51724710 ATGTTATCTTATATAGAAAAGGG + Intronic
1008618158 6:53245932-53245954 ATGTTACCTTATATGGCAAAGGG - Intergenic
1009016521 6:57910347-57910369 TTCTTGACTTATATAGAACATGG + Intergenic
1009534893 6:64869201-64869223 ATGTTCATGTTTATGGAACATGG - Intronic
1009818144 6:68763495-68763517 ATGTTAACTTATTTGTAATAGGG - Intronic
1010032452 6:71285566-71285588 ATATACACATGTATGGAACAAGG - Intergenic
1010158466 6:72823067-72823089 ATGTTGCCTTATATGGCAAAGGG - Intronic
1011954059 6:93003052-93003074 ATGTTCTATTATATGTAAAATGG + Intergenic
1012228011 6:96726958-96726980 ATGTTACCTTATATGGCAAAAGG + Intergenic
1014662351 6:124188841-124188863 ATATTTAATTATATTGAACATGG - Intronic
1014965933 6:127750743-127750765 ATGTTCTTTTATATGTCACAAGG - Intronic
1015118917 6:129680138-129680160 ATGTGAACTTATTTGGAAAAAGG - Intronic
1015481479 6:133715800-133715822 ATGTTACCTTATTTGGAAGATGG - Intergenic
1016964548 6:149706557-149706579 ATGTTATCTTATTTGGAAAAAGG + Intronic
1017857054 6:158359042-158359064 ATGTTCTTTTATATTGAATAAGG + Intronic
1020954339 7:14721200-14721222 ATCTTCACTTATTTAGAACATGG + Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022734253 7:33061715-33061737 ATGTTCACATGTATAGCACACGG + Intronic
1024925328 7:54606994-54607016 ATGTTGCCTTATTTGGAAAAAGG + Intergenic
1025306145 7:57858652-57858674 ATGGCCACTTATATGGTATATGG - Intergenic
1025319206 7:58075009-58075031 ATGGCCACTTATATGGTATAAGG + Intergenic
1025477621 7:60945478-60945500 ATGGCCACTTATATGGTATATGG + Intergenic
1025483041 7:61009753-61009775 ATGGCCACTTATATGGTATATGG + Intergenic
1025489468 7:61095045-61095067 ATGGCCACTTATATGGTATATGG - Intergenic
1025554504 7:62288182-62288204 ATGGCCACTTATATGGTATATGG - Intergenic
1025560277 7:62365092-62365114 ATGGCCACTTATATGGTATATGG + Intergenic
1025563127 7:62396723-62396745 ATGGCCACTTATATGGTATATGG + Intergenic
1025564353 7:62414124-62414146 ATGGCCACTTATATGGTATATGG + Intergenic
1028014718 7:85692965-85692987 ATGTTTACTTATAAGGAAAATGG + Intergenic
1028156265 7:87433359-87433381 ATATTTACTTATATGGAAGCTGG + Intronic
1028335844 7:89653586-89653608 ATGTTACCTTATTTGGAAAAGGG + Intergenic
1028917104 7:96271088-96271110 ATGTTACCTTATTTGGAAAAAGG - Intronic
1028950012 7:96624067-96624089 ATGTTACCTTATTTGGAAAAGGG - Intronic
1029348087 7:99993171-99993193 ATGGTCTCTGAAATGGAACAAGG - Intergenic
1029853923 7:103494075-103494097 ATCTTCACTCTTAAGGAACAGGG + Intronic
1030858447 7:114591494-114591516 ATGTTCAGTTATATGTCAGATGG + Intronic
1031132043 7:117843881-117843903 ATGTTCCCTTACATGGCAAAAGG + Intronic
1031792177 7:126119702-126119724 ATGTTACCTTATTTGGAAAAAGG - Intergenic
1031819225 7:126478114-126478136 ATGTGATCTTATATGGAAAAGGG - Intronic
1032527456 7:132590180-132590202 TAGTTCACTTTTATGGAACCAGG - Intronic
1033578767 7:142712440-142712462 ATGTTCAGTTAGATGGCAAATGG - Intergenic
1033629578 7:143143415-143143437 ATAGTCTCTTATTTGGAACAAGG - Intergenic
1036195684 8:6711959-6711981 ATGTTTTCTTATTTGGAAAAAGG - Intronic
1037181931 8:16017780-16017802 ATCTTCACAGGTATGGAACAAGG - Intergenic
1039395149 8:37219497-37219519 AAATTCACTTAAGTGGAACACGG + Intergenic
1040745627 8:50638054-50638076 ATGTTACCTTATGTGGAAAAAGG + Intronic
1041888447 8:62841073-62841095 ATGTTATCTTACATAGAACAAGG + Intronic
1042156697 8:65851699-65851721 ATGTGAACTTATTTGGAAAAAGG + Intergenic
1042851880 8:73225062-73225084 ATGTGAACTTATTTGGAAAAAGG - Intergenic
1043094299 8:75946949-75946971 AGGTTGTCTTATACGGAACAGGG + Intergenic
1044182533 8:89213550-89213572 ATGTTCAATTAAATGCACCATGG - Intergenic
1044300847 8:90581245-90581267 ATGTTACCTTATATGGCAAAAGG - Intergenic
1044828192 8:96219205-96219227 ATGTTAACCTACATGGAAAAAGG + Intergenic
1045664882 8:104473570-104473592 ATGTTGCCTTATATGGCAAAAGG - Intergenic
1045804725 8:106145182-106145204 ATGTTATCTTATTTGGAAAAAGG + Intergenic
1045987925 8:108271254-108271276 ATGTTACTTTATAAGGAACAAGG - Intronic
1047917190 8:129594822-129594844 ATGCTACCTTATATGCAACAGGG - Intergenic
1048409743 8:134160521-134160543 TTGTTAAATTATTTGGAACAAGG + Intergenic
1049270652 8:141693907-141693929 ATGTTCCCTTATATGGGAAAAGG + Intergenic
1052509412 9:29396333-29396355 ATGTTAGCTTATATGGCAAAAGG - Intergenic
1052708393 9:32021415-32021437 ATGTTATCTTACATGGAAAAAGG - Intergenic
1052762412 9:32606078-32606100 ATGTTCTCTTAAATGGAGCCAGG - Intergenic
1054754251 9:68941243-68941265 ATGTTACCTTATATGGCAAAAGG + Intronic
1054862426 9:69967569-69967591 ATGTTACCTTATATGGTAAAAGG - Intergenic
1054919233 9:70525252-70525274 ATGTTACCTTATATGGCAAAAGG - Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1056233324 9:84568803-84568825 ATGTTATCTTATATGGAAGAAGG + Intergenic
1057223554 9:93271388-93271410 ATGTTAACTTGCATGGAAAAAGG + Intronic
1058442008 9:105018076-105018098 ATGTTACCTTACATGGAAAAAGG - Intergenic
1059319378 9:113456325-113456347 ATCTTCACTTGGATGGCACATGG + Intronic
1060144880 9:121243402-121243424 ATGTTAGCTTATATGGCAAAAGG - Intronic
1062151230 9:135020177-135020199 ATGTTGCCTTATATGGAAACTGG + Intergenic
1203614408 Un_KI270749v1:44395-44417 ATGGCCACTTATATGGTATATGG + Intergenic
1186371345 X:8950478-8950500 ATGTTCTGATATATGGTACATGG - Intergenic
1186429015 X:9488586-9488608 ATGTTTCCTTATATGGTAAAAGG - Intronic
1187093055 X:16117713-16117735 ATGTTCCCTTATATGGCAAAAGG + Intergenic
1189158524 X:38785580-38785602 ATGTGAACTTATTTGGAATAAGG + Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1190155784 X:47991555-47991577 ATATCCATTTATATGGAACAAGG - Intronic
1190327937 X:49218275-49218297 ATGGTCACTTGGAAGGAACATGG + Intronic
1191851790 X:65590774-65590796 AACTTCACTACTATGGAACATGG + Intronic
1192491859 X:71582867-71582889 TTGTTCACTTTTGTGGAAGAAGG + Intronic
1193426592 X:81347485-81347507 ATGTTACCTTATTTGGAAAAAGG - Intergenic
1194408359 X:93526497-93526519 ATGTTGCCTTACATGGAAAAAGG + Intergenic
1195222948 X:102763700-102763722 ATGTTCTGTTATATGGCAAAAGG + Intergenic
1195287473 X:103398947-103398969 ATGTTCTGTTATATGGTAAAAGG + Intergenic
1195954505 X:110315300-110315322 AAGTTCACTTAAGTGGAAAATGG - Intronic
1196983487 X:121241755-121241777 ATGTTGCCTTATATGGCAAAAGG - Intergenic
1198677656 X:139147933-139147955 ATGTTGCCTTATTTGGAATAGGG - Intronic
1199768339 X:150956979-150957001 ATGTTGCCTTATATGGAAAAAGG - Intergenic
1201620622 Y:15953096-15953118 ATGGGAACTTATATGGAAAAGGG + Intergenic