ID: 960208239

View in Genome Browser
Species Human (GRCh38)
Location 3:114929264-114929286
Sequence CTGAAAAAACAGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 1, 2: 7, 3: 95, 4: 827}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960208236_960208239 13 Left 960208236 3:114929228-114929250 CCAGGGAAGAAAAGACTACTACA 0: 1
1: 0
2: 1
3: 13
4: 217
Right 960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG 0: 1
1: 1
2: 7
3: 95
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960208239 Original CRISPR CTGAAAAAACAGAAGCAGAG AGG Intronic
900876168 1:5343969-5343991 ATGAGAAAACAGACTCAGAGAGG - Intergenic
901364102 1:8730637-8730659 CTCAAAAAACAAAACCAGACTGG - Intronic
901915225 1:12494284-12494306 CAGAGAATACAAAAGCAGAGTGG - Intronic
902411917 1:16216770-16216792 GCGAAGAAACAGAAGCAGAAAGG + Intergenic
902556466 1:17249800-17249822 ATGAGAAAACCGAGGCAGAGAGG + Intronic
903430120 1:23290740-23290762 ATGAAAAAAAAGAACCAGAAAGG + Intergenic
903534757 1:24059690-24059712 CTGAAAAAACAGAAGCTTTTGGG + Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903593981 1:24479943-24479965 CTGAAAAAAAAAAAAAAGAGTGG + Intergenic
904231543 1:29078216-29078238 CTCAAAAAAAAGAAAAAGAGGGG + Intronic
904590726 1:31614040-31614062 CTCAAAAAACAAAACCAAAGAGG + Intergenic
904643320 1:31946833-31946855 TTGAAAACACAGCAGCAGATAGG - Intergenic
904670200 1:32158943-32158965 CTGAAACAAGAGACCCAGAGAGG - Intronic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
905823934 1:41015389-41015411 ATGAAGAAACTGAAGCACAGAGG + Intergenic
906103134 1:43275873-43275895 AAGAAAAAACAGAAGCCCAGAGG + Intergenic
906314458 1:44777230-44777252 CTAAAAATACAGAAGCAGCCGGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906786172 1:48617939-48617961 CTGATAAGTCAGAGGCAGAGAGG - Intronic
907014256 1:50996221-50996243 CTGAAGAAAAAGAACCAGAGAGG + Intergenic
907111096 1:51927253-51927275 CTGAAATCACAGAATCAAAGTGG + Intronic
907647788 1:56261526-56261548 ATGAGAAAACAGGATCAGAGTGG - Intergenic
907670544 1:56471280-56471302 ATGAAAGAAAAGAAGGAGAGAGG + Intergenic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
907946467 1:59140518-59140540 CTCAAAAAAAAGAAACAAAGCGG + Intergenic
909299654 1:73996142-73996164 GTGAAAAAAAGGAAGGAGAGTGG + Intergenic
910452261 1:87359207-87359229 CTTAATAGATAGAAGCAGAGAGG - Intergenic
910908941 1:92213813-92213835 CTCAAAAACCAAAAGCATAGAGG + Intergenic
911046432 1:93632736-93632758 CTTAAAAATCAAAAGAAGAGTGG - Intronic
911177413 1:94830970-94830992 CTGAGAAAACTGATGCAGAGAGG + Intronic
911364023 1:96915107-96915129 CTGAAATGACAGAACCAAAGGGG - Intergenic
911605537 1:99900387-99900409 ATGAAAAAACTGTATCAGAGAGG + Intronic
911721173 1:101192802-101192824 ATGAAGAAAATGAAGCAGAGAGG + Intergenic
911786822 1:101960839-101960861 CTGTAAGAATTGAAGCAGAGTGG - Intronic
911831126 1:102552517-102552539 CTGAAAAAAAACAAGCACTGGGG + Intergenic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
912564968 1:110580832-110580854 CTAAAGAGACAGAAGCTGAGGGG + Intergenic
912760375 1:112360834-112360856 ATGAAAAAACTGAGGCAGAGTGG + Intergenic
913134854 1:115878314-115878336 ATGAGAAAACAGAGGCACAGGGG + Intergenic
913550770 1:119915410-119915432 CTGACCAGTCAGAAGCAGAGTGG + Exonic
914198894 1:145466942-145466964 CTGCAAAGACAGAAACAAAGTGG + Intergenic
914478007 1:148040078-148040100 CTGCAAAGACAGAAACAAAGTGG + Intergenic
914730695 1:150367504-150367526 AAGAAAAAAGAGAAGCAAAGTGG - Intronic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915277886 1:154802168-154802190 ATGAAGAAACTGAGGCAGAGAGG + Intronic
915543378 1:156582544-156582566 CTGAAAATCCAGAACCAGTGGGG + Intronic
915755813 1:158258139-158258161 CTGAAAAATTAGAAGGAAAGGGG - Exonic
915839614 1:159203781-159203803 CTGAGGAAATAAAAGCAGAGAGG + Intronic
916259878 1:162831066-162831088 GAATAAAAACAGAAGCAGAGTGG + Intronic
916341508 1:163741432-163741454 CTGAAAAAACAGAGGAGGAGGGG - Intergenic
916723558 1:167503409-167503431 CTGAAAAACCAGATGCCAAGAGG + Intronic
916946206 1:169730367-169730389 ATCAAAAAACAGAAGCAATGAGG + Intronic
917067465 1:171112401-171112423 CTCAAAAACCTGAATCAGAGGGG + Intronic
917505141 1:175620580-175620602 CAGAGAGAAAAGAAGCAGAGGGG + Intronic
917729699 1:177862371-177862393 CTGAAAGAAGAGAAGGAGTGAGG - Intergenic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918565672 1:185928212-185928234 TGGAAAAAATAAAAGCAGAGAGG + Intronic
918572101 1:186008644-186008666 CTGAGAAAACTGAAGCCCAGAGG - Intronic
919170172 1:193943943-193943965 CTGAGAAAAAAGAACCAAAGTGG + Intergenic
919326979 1:196120463-196120485 CTGAACAAACAGAATGAAAGAGG + Intergenic
919457960 1:197842330-197842352 AAAAAAAAACAGAAGCAGGGAGG - Intergenic
919905800 1:202077550-202077572 CTATGAAAACAGAAGCACAGAGG - Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920152970 1:203924236-203924258 CTGAAAAAAAAAAAGTACAGGGG + Intergenic
920447309 1:206028437-206028459 ATGAGAAAACTGAGGCAGAGAGG + Intergenic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921164108 1:212493855-212493877 CTGATAAACAAGAAGCAGAGTGG + Intergenic
921987440 1:221327457-221327479 GTGAAAAAAATGAAGCTGAGGGG - Intergenic
922248577 1:223825287-223825309 ATGAAAACACTGAAGCACAGAGG + Intronic
922466224 1:225846899-225846921 CTGAAAAGACACAACCAGAATGG - Exonic
922880082 1:228974258-228974280 CTGACAAAACTGAGGCACAGAGG - Intergenic
923476295 1:234334550-234334572 CTGAGAAAACTGAACCAGAATGG + Intergenic
923885830 1:238154324-238154346 CTGAACTAACAGAAGCTGAAGGG + Intergenic
923921289 1:238566696-238566718 CTGCAAAACAACAAGCAGAGGGG + Intergenic
924256239 1:242185758-242185780 CTTAAAAAAAAATAGCAGAGAGG - Intronic
924415857 1:243855937-243855959 CTGAAGAAACTAAAGCTGAGGGG - Intergenic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
924916692 1:248577102-248577124 CTGACAAAACAGACTCTGAGTGG + Intergenic
924931100 1:248733101-248733123 CTAAAGGAACAGAAGCTGAGAGG + Intronic
1063018139 10:2098678-2098700 ATGAAATAAGAGAAGCAGACAGG - Intergenic
1063297225 10:4818883-4818905 CTTAAAAAAAAAAAGCACAGTGG + Intronic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064180181 10:13107933-13107955 TTGGTAACACAGAAGCAGAGTGG + Intronic
1064859748 10:19815437-19815459 CTGAAAAAACAAAAACAAACTGG + Intergenic
1064967437 10:21029573-21029595 CTGACAAAACAGATACAGACTGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1067108799 10:43383997-43384019 CTTAACAAAAAGAAGCAGCGTGG - Intergenic
1067161678 10:43830773-43830795 TTGAACTCACAGAAGCAGAGAGG + Intergenic
1067373431 10:45705717-45705739 TTGAGAAAACAGAAGCAGAAAGG + Intergenic
1067380262 10:45766497-45766519 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067688233 10:48480767-48480789 ATGAGAAAACTGAAGCACAGAGG + Intronic
1067887963 10:50107151-50107173 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1068706570 10:60083081-60083103 CTCCAAGAACAGAAGGAGAGAGG - Intronic
1068716598 10:60195640-60195662 CTGAGAAAAGAGAAACTGAGTGG - Intronic
1068755814 10:60651679-60651701 GTGAGAAAACTGAGGCAGAGAGG - Intronic
1068773261 10:60845770-60845792 CTGAACTAACAGAATCAGATGGG - Intergenic
1069614021 10:69794949-69794971 TTTAAAAAACAGATGCAGAGAGG + Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070678335 10:78431072-78431094 CTGTGGAAAGAGAAGCAGAGAGG - Intergenic
1070830910 10:79417641-79417663 ATGAAGAAAGAGAAGAAGAGTGG + Intronic
1072861297 10:99007807-99007829 CTGAGAAAGCAGGAGCAGTGAGG + Intronic
1074080570 10:110165202-110165224 ATGAGAAAACAGAGGCACAGAGG - Intergenic
1074196682 10:111194384-111194406 CCGCAAAAACAGAAGCAAATGGG - Intergenic
1074420686 10:113306377-113306399 ATCAAAAAACACAAGCAGTGGGG - Intergenic
1074466131 10:113682485-113682507 CTGAAAAGGGGGAAGCAGAGAGG - Intronic
1074563475 10:114554924-114554946 ATGAAAAAACTGAAGCCCAGTGG - Intronic
1074948051 10:118300241-118300263 CTGAAAAACCAGTGGCACAGAGG + Exonic
1075399953 10:122153768-122153790 ATGAGAAAACGGAAGCACAGAGG + Intronic
1075424536 10:122331303-122331325 CAGAAAAAACAAAGTCAGAGAGG - Intronic
1076146741 10:128127777-128127799 CTGCAAATGCAGAAGCAGTGAGG + Intergenic
1076226041 10:128776335-128776357 ATGAAAAAATATAATCAGAGGGG - Intergenic
1076400454 10:130180714-130180736 CTGAAGAGACAGCAGCAGTGTGG - Exonic
1078113492 11:8420980-8421002 CTGAAAAAAAAAAAGGGGAGGGG + Intronic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1078737333 11:14032615-14032637 ATGAGAAAACAGACCCAGAGAGG + Intronic
1078742971 11:14085411-14085433 CTGACAAAAAAAAAGCAGTGGGG - Intronic
1078996542 11:16706597-16706619 CAGGAAAATGAGAAGCAGAGAGG + Intronic
1079004011 11:16779944-16779966 ATGAAAAAACAAAAGCTCAGAGG - Intronic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079145082 11:17843873-17843895 CTAAAACATCAGAACCAGAGGGG + Intronic
1080039719 11:27746871-27746893 ATGAAGAAAGAGAAGCAGACAGG + Intergenic
1080663990 11:34319616-34319638 CTGATAAAACAGAGGCTGGGAGG - Intronic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1080830919 11:35892628-35892650 CTGAAAAATCAGAAGGGTAGTGG + Intergenic
1081031048 11:38084214-38084236 CTGAAAAATAAGAGGAAGAGAGG - Intergenic
1081322597 11:41709418-41709440 CTGTAAAAAGAGAAGCAAAGGGG - Intergenic
1081583185 11:44366316-44366338 TTGAAGAAACAGACGTAGAGAGG - Intergenic
1082620317 11:55412605-55412627 CTGAAAAGACAGAAGTAAATAGG - Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082965648 11:58964004-58964026 ATGCAAGTACAGAAGCAGAGCGG + Intronic
1085024880 11:73230569-73230591 CTGAGGAAACAGAAGCAGTCTGG + Intronic
1085062043 11:73456050-73456072 GTTAAAAAACTGATGCAGAGAGG - Intronic
1085382494 11:76133003-76133025 ATGAAGAAACTGAAGCACAGAGG - Intronic
1085646118 11:78224094-78224116 ATAAAAAAAAGGAAGCAGAGTGG + Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085798256 11:79563628-79563650 ATGAAGAAACTGAAGCAGAGAGG + Intergenic
1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG + Intergenic
1087272555 11:96126255-96126277 CAGTAAAAACAATAGCAGAGAGG + Intronic
1087375254 11:97331782-97331804 CTGAAAATATAGAAGTGGAGGGG - Intergenic
1088368767 11:109066338-109066360 CTGAGAAATCTGAAGCAAAGAGG + Intergenic
1088416941 11:109599731-109599753 CTGAAGAAACACAAGCATAAAGG - Intergenic
1088620725 11:111680119-111680141 CTCAAAAAAAAAAAGCAGTGGGG + Intronic
1089029164 11:115305410-115305432 CTGAAAACACAGAAAAGGAGAGG - Intronic
1089036095 11:115393556-115393578 CTGAAAAAAAAAAAACATAGAGG + Intronic
1089559513 11:119336737-119336759 CAGAAAAACCAGAAGCAGACAGG - Exonic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089801123 11:121028525-121028547 ATCAGAAAACTGAAGCAGAGAGG - Intronic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090223197 11:125049161-125049183 CTGAAAAATGAGAAACAGTGAGG - Intergenic
1090824483 11:130374644-130374666 CTGAAAAAAAAGAAACGGAAGGG + Intergenic
1091192798 11:133708355-133708377 ATGCAGAAACAGAAGCACAGAGG - Intergenic
1091275270 11:134345469-134345491 CTCAAAAAAAAGAAACAGACAGG - Intronic
1091413648 12:261386-261408 CTGAAAGAGCAGGGGCAGAGTGG - Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091520244 12:1232243-1232265 CTGAAAAATCAAAGGCAAAGAGG - Intronic
1091701992 12:2669540-2669562 CTCACAAAACAGAAGGAGACGGG + Intronic
1092165903 12:6342026-6342048 CTGAGAAAATTAAAGCAGAGAGG + Exonic
1092306046 12:7302187-7302209 GGGAGAAAAGAGAAGCAGAGTGG - Intergenic
1092691308 12:11113440-11113462 CTGACAAAAAACAAGCAGTGAGG + Intronic
1093028710 12:14268433-14268455 CAAAAAAAGCAAAAGCAGAGAGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093548721 12:20380371-20380393 CTGAAAAATCAGAAGCTTATAGG + Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094049839 12:26206907-26206929 ATGAAAATACAGAGGGAGAGTGG - Intronic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1094410862 12:30167694-30167716 GGAGAAAAACAGAAGCAGAGTGG - Intergenic
1094715104 12:33005999-33006021 CTGCAGAAAGAGAGGCAGAGTGG - Intergenic
1094734169 12:33214934-33214956 CTGAAACCACAGAAGTAGAAAGG + Intergenic
1095328901 12:40932991-40933013 TTGAAAAGAGAGAAGGAGAGAGG - Intronic
1095378503 12:41560111-41560133 CGGAAAAAACAGAAATAGGGAGG - Intronic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1096644410 12:53022535-53022557 CTGACAAAACAGATACAGACTGG + Exonic
1096653202 12:53072371-53072393 ATAACAAAACAGAAGCAGTGGGG - Intronic
1097122672 12:56747742-56747764 CTCAAAAAAAAGAACCTGAGAGG + Intronic
1097977416 12:65702132-65702154 CTGAACAAACAGAAAAAAAGTGG - Intergenic
1098192549 12:67965857-67965879 AGGAAAATATAGAAGCAGAGAGG - Intergenic
1098203066 12:68077743-68077765 TTGAAGAAACAGAGGCAAAGAGG - Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1099076882 12:78120734-78120756 ATGAGAAAACAGACTCAGAGAGG - Intronic
1099151826 12:79123944-79123966 ATAACAAAACAGAAGCAGGGTGG - Intronic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1100990884 12:100250214-100250236 CTAAAAAAACAGAAACATACTGG - Intronic
1100994058 12:100282920-100282942 CTAGAAAAACAGAAGGATAGTGG - Intronic
1101272625 12:103163599-103163621 ATTAAAAAACAAAAGCAGAGAGG + Intronic
1101488234 12:105187436-105187458 CTGAAAAAACTGAGGTACAGAGG + Intronic
1101525590 12:105526018-105526040 CTCCACAAACAGAAGCAGAATGG - Intergenic
1101540991 12:105665330-105665352 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1101771628 12:107757029-107757051 CTGAAGAAACTGAAACAGTGGGG + Intronic
1101847387 12:108373412-108373434 CTGGAAAATGAGAAGCAGACAGG - Intergenic
1101875198 12:108592829-108592851 ATGAAAAAACAGAGGCTGAGAGG + Intronic
1101914094 12:108883012-108883034 CTTAAAAAAAAGAAAAAGAGTGG + Intronic
1101982532 12:109420118-109420140 CTGAATATACAGAAACAGAGTGG - Intronic
1102473984 12:113176778-113176800 CTGGGAAAGCAGAGGCAGAGAGG - Intronic
1102480963 12:113222707-113222729 CTAAAAAAAAAGAGGCAGGGGGG - Intronic
1103184612 12:118945696-118945718 CTGAAATTCAAGAAGCAGAGGGG - Intergenic
1103212472 12:119176773-119176795 GTGAAAAAACAGAGGCACAGAGG - Intergenic
1103316960 12:120063924-120063946 GTGAGAAAACAGAGGCAAAGAGG - Intronic
1103424794 12:120823786-120823808 ATGAAAAAACAGAAACATAGTGG + Intronic
1103568046 12:121826942-121826964 CTGAAAACACCCAGGCAGAGAGG + Intronic
1103839246 12:123849508-123849530 CTGAAAACACAGGACCAGCGTGG + Intronic
1103974546 12:124693898-124693920 CTAAAAAAACAAAAACAGACCGG + Intergenic
1104516422 12:129431322-129431344 CTGGAAAATCTGAAGCAGAGAGG - Intronic
1105027348 12:132857725-132857747 CTGAAAACACAGAGGCCGTGTGG - Intronic
1105261530 13:18783174-18783196 CTGTAAAAAAAAAAGCACAGTGG - Intergenic
1105263878 13:18799752-18799774 CTGTAAAAAAAAAAGCATAGTGG - Intergenic
1105580174 13:21688189-21688211 GTGACAAATCAGAAGCTGAGTGG - Intronic
1105757370 13:23480428-23480450 CTAAACAAACAAAAGCTGAGAGG - Intergenic
1106706084 13:32281293-32281315 CTAAGAAAACTGAAGCTGAGAGG + Intronic
1106776191 13:33012284-33012306 TTGAACTCACAGAAGCAGAGAGG + Intergenic
1106891980 13:34255521-34255543 CTCAAAAAGGAGAATCAGAGTGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107130525 13:36889467-36889489 ATGAGAAAACAGAAGCAAAATGG + Intronic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1107497780 13:40945480-40945502 CTCAAAAAAAAGAAGCCGACCGG - Intronic
1107933145 13:45322838-45322860 TTCATGAAACAGAAGCAGAGAGG + Intergenic
1108022461 13:46142131-46142153 CTGAAAAAAAAAAAGCAGAAAGG + Intronic
1108731601 13:53241142-53241164 CTAACAAAAGAGAGGCAGAGTGG + Intergenic
1109678240 13:65709596-65709618 ATGAGGAAACAGAAGCACAGAGG - Intergenic
1109679607 13:65733009-65733031 CTGAAAACAAGGAAGCAGGGAGG + Intergenic
1109737689 13:66508062-66508084 ATGAACAAACTGAGGCAGAGAGG - Intronic
1109773974 13:67015433-67015455 TTGAAATACCAGAAGTAGAGAGG - Intronic
1109939765 13:69346228-69346250 CTGGAATAACAGCAGTAGAGAGG + Intergenic
1109958604 13:69602517-69602539 GAGAAAAAACAGAGGCAAAGGGG + Intergenic
1110313131 13:74074121-74074143 ATGAGAAAACAGTAGCAGAAGGG - Intronic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1110632670 13:77727525-77727547 CTCAAAAAACCAAAACAGAGTGG + Intronic
1110796810 13:79647939-79647961 CAGAACAAACATCAGCAGAGAGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111244115 13:85512472-85512494 CAGAAACAATACAAGCAGAGAGG + Intergenic
1111492424 13:88998485-88998507 CTGACAAAACAGAATCAAAGGGG + Intergenic
1111572838 13:90109057-90109079 AGGAAAAAAATGAAGCAGAGAGG + Intergenic
1112198934 13:97256510-97256532 CTGGAAAAAGTGAAGCAGACAGG + Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112986939 13:105462245-105462267 CTGAAATTGCAGAAGCAAAGTGG - Intergenic
1113232455 13:108228848-108228870 ATGAGAAAACAGAAGCTCAGGGG - Intronic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1115513555 14:34162292-34162314 GTGAGAAAACTGAAACAGAGAGG + Intronic
1116550556 14:46232044-46232066 CTGAAAAAAAACAAGCAATGGGG + Intergenic
1117163282 14:53009804-53009826 CTCAAAAAAAAGAAAAAGAGAGG - Intergenic
1117422080 14:55556704-55556726 CAGAAAGAACAGAGGCAGACAGG - Intergenic
1117922476 14:60739519-60739541 GAGAAAATACAGGAGCAGAGAGG + Intronic
1118031951 14:61826663-61826685 CTGGAGAAATAAAAGCAGAGAGG - Intergenic
1118433349 14:65745461-65745483 ATGAAAAAACAGCAGGGGAGAGG + Intergenic
1118857023 14:69631478-69631500 AACAAAAAACAGAAGCAGAAGGG - Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1119465979 14:74858966-74858988 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1119608468 14:76041536-76041558 ATTAAAAAACAGAATCAGTGGGG - Intronic
1119618459 14:76113736-76113758 CTGACAAAACAGACCCAGAGAGG - Intergenic
1119836781 14:77757404-77757426 ATGAGAAAACAGATTCAGAGAGG - Intronic
1120524232 14:85559275-85559297 CTGAAAACAGAGTAGAAGAGGGG + Intronic
1120703068 14:87719607-87719629 ATGAAAAAACTGGAGCTGAGAGG + Intergenic
1120713102 14:87813569-87813591 TTGAAGAAACAGGTGCAGAGAGG - Intergenic
1120956321 14:90086344-90086366 GTGAGAAAACTGAAGCACAGAGG + Intronic
1121357360 14:93226987-93227009 GTCAAAAAAGAGAAGAAGAGTGG + Exonic
1121510980 14:94513382-94513404 CTCAAGAATCTGAAGCAGAGCGG + Intronic
1121585876 14:95062472-95062494 ATAAAGAAACAGCAGCAGAGGGG - Intergenic
1122060601 14:99134386-99134408 GTGCAAAGGCAGAAGCAGAGAGG + Intergenic
1122324836 14:100875773-100875795 CTGACACCACAGAAGCTGAGGGG - Intergenic
1122648157 14:103208454-103208476 CTGAAAAATAAGAAGCAAAGAGG - Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1202834561 14_GL000009v2_random:68264-68286 CTGTAAAAAAAAAAGCATAGTGG + Intergenic
1124037234 15:26065839-26065861 CTGAGCAAAGAGAAGCAGAGAGG - Intergenic
1124521295 15:30408227-30408249 CTGAACATATAGAAGGAGAGAGG - Exonic
1124537367 15:30557990-30558012 CTGAACATATAGAAGGAGAGAGG + Exonic
1124602431 15:31146278-31146300 CTGGAAACACAGAAACTGAGAGG + Intronic
1124761288 15:32449597-32449619 CTGAACATATAGAAGGAGAGAGG - Exonic
1124777346 15:32599466-32599488 CTGAACATATAGAAGGAGAGAGG + Exonic
1124918562 15:34000769-34000791 CTGATAAATCAGCAACAGAGTGG + Intronic
1124959491 15:34383785-34383807 CTGAACAAATAAAAGGAGAGAGG - Exonic
1124976117 15:34530006-34530028 CTGAACAAATAAAAGGAGAGAGG - Exonic
1125335283 15:38620545-38620567 CTGAAGTGACTGAAGCAGAGCGG - Intergenic
1125655478 15:41353301-41353323 CTGAAAAAACAAAAACATGGTGG - Intronic
1125963769 15:43855313-43855335 GTGAAAAAACTGAGGCAGAGAGG + Intronic
1126450738 15:48805745-48805767 GTGAAAAGACAGAAACAGACTGG + Intronic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1127907569 15:63387631-63387653 CAGACAAGACAGAGGCAGAGAGG + Intergenic
1128484005 15:68067128-68067150 CTGGAACAACTGAACCAGAGAGG - Intronic
1128603160 15:69014961-69014983 ATGAGAAAACAGACCCAGAGAGG - Intronic
1128732365 15:70029871-70029893 CTGAAAAAACAAAAGACAAGAGG + Intergenic
1128856108 15:71017436-71017458 GTGAAAATACATAAGCAGACAGG + Intronic
1129859654 15:78850690-78850712 ATGAAGAAACTGAGGCAGAGTGG - Intronic
1130145205 15:81268859-81268881 CTGAGGAAACTGAGGCAGAGAGG + Intronic
1130898897 15:88192369-88192391 CAGTAAAAATAGAAGCAGATAGG - Intronic
1131427526 15:92358678-92358700 TTGAAAAAACAAAAGCACATAGG - Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1132825977 16:1905821-1905843 CAGAAAAAAAAAAAGCAAAGTGG - Intergenic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1133863674 16:9620939-9620961 CTGAAAAAAAAGAAAGAGAGAGG + Intergenic
1133915334 16:10104499-10104521 ATGGAAAGCCAGAAGCAGAGGGG - Intronic
1134030406 16:10987912-10987934 TTGAAGAGAGAGAAGCAGAGGGG + Intronic
1134175999 16:12006937-12006959 ATGAGAAAACAGATTCAGAGAGG + Intronic
1134872782 16:17666877-17666899 GTGTAACAACAGAAGGAGAGGGG - Intergenic
1134884087 16:17774484-17774506 ATGAGAAAACAGAGGCACAGCGG - Intergenic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135642292 16:24131254-24131276 ATCTAAAATCAGAAGCAGAGAGG + Intronic
1135701716 16:24638414-24638436 CTCAAAAAACAGAAACAGGATGG + Intergenic
1135855272 16:26004022-26004044 ATGAACAAACAGAAGTAGAGAGG - Intronic
1136006593 16:27334578-27334600 ATGAATAAAGAGAAACAGAGAGG - Intronic
1136136874 16:28261627-28261649 CTCAAAAAAGAGAAAGAGAGAGG + Intergenic
1137788321 16:51154496-51154518 CAATAAAAACAGAAGCAGAGTGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138153695 16:54683459-54683481 CTGAGAAGAAAGGAGCAGAGTGG - Intergenic
1138525775 16:57606290-57606312 ATGAGAAAACAGGAACAGAGTGG + Intergenic
1138637429 16:58352228-58352250 ATGAATAAACAGAAGCAATGAGG - Intronic
1138895010 16:61193322-61193344 CTGAAATAACAGTAGCAGAGAGG - Intergenic
1138985079 16:62318655-62318677 CTGAGAAAACTGAGGCACAGAGG + Intergenic
1138999107 16:62487390-62487412 TCCAGAAAACAGAAGCAGAGTGG + Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1139338889 16:66254169-66254191 CTGAAAACACAAAACCACAGAGG + Intergenic
1140232188 16:73126455-73126477 CTGAAGAAACAGAAACAGATGGG + Intergenic
1140956986 16:79875058-79875080 CTGAGAAAACAGAGGCAAATTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141697256 16:85625962-85625984 CTGAGAAAACACAAGCAGGTGGG - Intronic
1141929832 16:87194971-87194993 ATGAGAAAACAGACTCAGAGAGG + Intronic
1141947126 16:87318038-87318060 CTTAAAGAACATAATCAGAGAGG - Intronic
1143174135 17:4947169-4947191 CAGGAAAAGCAGAAGCGGAGAGG + Intronic
1143849568 17:9800195-9800217 CTGAAAAAAAAAAAAAAGAGAGG - Intronic
1144214684 17:13044825-13044847 CTGAGAAAAAAGGAGAAGAGAGG + Intergenic
1144248558 17:13393108-13393130 TCGCAAAAACACAAGCAGAGTGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144359563 17:14479086-14479108 CTGAAAACAGAGAACCAGGGAGG - Intergenic
1144381306 17:14701254-14701276 CTGATAAATCAGAAGTAAAGAGG - Intergenic
1144714189 17:17422713-17422735 CTGAAAAAAGACAGGAAGAGGGG + Intergenic
1144884033 17:18446950-18446972 AAGAAAAAAAAAAAGCAGAGAGG - Intergenic
1145148197 17:20497427-20497449 AAGAAAAAAAAAAAGCAGAGAGG + Intergenic
1146533507 17:33630339-33630361 CTGCACAGACAGGAGCAGAGGGG - Intronic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1147308428 17:39579259-39579281 TGGGAAAAACAGAAGGAGAGAGG + Intergenic
1148582094 17:48751323-48751345 CTGCAGACAGAGAAGCAGAGTGG - Intergenic
1149100561 17:52901446-52901468 CTGAAAAATCAGGTGTAGAGGGG - Intergenic
1149593739 17:57850709-57850731 CGGAACAAACAGACGCCGAGAGG + Intergenic
1149895937 17:60428363-60428385 AGGAAGAAACAGATGCAGAGAGG - Intronic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1150433109 17:65134425-65134447 CTGAACAGAGAGCAGCAGAGGGG - Intergenic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150566832 17:66349512-66349534 ATGAAAAGCCAGAAGGAGAGAGG - Intronic
1151178937 17:72311935-72311957 CTGAAAAATCAGGTGCAAAGAGG + Intergenic
1151530802 17:74703483-74703505 CAGCAAAAACAGGAGCAGAGTGG + Intronic
1151752556 17:76048538-76048560 ATGAAGGAACGGAAGCAGAGGGG + Intronic
1151802443 17:76385962-76385984 CTGAGAAAACAAAACCAAAGAGG - Intronic
1152103215 17:78314707-78314729 ATTAAAAAATAGAAACAGAGGGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1153133027 18:1879488-1879510 CTGAAAAAAAACAAGCAATGGGG - Intergenic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1153856104 18:9148922-9148944 AGCAAAAAACTGAAGCAGAGTGG - Intronic
1153868585 18:9296227-9296249 CTGAAGAAACTGAGGCACAGAGG + Intergenic
1155079857 18:22398046-22398068 CTGAAAATACAGAAGTGAAGTGG + Intergenic
1155598956 18:27521133-27521155 CTAAGAAAACAGACACAGAGAGG + Intergenic
1156057157 18:33020535-33020557 CTTTAAAAACAAAAGCAAAGTGG - Intronic
1156089508 18:33448890-33448912 CAGAAAAGGCAGAAACAGAGGGG + Intergenic
1157070564 18:44403046-44403068 AGAAGAAAACAGAAGCAGAGTGG - Intergenic
1157331495 18:46707367-46707389 GAGAAAAAAGAGATGCAGAGAGG - Intronic
1157390124 18:47294889-47294911 CTCCATAAACATAAGCAGAGTGG + Intergenic
1158739165 18:60120017-60120039 GCGAAAAAATAGAGGCAGAGAGG - Intergenic
1159148900 18:64494613-64494635 CTGATACAACAGAAGCAGAAGGG + Intergenic
1159626514 18:70701447-70701469 CTGAAGAGAAAGAAGCATAGTGG - Intergenic
1159905243 18:74083969-74083991 GTGATAAAACTGATGCAGAGAGG + Intronic
1160127301 18:76187952-76187974 TTGAACTCACAGAAGCAGAGTGG - Intergenic
1161645923 19:5453417-5453439 GTGGAAAAACAGAAGCAGAGAGG - Intergenic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1163192212 19:15685473-15685495 CTGGGAGAACAGAAACAGAGTGG - Intronic
1163910158 19:20182421-20182443 CAGAACAAACAGAAGCTGTGGGG - Intronic
1163949388 19:20569916-20569938 CTGTAATAACAAAAACAGAGGGG - Intronic
1163968688 19:20771987-20772009 CTGTAATAACAAAAACAGAGGGG + Intronic
1164694340 19:30232255-30232277 TTTAAAAATCAGAAGCTGAGAGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG + Intergenic
1164895050 19:31869109-31869131 CAGAAAAAACAGAATCAAACTGG + Intergenic
1165170547 19:33888877-33888899 CTGAAAACCCAGACTCAGAGAGG - Intergenic
1165365427 19:35362230-35362252 CTGAGAAAACAGATGTGGAGAGG + Intergenic
1165429423 19:35764085-35764107 CCAAAAAAAGAGAAGCACAGAGG - Intronic
1165656235 19:37534674-37534696 AAGAAAAAAAAAAAGCAGAGAGG - Intronic
1167169414 19:47821378-47821400 CTGACAACACAGAGACAGAGAGG + Intronic
1167285190 19:48595280-48595302 CTAAAAAAAAAAAGGCAGAGGGG + Intronic
1168153856 19:54462705-54462727 CTGAGACGACAGAAGCCGAGTGG - Exonic
925051466 2:819031-819053 TTAAAAAAACTGAAGGAGAGAGG + Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925561782 2:5203909-5203931 CTGAAAAGACAGAGACAGTGTGG - Intergenic
926430647 2:12782394-12782416 ATGCAAAGTCAGAAGCAGAGAGG + Intergenic
926640567 2:15231238-15231260 CTGAAGAACCATAAGCAAAGGGG + Intronic
926752100 2:16205985-16206007 CTGAAAAAACAAAAAGAAAGAGG + Intergenic
926875504 2:17472590-17472612 GTGAGAAAACTGACGCAGAGAGG - Intergenic
927284768 2:21345210-21345232 CTGGAGAAAGAGAAGCAGTGTGG - Intergenic
927345354 2:22032357-22032379 GTGAAAACAGAGAAACAGAGGGG - Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927481973 2:23461206-23461228 CTGAAGAGACTGAGGCAGAGGGG + Intronic
928039718 2:27862566-27862588 CTGAAGAGACAGAAGCCCAGGGG - Intronic
928206782 2:29290203-29290225 CTGAAAAGACAGAGGCCCAGAGG - Intronic
928242854 2:29601673-29601695 CTGAAAAAACAAAAGCAGGCAGG + Intronic
928328686 2:30340207-30340229 CTGAGAAAACTGCAACAGAGAGG + Intergenic
930301191 2:49618101-49618123 CTGACAAAACAGATGAAGACAGG + Intergenic
930430001 2:51263727-51263749 ATGAGAAAACAGAAGCAGATAGG + Intergenic
930492301 2:52091409-52091431 CTAGAAAAACAAAAGCTGAGAGG - Intergenic
930542837 2:52729053-52729075 CAGAAAGAACAAAAGCAGATTGG - Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
931252079 2:60541062-60541084 CTTCAAGAACAGGAGCAGAGGGG - Intronic
931364547 2:61607811-61607833 CTGAAAAAATAGAAGCAGCCTGG + Intergenic
931402411 2:61943327-61943349 ATGAAAAAACACAAGGAGAGTGG - Intronic
931683286 2:64770410-64770432 ATGAGAAAACCAAAGCAGAGAGG + Intergenic
932009327 2:67959599-67959621 CTGAAACAACAGAGGCCAAGTGG - Intergenic
932032716 2:68206871-68206893 CTGAAAGAAGAAAAGCTGAGAGG + Intronic
932101723 2:68907569-68907591 ATTAAAAAAGAGAATCAGAGAGG - Intergenic
932466036 2:71925007-71925029 CTGAAAAAACACGAGCAGGGAGG + Intergenic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
933238251 2:79889566-79889588 ATGAAGAAACAGAGGCACAGAGG - Intronic
933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG + Intergenic
933583215 2:84150704-84150726 CTAAAAAAACAGAAGGTGAATGG + Intergenic
935042946 2:99451984-99452006 TTGAAGAAATAGAACCAGAGAGG - Intronic
935469390 2:103438707-103438729 CTGAAGAAACTGAAGCTTAGTGG + Intergenic
935684445 2:105671106-105671128 TTGAAAAAACAGCTTCAGAGAGG + Intergenic
935825021 2:106937316-106937338 CTAAAGAAGCAGAAGCACAGAGG + Intergenic
936022855 2:109008197-109008219 GTGAAAATACAGAAGCACATAGG - Intergenic
936836840 2:116719930-116719952 CTGTAATAACAAAAGCGGAGGGG - Intergenic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
937180220 2:119988800-119988822 CTTAAAAAATAGAAGTAGAGAGG + Intergenic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937261284 2:120588019-120588041 CTGAAGAAACCGAGGCAGAGAGG + Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
938123001 2:128646713-128646735 CTGAGAAAACCAAGGCAGAGAGG + Intergenic
938226596 2:129621960-129621982 TTGAACTCACAGAAGCAGAGTGG + Intergenic
938366727 2:130740533-130740555 GTGAAAAACAAGGAGCAGAGGGG + Intergenic
938692205 2:133801999-133802021 CTGCAAAGACACAAGGAGAGGGG - Intergenic
939078782 2:137634915-137634937 AAACAAAAACAGAAGCAGAGAGG - Intronic
939556285 2:143677880-143677902 GTGAAAAAAGAGAGGAAGAGAGG + Intronic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
940382134 2:153027229-153027251 GAGAAATAACAGAAGAAGAGTGG - Intergenic
940536469 2:154951551-154951573 ATGAAAAAAATGAAGCACAGCGG - Intergenic
940549559 2:155136222-155136244 ATGAAAAAATAGAAATAGAGGGG - Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941152261 2:161929340-161929362 CTGAACATAAAGAAGCATAGTGG - Intronic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
942589621 2:177528255-177528277 ATGAGAATACAGTAGCAGAGTGG - Intronic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
942825613 2:180171364-180171386 ATGAAAAAACAGTAGCTGAATGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG + Intergenic
943307503 2:186282593-186282615 ATTAAAAAACAGTAGCACAGAGG + Intergenic
943587608 2:189759568-189759590 ATGTGAAAACAGAATCAGAGAGG + Intronic
944258935 2:197655122-197655144 CTGAAACAACAGAATGAAAGGGG - Intronic
944311423 2:198237865-198237887 CTGAACAAAAGGGAGCAGAGAGG - Intronic
944797548 2:203203469-203203491 CAGAAAACACAGAAGCTGACCGG - Intronic
944939663 2:204610037-204610059 CTGAAAAAACAGACGCTTTGTGG - Intronic
946169446 2:217885922-217885944 CTGAAAGGACAGAGTCAGAGAGG - Intronic
946201905 2:218075487-218075509 CTCACAAAAAGGAAGCAGAGTGG + Exonic
946306089 2:218857850-218857872 CTGCAATAACAGTAGCAGGGTGG + Intergenic
946349630 2:219141377-219141399 CTCAAAAAAAAAAAGCAGGGGGG + Intronic
946488040 2:220119844-220119866 CAGAAAAAACAGAACAAGATGGG - Intergenic
946774999 2:223128149-223128171 GTGAGAAAACACAGGCAGAGAGG + Intronic
946954017 2:224908791-224908813 TTGAAAGAACAGAAGCAGGCTGG - Intronic
947058968 2:226140307-226140329 CTGAGAAAGAAGTAGCAGAGAGG - Intergenic
947102930 2:226640593-226640615 CTGAAAAAACTGAAGAATTGTGG + Intergenic
947123848 2:226846353-226846375 CAGAAAAATCAGAATTAGAGGGG - Intronic
947165279 2:227255319-227255341 CTGGAAAAACGGAAGCAGCAGGG + Intronic
947436849 2:230080306-230080328 CTGGAGAAACTGAACCAGAGAGG + Intergenic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
948030205 2:234811492-234811514 AAGAAAAACCAGAAGAAGAGTGG - Intergenic
948175071 2:235936926-235936948 TTAAAAAAAAAAAAGCAGAGGGG - Intronic
949061012 2:241957338-241957360 CTTAAACAACCGAAGCAGTGGGG + Intergenic
949061025 2:241957406-241957428 CTTAAACAACCGAAGCAGTGGGG + Intergenic
1169067993 20:2705338-2705360 CTGGAAAACAAGAGGCAGAGTGG - Intronic
1169736150 20:8839689-8839711 CTGAGAAATCAAAAGCAGATAGG - Intronic
1169852712 20:10070089-10070111 ATGAGAAAACAGAATCTGAGAGG - Intergenic
1170309572 20:14977569-14977591 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1170718407 20:18852314-18852336 CTGAAAAATCAAATGCAAAGAGG - Intergenic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171158246 20:22896646-22896668 CTTAAAAAACACAAAGAGAGTGG + Intergenic
1171877194 20:30587607-30587629 CTGAAAAAAAATAAAGAGAGTGG - Intergenic
1171884711 20:30643490-30643512 CTGTAAAAAAAAAAGCATAGTGG - Intergenic
1171988334 20:31676334-31676356 ATGAGGAAACAGAGGCAGAGAGG + Intronic
1172009207 20:31836664-31836686 GTGAAAAAACAGGTTCAGAGAGG + Intergenic
1172407305 20:34699452-34699474 GTGAAAAAACTGAGACAGAGAGG - Intronic
1172820234 20:37726081-37726103 CTGAGAAAACTGAAGCGTAGAGG + Intronic
1172949789 20:38715569-38715591 ATGAGTAAACTGAAGCAGAGAGG + Intergenic
1173119977 20:40279880-40279902 ATGAGAAAACAGACTCAGAGAGG - Intergenic
1173168086 20:40700287-40700309 CAGCACAAACAAAAGCAGAGAGG - Intergenic
1173240379 20:41290642-41290664 ATGAGAAAACAGATGCAGAGAGG + Intronic
1173323731 20:42013408-42013430 ATGAGAAAACAGATTCAGAGAGG - Intergenic
1173547124 20:43906483-43906505 TAGAAAATACAGCAGCAGAGGGG + Intergenic
1173551493 20:43935942-43935964 AAAAAAAAAAAGAAGCAGAGTGG + Intronic
1173562727 20:44017769-44017791 ATGAGAAAACAGAGGCACAGAGG + Intronic
1173990981 20:47303271-47303293 CTGAAAAAAAAGAAAAAGAAGGG - Intronic
1174511212 20:51054302-51054324 CAGAAGAAACAGACACAGAGAGG + Intergenic
1174563651 20:51448963-51448985 GTGGAAAAACAGTAGGAGAGGGG - Intronic
1174943533 20:54958721-54958743 TTGATGAAGCAGAAGCAGAGAGG - Intergenic
1175616690 20:60405762-60405784 ATGAAAACAAAGAGGCAGAGAGG - Intergenic
1175684978 20:61022338-61022360 TTTAAAAAACAGAAACGGAGAGG - Intergenic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1177444676 21:21177709-21177731 GGGAAAAAAGAGAAGGAGAGGGG - Intronic
1177527793 21:22318955-22318977 ATAACAAAACAGAAACAGAGTGG + Intergenic
1178024682 21:28452627-28452649 GTGAGAAAAAAGGAGCAGAGAGG + Intergenic
1178163450 21:29945423-29945445 CTAAAGAAACTGAGGCAGAGAGG + Intergenic
1178275626 21:31234301-31234323 CTGAAAAGAGAGCAGGAGAGGGG + Intronic
1178317671 21:31580240-31580262 ATGAGAAAACAAAGGCAGAGAGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178723021 21:35027008-35027030 TTGAAAGAAAAGAAGTAGAGCGG + Intronic
1178974693 21:37210837-37210859 CTGAAAAAAGAGATGGGGAGGGG - Intergenic
1179348000 21:40579309-40579331 CAGAAGAAAAAGAAGCAGTGAGG + Intronic
1179841012 21:44073556-44073578 AAGTAAATACAGAAGCAGAGAGG + Intronic
1180716877 22:17877837-17877859 CTCAAAAAAAAGAAGAAGGGAGG - Intronic
1181294732 22:21827742-21827764 ATGAAGAAACTGAGGCAGAGTGG + Intronic
1181345143 22:22214627-22214649 CTCAAAGATCTGAAGCAGAGAGG - Intergenic
1181435673 22:22909228-22909250 CAGGAAACGCAGAAGCAGAGAGG - Intergenic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1181825067 22:25508344-25508366 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1181853671 22:25767799-25767821 ATTAAAAAACAGACTCAGAGAGG + Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182155134 22:28064380-28064402 TTGGAAACACAGAATCAGAGAGG - Intronic
1182287576 22:29257436-29257458 GTGAAGAAACAGAAGCTCAGAGG + Intronic
1182391288 22:29999088-29999110 CAGAAAAAACAGAGGCCTAGAGG - Intronic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1182746126 22:32606765-32606787 CTGAATGAAGAGGAGCAGAGAGG - Intronic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185198447 22:49487504-49487526 GAACAAAAACAGAAGCAGAGTGG - Intronic
949346857 3:3084782-3084804 GTGAGAAAACAGATGCAGAGAGG - Intronic
949388928 3:3537516-3537538 ATGAAACCACAGAAGTAGAGTGG + Intergenic
950182989 3:10928043-10928065 ATGAAGACACAGAAGCACAGAGG - Intronic
950288442 3:11763730-11763752 ATGATGAAACTGAAGCAGAGAGG + Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950611072 3:14126925-14126947 GTGAGTAAACAGAATCAGAGAGG + Intronic
951111448 3:18809163-18809185 CTGAAATAAAAAGAGCAGAGAGG + Intergenic
951850321 3:27132469-27132491 CTGAAAATTCAGCTGCAGAGAGG + Intronic
951944020 3:28114054-28114076 CTGAAAACACAGGTTCAGAGAGG - Intergenic
952066284 3:29575706-29575728 TTGAAAACACACAATCAGAGGGG - Intronic
952253839 3:31678864-31678886 GTGCAAAGATAGAAGCAGAGAGG - Intronic
953917162 3:46927425-46927447 GTGAGAAATCAGAAGGAGAGAGG + Intronic
954499419 3:50996681-50996703 ATGAAAAAAGAGAAGAAAAGAGG + Intronic
955026816 3:55175581-55175603 ATGAGAAAACAGGACCAGAGAGG + Intergenic
955415288 3:58685940-58685962 AGGAAGAAACAGAGGCAGAGAGG - Intergenic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
955773563 3:62410596-62410618 ATGAAAAAACTGAGGCACAGCGG - Intronic
956112942 3:65889325-65889347 CTAAAAAGACAGAAACAGAAGGG - Intronic
956190689 3:66605187-66605209 ATGAAAAAACAGACATAGAGAGG - Intergenic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956957755 3:74360444-74360466 ATGAAAAAACAGAAACTTAGTGG - Intronic
957038379 3:75316032-75316054 CTGCAAAAACATACCCAGAGAGG + Intergenic
957933505 3:86912750-86912772 TCCAAGAAACAGAAGCAGAGGGG - Intergenic
957964462 3:87304542-87304564 ATGAAAAAAATAAAGCAGAGGGG - Intergenic
958089459 3:88857638-88857660 CCAAAAAAAGGGAAGCAGAGAGG + Intergenic
958425734 3:93976929-93976951 TTTAAAAAAGAAAAGCAGAGGGG + Intergenic
958503298 3:94942172-94942194 CTGAAAAAAAACAAGCAATGGGG - Intergenic
959276362 3:104281938-104281960 CTGAAAAAAAAGAAAAAGAAGGG - Intergenic
959552567 3:107679687-107679709 ATGAACAAACAGAACCAGAAAGG + Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960216291 3:115042186-115042208 CTGAAAAAAGAGGAGCTGATAGG + Intronic
960299941 3:115990557-115990579 CTGAGAAAACAGAAGCTGATTGG - Intronic
960309516 3:116103991-116104013 CTGAGAGGACAGAATCAGAGTGG + Intronic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
961960399 3:130848545-130848567 CTGCAAAAACAGAGGCGAAGGGG - Intergenic
962695945 3:137947449-137947471 ATGAAGAAACAGAAGCACAGAGG - Intergenic
963773999 3:149420202-149420224 CTAAAATAAAAGAAGAAGAGGGG + Intergenic
963834658 3:150046031-150046053 TTTAAAAGACAGAAGGAGAGAGG + Intronic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964463160 3:156959553-156959575 CTGAAGAAAAAAAGGCAGAGTGG - Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964921659 3:161904014-161904036 CTGCAAAGACCAAAGCAGAGTGG + Intergenic
965008958 3:163061154-163061176 CTGAAAAAAAAGAAGCCTACTGG - Intergenic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
965883417 3:173414211-173414233 CTGACTTAACAGAAACAGAGAGG + Intronic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
966189183 3:177256223-177256245 CTGAAAAAAAAGAGAGAGAGAGG - Intergenic
967135069 3:186506193-186506215 CCCAAATAACAGAAGCAGAAGGG + Intergenic
967147864 3:186621088-186621110 CTCACAGGACAGAAGCAGAGTGG + Exonic
967210168 3:187161474-187161496 CTAGAGAAACAGAAGCACAGAGG - Intronic
967529305 3:190530904-190530926 GTGAAAAAACTGAAGCTCAGAGG + Intronic
967723722 3:192842115-192842137 TTGTAAAACCAGAGGCAGAGAGG + Intronic
967900196 3:194442038-194442060 ATGAGAAAACTGAAGCAGGGTGG + Intronic
968496456 4:920013-920035 CTTAAAAAACAAAAACAGGGTGG + Intronic
968566039 4:1313431-1313453 CTTAAAGAACAGAAGCAGGCTGG + Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969112851 4:4854490-4854512 ATGAAAGAACAGAATCAGAGAGG - Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969688041 4:8687921-8687943 CTGAGGAAACAGGATCAGAGAGG + Intergenic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
970418235 4:15880381-15880403 ATAAGAAAACAGAATCAGAGAGG + Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970697796 4:18697942-18697964 AAAAAAAAACAGAAGCAGAAAGG - Intergenic
972125617 4:35761168-35761190 CTGTAATGACAGTAGCAGAGGGG - Intergenic
972236612 4:37141698-37141720 CTTAAAAAACAAAAGCATAGTGG - Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972443404 4:39118754-39118776 CTCAAAAAAAAAAAGCAGACTGG + Intronic
973141481 4:46773993-46774015 CTGGAAAATCAGAGTCAGAGAGG - Intronic
973204790 4:47548379-47548401 CTGAAAGAAGAGAATCTGAGAGG - Intronic
973690703 4:53427343-53427365 CTGAAATAAAACAAGCAAAGTGG - Intronic
973767218 4:54173616-54173638 GCGAAAAAAGAGAAGAAGAGAGG + Intronic
974140275 4:57877809-57877831 CAGAAAAGACAGCAGCACAGAGG - Intergenic
974449984 4:62041965-62041987 CTAGAAAAACCGAAGCACAGTGG - Intronic
974483016 4:62470349-62470371 CTGAAAAAAGAGAAGGGAAGGGG - Intergenic
974845761 4:67349723-67349745 ATGAAGAAACTGAGGCAGAGAGG - Intergenic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
976410081 4:84703382-84703404 CTTAAAACACAGCAGCATAGGGG - Intronic
976908571 4:90271188-90271210 CTGAACAAAAAGAAGAAGACTGG + Intronic
976942459 4:90720144-90720166 CTCAAAAAACAAAAGAACAGGGG - Intronic
977213744 4:94253213-94253235 CTGAAAAAACCCAAGCTGATTGG + Intronic
977814826 4:101402844-101402866 CTGAAAACATGAAAGCAGAGTGG - Intergenic
977860895 4:101958529-101958551 CTGGAAAAATAGCAGCAGATGGG - Intronic
979025060 4:115560052-115560074 TTGAAAAAACAGAAGTGGACTGG - Intergenic
979070197 4:116193945-116193967 CTTAAAAAACAGAACCTGGGTGG + Intergenic
979466007 4:121039453-121039475 ATGGAAACAGAGAAGCAGAGAGG - Intronic
979689509 4:123545891-123545913 TGGAACAAACTGAAGCAGAGAGG + Intergenic
981263639 4:142754042-142754064 CTGAAAAATCAGAATCACAATGG + Intronic
982738036 4:159026596-159026618 ATGAAAAAAAAGAAGCAGTATGG - Intronic
982833498 4:160092636-160092658 ATGCAAAAGCAGAAGCAAAGGGG + Intergenic
982882522 4:160737899-160737921 ATAAAGAAACAGAAGCAGACTGG - Intergenic
983176722 4:164596855-164596877 CAGAACTCACAGAAGCAGAGTGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984286854 4:177741750-177741772 GTGAAAAAACAGATGACGAGTGG - Intronic
984875315 4:184362660-184362682 CAAAGAAAACAGAAACAGAGAGG + Intergenic
985607910 5:868535-868557 CTCCAACAACAGGAGCAGAGTGG + Intronic
985906601 5:2842522-2842544 GTGAAATACCAGAAGCAGATGGG - Intergenic
985985837 5:3515569-3515591 CTTAAAAAACAGAAACGGAGTGG + Intergenic
986104592 5:4647830-4647852 ATGAAGAAACCGAGGCAGAGAGG + Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
987107749 5:14657248-14657270 TTTAAAAAACAGAATTAGAGGGG - Intergenic
987372359 5:17204652-17204674 TTGCAAAAACAGAAGCAGAAAGG + Intronic
987567248 5:19606562-19606584 CTGAACAAACAGCAGAAGAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988085895 5:26475378-26475400 CCAAGAAAACAGAAGCACAGAGG - Intergenic
988186682 5:27873380-27873402 CTGAAAAAAAATAAGCAGGCCGG + Intergenic
988282069 5:29162492-29162514 CTGTAAACACAGCAGCACAGAGG + Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990544309 5:56807198-56807220 GTGAAGAAACTGAAGCAGAGAGG - Intergenic
990802440 5:59620045-59620067 CTGAAAAGGCAGAAGCAGGTGGG + Intronic
991246368 5:64512492-64512514 TTGAGGAAACTGAAGCAGAGAGG - Intronic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
991374544 5:65953107-65953129 TGGAGAAAGCAGAAGCAGAGAGG - Intronic
991402909 5:66272894-66272916 CTGAGAAAACAGAGGCTCAGAGG + Intergenic
991906067 5:71512359-71512381 CTGATAAAACAGAAGTCCAGGGG + Exonic
992011657 5:72533295-72533317 CAGAAAGAACAGAGTCAGAGAGG + Intergenic
992213397 5:74502913-74502935 CTAAAAAAAAAAAAGGAGAGTGG + Intergenic
992857207 5:80874417-80874439 ATGCCAAAACAGAAGCAAAGTGG + Intronic
993089706 5:83410150-83410172 TTAAAAAAAAAGAAGCAGAAGGG + Intergenic
993347307 5:86800268-86800290 TTGTGAAAACAGAAGCAGAAAGG + Intergenic
993502204 5:88676688-88676710 TTAAATAAACAGAAGCAGGGAGG - Intergenic
993531367 5:89028768-89028790 CTGATTACACAGAAGCAGAAGGG - Intergenic
993535281 5:89076661-89076683 CTGAGAAAACAGATTTAGAGAGG + Intergenic
993584147 5:89702312-89702334 CTGAAAAAAAAGGATCATAGAGG - Intergenic
993993611 5:94691345-94691367 CTGATAGAACAGAAGCAGTATGG + Intronic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994507718 5:100663535-100663557 CTAAAAGAACAGAAAAAGAGGGG - Intergenic
994722109 5:103392295-103392317 ATGAAGAAACAGAAGCTGAGAGG - Intergenic
994784446 5:104138530-104138552 AGGAAAAAACAGAAGGAAAGAGG + Intergenic
994828075 5:104742415-104742437 CTGGAAAAACAGTAGCAAAGAGG - Intergenic
995220075 5:109638498-109638520 CTGAAAAAAAACAAGCAATGAGG + Intergenic
995264021 5:110137791-110137813 CTGAAATAAGAAAGGCAGAGAGG - Intergenic
995544942 5:113220900-113220922 CTAAAAGAAAAGAAGCAGTGAGG + Intronic
995924396 5:117353328-117353350 TTGACAAAACAGAAGAAGAAGGG + Intergenic
996249651 5:121313938-121313960 CTGAAAAAACAGAACCAGAGAGG - Intergenic
996644970 5:125802989-125803011 CAGAAAAAACAAAAGCATAGTGG - Intergenic
997142447 5:131397207-131397229 GCCAAAAGACAGAAGCAGAGTGG - Intronic
997333966 5:133090814-133090836 CTGATAAACGACAAGCAGAGTGG + Intronic
997453329 5:134000666-134000688 CTGAAGAAAAAGGAGTAGAGAGG - Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
998223878 5:140311136-140311158 CTGAAAAGACAGAAAAAAAGGGG + Intergenic
998354280 5:141521674-141521696 CTAAAAAAACAGAGGCACTGTGG - Intronic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
998475663 5:142419347-142419369 TTGAAAAATCAGAAAAAGAGAGG + Intergenic
998608999 5:143667287-143667309 CTGAGAAAACAGGATCAGAGAGG + Intergenic
998767994 5:145509834-145509856 GTGAAAAAACAGATTCTGAGAGG - Intronic
999039057 5:148386366-148386388 ATGAACAAACAGAACCAGAGAGG - Intronic
999040927 5:148411055-148411077 GTGAAAAAAATGAAGCAGAATGG - Intronic
999291727 5:150430269-150430291 CTCAAAAAAAAAAAGCAGGGAGG + Intergenic
999523102 5:152372903-152372925 CTGAACAAATAGAAGCAGGGGGG + Intergenic
999660976 5:153862562-153862584 CTTATAAGACAGAGGCAGAGGGG - Intergenic
999795583 5:154986756-154986778 ATGAGAAAACAGGACCAGAGAGG + Intergenic
999804196 5:155066835-155066857 ATGAAGAAAAGGAAGCAGAGAGG - Intergenic
999852560 5:155558669-155558691 CTGAGGAAACAGAGTCAGAGAGG + Intergenic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000455101 5:161438837-161438859 TTGAAAATACATAATCAGAGGGG + Intronic
1000487874 5:161870657-161870679 AAGAAAAAACAGAAAAAGAGGGG + Intronic
1001131196 5:169065048-169065070 TTGAAGAACCAGAAGCACAGAGG + Intronic
1001355447 5:171018018-171018040 CTGAAAAAAAACAAGCAATGGGG - Intronic
1001571700 5:172734389-172734411 CTAAGAAAACAGATGAAGAGGGG + Intergenic
1002331403 5:178443357-178443379 CTGAACAAAGAGGAGCTGAGTGG - Intronic
1002596674 5:180328339-180328361 CTGAAAACACACAAACAGTGAGG + Intronic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1003024059 6:2537753-2537775 TTGAGAAAACAGAAGCAGAAAGG - Intergenic
1003103031 6:3191987-3192009 GGGTAAAAACAGAAGCATAGAGG + Intergenic
1003409025 6:5847094-5847116 CTGAAATGAAAGCAGCAGAGAGG + Intergenic
1003735296 6:8871708-8871730 CTGAAAATACAGGAGCAGGAAGG + Intergenic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004240594 6:13917735-13917757 CTGCAAAGAGAGAAACAGAGAGG - Intergenic
1004347642 6:14863364-14863386 TTGGAAAAACAGAAACAGAGAGG + Intergenic
1004469954 6:15920327-15920349 CTGAAGAGACAGGGGCAGAGTGG - Intergenic
1004601641 6:17156104-17156126 ACAAAAAAAAAGAAGCAGAGGGG - Intergenic
1004946885 6:20624979-20625001 CTCAGAAAACAGATGAAGAGAGG - Intronic
1005143454 6:22661141-22661163 ATGAAGAAACTGAAGCAGAGAGG - Intergenic
1005226161 6:23644672-23644694 CTTAAAAAGCAGAAGCTGACCGG - Intergenic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1006900925 6:37500470-37500492 AGGAATAAACAGAAGCAAAGAGG - Intergenic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007475530 6:42117318-42117340 ATGAGAAAACTGAAGCACAGAGG + Intronic
1007548779 6:42713276-42713298 CTGAAAAGACAGAGTCAGTGAGG + Intronic
1008086365 6:47248976-47248998 ATGAAGAAACTGAGGCAGAGAGG + Intronic
1008487936 6:52055497-52055519 CTGAAAACTCAGAAGCACAAAGG - Intronic
1008610427 6:53180307-53180329 CTGAAAAAACCGAAGCACTCAGG + Intergenic
1008925431 6:56887157-56887179 CTAAAAGTACTGAAGCAGAGAGG + Intronic
1009244554 6:61220148-61220170 TTGAGAAAACAGAAACAGAGAGG - Intergenic
1009561684 6:65253861-65253883 CTGAAAAATCAGAAAAAGATAGG - Intronic
1011190005 6:84718594-84718616 CTTAAAATACAGAACCAGAAAGG - Intronic
1011303599 6:85902183-85902205 CTGAACACAGAGTAGCAGAGGGG + Intergenic
1011571064 6:88736280-88736302 TTCAGAAAATAGAAGCAGAGAGG + Intronic
1012182590 6:96173144-96173166 CTGAAGAAAAATCAGCAGAGAGG - Intronic
1012248001 6:96947792-96947814 ATGAAGAAACTGAGGCAGAGAGG + Intronic
1012388373 6:98707800-98707822 CTGAGAAAAAACAAGCAGTGGGG + Intergenic
1012987478 6:105890251-105890273 CTTAAAAAACAAAAGGACAGGGG + Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013669856 6:112388769-112388791 CTGAAGAAACCTAACCAGAGAGG - Intergenic
1013688536 6:112613222-112613244 TTTAAAAAACAGAGGCAGAAAGG - Intergenic
1013875929 6:114828295-114828317 CTCAAAAAACAAAAGTTGAGAGG - Intergenic
1014016051 6:116531349-116531371 GTGAAACACCAGAAGCAGTGAGG + Intronic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014372821 6:120633893-120633915 TTGAATTCACAGAAGCAGAGAGG + Intergenic
1014433184 6:121392935-121392957 ATGAAAATACGGAAGCACAGAGG + Intergenic
1014886592 6:126789323-126789345 CTGGAAAAACAGGAAAAGAGAGG + Intergenic
1014930008 6:127324697-127324719 CTCAAAAAACAAAAGGATAGGGG + Intronic
1015011616 6:128356180-128356202 CTAAAGAAACAGGAGAAGAGGGG - Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015046613 6:128783735-128783757 CTGAAAAAAAAAATGCAAAGAGG - Intergenic
1015120368 6:129694344-129694366 ATGATGAAACAGAAGCACAGAGG - Intronic
1015232138 6:130927422-130927444 ATGGCAAAACATAAGCAGAGTGG + Intronic
1016286748 6:142482296-142482318 CAGAAAAGAAAGAAGCAAAGGGG + Intergenic
1016793794 6:148095770-148095792 CTGAGGAAACAGGAACAGAGTGG - Intergenic
1017339864 6:153308507-153308529 TTGAAATTACAGAAGAAGAGTGG - Intergenic
1017629702 6:156384514-156384536 ATGAAACCACAGAAGCAAAGAGG + Intergenic
1017670493 6:156765401-156765423 CTGAAAGAAAAGGAGCAGATAGG + Intergenic
1017809148 6:157971907-157971929 ATTAAAAAAAAGAAGTAGAGGGG + Intergenic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1018019961 6:159752752-159752774 CTCAAAAAAGAGGAGGAGAGAGG - Intronic
1018399522 6:163408774-163408796 CTGAAGAAGCAGAGGCTGAGAGG - Intergenic
1019727623 7:2611740-2611762 CTGCAGAAACAGAAGCTAAGTGG - Exonic
1020121003 7:5503351-5503373 CTCAAAAAACAGAAACAGGCTGG - Intronic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1020526141 7:9261249-9261271 CTTAAAAAACGGAACCACAGAGG - Intergenic
1020901113 7:14004659-14004681 ATCAAAAAACAAAAGCAGACTGG - Intergenic
1020960092 7:14791584-14791606 CTGATAAAACAGAAAAAGAAGGG - Intronic
1021091651 7:16489866-16489888 CTGATAAAGTACAAGCAGAGTGG + Intronic
1021265929 7:18522565-18522587 CTGAAAAAAAAAAAGCAGGGTGG + Intronic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021702125 7:23329842-23329864 TTGAAAAAACTGAGCCAGAGAGG + Intronic
1021939854 7:25668705-25668727 AGGTAAAAACACAAGCAGAGAGG - Intergenic
1022038736 7:26559038-26559060 CATTAAAAACAGAAGCAGAGTGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1022667644 7:32427274-32427296 ATGAAAAAACGGAGGCACAGGGG + Intergenic
1022755254 7:33280783-33280805 ATGAAAAAACAGACTCATAGAGG + Intronic
1023133576 7:37028124-37028146 ATGAGAAAACAGAGGCACAGAGG + Intronic
1023275120 7:38510584-38510606 ATGAGAAAACAGAGGCACAGAGG + Intronic
1023624626 7:42103581-42103603 CTGAAGAAATAGTTGCAGAGAGG - Intronic
1023949519 7:44831533-44831555 TTGAAAAAAAAGAAGCGGGGGGG - Intronic
1024192448 7:47026720-47026742 CTGTGAAAACAGGTGCAGAGAGG + Intergenic
1024302574 7:47898897-47898919 CTAAAAAAAAAAAAGGAGAGAGG + Intronic
1024523791 7:50330819-50330841 ATGAAAAGACAGAAGCAGTGGGG + Intronic
1024657008 7:51459425-51459447 CTGAATGAACAGACGCAGACTGG - Intergenic
1026062880 7:67041836-67041858 ATGAGAAAACGGAAGCACAGAGG - Intronic
1026129795 7:67610757-67610779 CTGAAGAAACTGAGGCACAGAGG - Intergenic
1026195838 7:68172842-68172864 CTAAAAAAAAAAAAGCAGAGTGG + Intergenic
1026352379 7:69528707-69528729 GTGAAAAATCAGAAGCAAACTGG - Intergenic
1026629078 7:72021956-72021978 CTGAAGAAACAGAAGAGGTGAGG - Intronic
1026715471 7:72785572-72785594 ATGAGAAAACAGAAGCACAGAGG + Intronic
1027342478 7:77223897-77223919 CTGAAAATACAGCAGCAGTAGGG + Intronic
1027573212 7:79898206-79898228 TTTGAATAACAGAAGCAGAGAGG + Intergenic
1028018263 7:85741534-85741556 TTGAAAAAACAGAATCAAAGAGG - Intergenic
1028343954 7:89757651-89757673 ATGAGAAAACTGAAGCACAGAGG + Intergenic
1028504173 7:91553448-91553470 ATGAGAAAACTGAAGCACAGAGG + Intergenic
1028660499 7:93267234-93267256 CTAGAGTAACAGAAGCAGAGAGG - Intronic
1028895138 7:96032644-96032666 CTGCAAAAACATAAACAAAGAGG - Intronic
1029025033 7:97407301-97407323 GGGAAAGAACAGAAGAAGAGAGG + Intergenic
1029101066 7:98130380-98130402 CTGCAAGGACAGAAACAGAGTGG - Intronic
1029147468 7:98457163-98457185 CTGAAAGGCCAGAGGCAGAGTGG + Intergenic
1029276798 7:99410031-99410053 CAGAAGAAACAGGACCAGAGAGG + Exonic
1029958811 7:104668323-104668345 CTGACAAAACAGATACAGACTGG + Intronic
1030555854 7:111022707-111022729 GACTAAAAACAGAAGCAGAGAGG + Intronic
1031942737 7:127806476-127806498 CAGAAAAACCAAAAGAAGAGAGG - Intronic
1032594099 7:133222276-133222298 CTGGAGAAACTGAACCAGAGAGG - Intergenic
1033875546 7:145812847-145812869 GTGAAAACAGAGAAGCAGAAGGG + Intergenic
1034567816 7:151929537-151929559 ATGAAAGATCAGAAGCAGAAGGG - Intergenic
1035068994 7:156127281-156127303 CAGGAAGAACAGGAGCAGAGAGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035540866 8:436732-436754 CGGGAAAAACATCAGCAGAGAGG + Intronic
1035623143 8:1050311-1050333 AGTGAAAAACAGAAGCAGAGGGG - Intergenic
1035627685 8:1084567-1084589 CTGAAAGCACAGAAGCAGTGAGG - Intergenic
1036701620 8:11016828-11016850 CTGGAAAAACAGAAGAGGAGAGG - Intronic
1036771266 8:11579746-11579768 CTGGAAAAACACTATCAGAGAGG - Intergenic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1037447859 8:18985338-18985360 ATGAACAAACACAAGCACAGAGG + Intronic
1037583685 8:20261909-20261931 GGGAAATAACAGAAGCTGAGTGG - Intronic
1037741429 8:21612166-21612188 GTGAACCAAGAGAAGCAGAGGGG + Intergenic
1037757319 8:21719353-21719375 CTCCAAAAACACAAGCAGATGGG + Intronic
1037926655 8:22848738-22848760 CTGAAAACACAGCAGAAGAAAGG - Intronic
1038208593 8:25493384-25493406 CTCAAAAACCAGAAACAGTGAGG + Intronic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1038954527 8:32452672-32452694 ATGGAAAAACAGAAGTATAGAGG + Intronic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039016911 8:33159884-33159906 CTGATCAAATAGAAGCAGAGTGG - Intergenic
1039256927 8:35729528-35729550 CTGAAAGAGCGGCAGCAGAGAGG + Intronic
1039643380 8:39249527-39249549 TTCAGAAGACAGAAGCAGAGGGG - Intronic
1039827001 8:41183149-41183171 CAGAAAAAGCAGAAGATGAGTGG - Intergenic
1040356785 8:46626085-46626107 GTGAAGAAACAGAATCTGAGGGG - Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040601453 8:48888405-48888427 GTGAAAAAACAGAAGAACAGAGG - Intergenic
1040805858 8:51395685-51395707 CTGAAAAAGCAGTAGAAGACTGG + Intronic
1041010005 8:53532369-53532391 GGGATAAAACAGAAGCACAGAGG + Intergenic
1041041593 8:53851814-53851836 CCAAACAAAGAGAAGCAGAGTGG + Exonic
1041252321 8:55946307-55946329 CAGAAAGAACAGGAGCACAGAGG - Intronic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042169997 8:65981798-65981820 CTGAAAAGCCAGGAGCAGACAGG - Intergenic
1043124744 8:76376431-76376453 TTAAAAAAACAAAAGCACAGTGG + Intergenic
1043158330 8:76814878-76814900 CTCAAAGAACAGAAGCACAAAGG - Intronic
1043297162 8:78680581-78680603 CTACAAAATCATAAGCAGAGTGG + Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044795275 8:95890925-95890947 ATGAGAAAACTGAGGCAGAGAGG + Intergenic
1045423319 8:102038707-102038729 CTTCAAAAACACAAGCACAGTGG + Intronic
1045799421 8:106084905-106084927 GAGAAAGAGCAGAAGCAGAGTGG - Intergenic
1045895186 8:107207819-107207841 AGGAAAAGACTGAAGCAGAGAGG + Intergenic
1045906146 8:107347431-107347453 ATGAAAAAATAGAATCAGAGAGG + Intronic
1046881521 8:119314113-119314135 CTGAACTAATAGAAGCAGAGAGG + Intergenic
1047052299 8:121126335-121126357 CTGGAAATCCAGTAGCAGAGTGG + Intergenic
1047203673 8:122786401-122786423 CTGAGCAAAGAGAATCAGAGAGG - Intronic
1047481175 8:125284447-125284469 ATGAGGAAACAGAACCAGAGAGG + Intronic
1047733771 8:127748129-127748151 CTGAAGATACAGGAGCAAAGGGG + Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047854776 8:128897518-128897540 TTTAAAAAATAGAAGTAGAGAGG - Intergenic
1048534253 8:135277656-135277678 TTGCAAAACCAGAAGCACAGAGG - Intergenic
1048572641 8:135668114-135668136 CTGAGAAAACAGAGGCTCAGAGG - Intergenic
1048873510 8:138817872-138817894 CTGAGGAAACAGCACCAGAGAGG + Intronic
1048935600 8:139353277-139353299 CTGAAATTACAGAAGAGGAGAGG + Intergenic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1049366887 8:142243550-142243572 CTGAACTCACAGAAGCAGAGAGG + Intronic
1049971804 9:828199-828221 CTGAAAAATCAGAAAGATAGTGG + Intergenic
1050061706 9:1716317-1716339 CTGAAAGAACAGAAGCAATTAGG + Intergenic
1050687130 9:8184392-8184414 CTGCACAAATACAAGCAGAGGGG - Intergenic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051183452 9:14435460-14435482 ATGAGAAAACAGAGGCACAGAGG - Intergenic
1051312009 9:15785675-15785697 ATGAGAAAACAGATACAGAGAGG + Intronic
1051499315 9:17759549-17759571 ATGAGAAAACAGATACAGAGGGG - Intronic
1051627232 9:19109976-19109998 CTCAAAAAATAGAAGGAAAGAGG + Intronic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052281998 9:26743612-26743634 TGGCAAATACAGAAGCAGAGTGG + Intergenic
1052540071 9:29799613-29799635 ATGAAAAAAATGAAGCGGAGTGG - Intergenic
1052692239 9:31829497-31829519 CTGAAAAAAAAAGAACAGAGAGG - Intergenic
1053538387 9:38948334-38948356 CTCAAAAAAAAGAAGAAGATGGG + Intergenic
1053752568 9:41271853-41271875 CTGAAAAAAACGAAAGAGAGTGG + Intergenic
1054258095 9:62836205-62836227 CTGAAAAAAACGAAAGAGAGTGG + Intergenic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1055415178 9:76074655-76074677 ATGAGAAAATGGAAGCAGAGAGG - Intronic
1055706430 9:79010351-79010373 CTCAACAGCCAGAAGCAGAGAGG - Intergenic
1055892618 9:81139706-81139728 GTTAAAAGAGAGAAGCAGAGTGG + Intergenic
1056430729 9:86525495-86525517 CTTAAAAAATAATAGCAGAGTGG - Intergenic
1056578491 9:87873236-87873258 CAGAAAGAAGAGAAACAGAGAGG + Intergenic
1057865808 9:98679796-98679818 CTGAAGACACAGGAGCACAGAGG + Intronic
1058152885 9:101481340-101481362 CTGGAAAAAGACAATCAGAGTGG - Intronic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1058887907 9:109336690-109336712 CTGAGAAGACAGAGGCAGAGAGG - Intergenic
1059339559 9:113589860-113589882 CTAAAAAAATGGAAGCCGAGAGG + Intronic
1059472183 9:114514005-114514027 CTGAGGAAACAGAACCAGAGGGG - Intergenic
1059521956 9:114951014-114951036 ATGAAATAACAGATTCAGAGAGG - Intergenic
1059648530 9:116292330-116292352 TTGAGAAAAGAGAAGCAGATAGG + Intronic
1059702050 9:116784766-116784788 CTGAAAATACAAAAGTAGACAGG + Intronic
1059813078 9:117878233-117878255 TTGAAAAAACTGAATCAGATAGG - Intergenic
1060189848 9:121585365-121585387 ATGAGAAAACTGAGGCAGAGAGG - Intronic
1060448303 9:123712657-123712679 CTGTTATAACAGAAGCAGGGAGG - Intronic
1060698149 9:125727796-125727818 GTGAAAAAACAAGAGCAGAGAGG + Intergenic
1060862620 9:126967356-126967378 CTGAAAAAAGAAAAGGACAGAGG - Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1202800684 9_KI270719v1_random:172171-172193 CTGAAAAAAACGAAAGAGAGTGG - Intergenic
1203546207 Un_KI270743v1:130176-130198 CTGTAAAAAAAAAAGCATAGTGG - Intergenic
1185518746 X:720717-720739 CTGCAAAGACAGAAAAAGAGAGG - Intergenic
1185754552 X:2643046-2643068 CCGAAAAAGCTGAAGCACAGGGG - Intergenic
1185764270 X:2712175-2712197 CTGAACTCACAGAAGCAGAGTGG + Intronic
1186616179 X:11190628-11190650 ATGAAATAACAGAAACAGAGGGG + Intronic
1187331490 X:18344305-18344327 CTGATAAGACAGAAGAGGAGGGG - Intronic
1187585862 X:20661243-20661265 ATAAAAAAAAAGAAGAAGAGAGG + Intergenic
1187674819 X:21705608-21705630 CTGAGCAAACAGAACAAGAGAGG - Intergenic
1188036311 X:25321374-25321396 ATGAGAAAACAGAGGCAGAGAGG + Intergenic
1189871474 X:45387447-45387469 TTGAACACATAGAAGCAGAGAGG - Intergenic
1189892751 X:45622519-45622541 CTGAAAAGACATAACCAGACTGG - Intergenic
1190075608 X:47314801-47314823 CTCAAAAAAAAGAACCAGGGAGG + Intergenic
1190369635 X:49728120-49728142 CCAAAAAGACGGAAGCAGAGCGG - Intergenic
1190526976 X:51338270-51338292 CTTAAAGAACAGAAGTAGAAGGG - Intergenic
1190568551 X:51757995-51758017 CTGAAAAAATAATAGCAGTGAGG + Intergenic
1190601928 X:52101838-52101860 CTGAAAAAAAAAAAGCAATGGGG - Intergenic
1190765576 X:53473172-53473194 CTGAAGAAAATGAAGCAGGGAGG + Intergenic
1191084661 X:56551632-56551654 TTGAAGAAACTGAAGCACAGAGG + Intergenic
1191904654 X:66075760-66075782 CTGACAAAACAGATACAGACTGG - Intergenic
1192170667 X:68852595-68852617 CTGAACAAACAAAAGCAGCTGGG - Intergenic
1192392635 X:70746586-70746608 AAGAAAGAACAGAAGCAAAGAGG + Intronic
1192446748 X:71216659-71216681 CTGAAAAGACCGCAGCAGAGAGG + Intronic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1194030894 X:88812706-88812728 CTGAAAAAAAATAAGCACTGTGG - Intergenic
1194737216 X:97526809-97526831 ACGGAAAAGCAGAAGCAGAGTGG - Intronic
1194912107 X:99658227-99658249 AGGAAAAAACAGAAAAAGAGAGG + Intergenic
1195361167 X:104085018-104085040 CTGCCAAAGCAGAGGCAGAGAGG + Intergenic
1195939338 X:110154873-110154895 GTGAGAAAACAGACACAGAGAGG - Intronic
1196020539 X:110986407-110986429 ATGAAAAAATAAAAGAAGAGAGG + Intronic
1196345241 X:114648193-114648215 CTGAAAATACAGAGTCACAGAGG - Intronic
1197479162 X:126961418-126961440 ATGCAAAAACCAAAGCAGAGAGG - Intergenic
1197597758 X:128487454-128487476 CAGATAAAACAGACTCAGAGAGG + Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1198020576 X:132653564-132653586 CAGAGAAAACAGATTCAGAGAGG + Intronic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199421265 X:147647514-147647536 CTGAAAAACCACAAGCACAATGG + Intergenic
1199505965 X:148561880-148561902 AAAAAAAAACAGAACCAGAGTGG + Intronic
1199889404 X:152060457-152060479 GTCAAAAAACACAAGCAAAGGGG - Intergenic
1200590333 Y:5065918-5065940 TTGAAAAAAGAAAAGAAGAGAGG - Intronic
1200610169 Y:5318241-5318263 CTGAAAAAATAGCAGTAGAAGGG - Intronic
1201366288 Y:13210495-13210517 CTCAAAAAAAAGATGCAGAGTGG - Intergenic
1201784716 Y:17762433-17762455 CTGAAAAAAGAGAAATACAGGGG - Intergenic
1201816836 Y:18143554-18143576 CTGAAAAAAGAGAAATACAGGGG + Intergenic