ID: 960213544

View in Genome Browser
Species Human (GRCh38)
Location 3:115000826-115000848
Sequence CTCTGCTGACCTAGTAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960213544_960213549 28 Left 960213544 3:115000826-115000848 CCCCCACTACTAGGTCAGCAGAG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 960213549 3:115000877-115000899 GACTTCAGTCCCAAAAGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960213544 Original CRISPR CTCTGCTGACCTAGTAGTGG GGG (reversed) Intronic
903840249 1:26233918-26233940 CTCTGCTCACCTAGACCTGGAGG - Intergenic
904990909 1:34591778-34591800 CTCTGCTAAGCCAGTTGTGGAGG + Intergenic
907181936 1:52578473-52578495 CTCTGCAGAGCAAGTAGTTGAGG + Intergenic
909728766 1:78868721-78868743 CCCTGCTGACCCAGCAGGGGCGG - Intergenic
910045941 1:82916555-82916577 CTCTGCTGAAGTAGTAAAGGGGG - Intergenic
911588025 1:99713765-99713787 CTGAGCTGACATAGTAGTGTTGG + Intronic
913217438 1:116632175-116632197 CTCTGATGATATAGTTGTGGAGG + Intronic
920023606 1:202975472-202975494 CACTGCTGAACAAGTAGTTGTGG - Intergenic
920187822 1:204172608-204172630 CTCTGTTGACCTAGTAAGGGTGG + Intergenic
922899702 1:229126817-229126839 TTCTTCTGACCTTTTAGTGGAGG - Intergenic
1064123608 10:12640236-12640258 CTCTGCTGAACCAGAAGGGGTGG - Intronic
1069699446 10:70410949-70410971 CCCTGCTGCCCTAGCAGTGTTGG + Intronic
1070304365 10:75230762-75230784 GTCAGCTGACCTACTAGTGCTGG - Intronic
1071007030 10:80895009-80895031 CTCTGCTCTCCCAGCAGTGGTGG - Intergenic
1076097201 10:127740956-127740978 CTCTGCTCACCTGCTTGTGGAGG - Exonic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1092763230 12:11828404-11828426 CTCTTCTCACTTAGAAGTGGGGG - Intronic
1095926012 12:47579886-47579908 CTCTCCTGACCTTGCAGCGGAGG - Intergenic
1100313937 12:93426131-93426153 CTCTTCTGGCTTAGTAGTGCAGG - Intronic
1102954819 12:117052637-117052659 CTGGGCTGAGCTAGAAGTGGAGG - Intronic
1106219435 13:27733411-27733433 CTCTGCTGACCTAGGGATTGTGG + Intergenic
1110395147 13:75021307-75021329 CTCTCCACACCTATTAGTGGTGG + Intergenic
1122788410 14:104174374-104174396 CTCTGCTGGCCTGGTTGGGGTGG + Intronic
1124040973 15:26103345-26103367 CTCTGCTGACCTGGAAGGTGGGG - Intergenic
1124041046 15:26103833-26103855 CCCTTCTGACCCAGCAGTGGAGG + Intergenic
1124507623 15:30291969-30291991 GTAGGCTGAGCTAGTAGTGGTGG - Intergenic
1124735933 15:32246689-32246711 GTAGGCTGAGCTAGTAGTGGTGG + Intergenic
1127862837 15:63008736-63008758 CCCCTCTGACCTTGTAGTGGGGG - Intergenic
1128331410 15:66757862-66757884 CTCTGCAGACGTGGTGGTGGTGG + Intronic
1133102282 16:3486639-3486661 CTCTGCTGACCTGACAGTGCTGG + Exonic
1133269229 16:4602453-4602475 CTCTGCTGAGCTGGGAGGGGAGG + Intergenic
1133963474 16:10514467-10514489 TGCAGCTGACCTTGTAGTGGGGG + Intergenic
1133970841 16:10567024-10567046 CTCTGCTGACTTAGGAGTTGGGG - Intronic
1136075049 16:27811519-27811541 CTCTGTTGACCTAGAGGTGCTGG - Intronic
1141599204 16:85115007-85115029 CTCTCCTGTCCTAGTAGAGCTGG - Intergenic
1146549385 17:33767103-33767125 CTCTGCTGACCTTGGATTTGAGG + Intronic
1149993426 17:61395265-61395287 CACTGCAGACCTAGAACTGGAGG + Intergenic
1160518619 18:79491736-79491758 CTCTGCGAACCAAGCAGTGGTGG + Intronic
1163624872 19:18383302-18383324 CTCTGCTGACCCAAGACTGGTGG - Intronic
1167330696 19:48854064-48854086 CGCTGCTGACCAAGTTGTGCGGG - Exonic
1167390252 19:49190209-49190231 CTCTGCTGACACAGAAGTGGTGG + Exonic
930910556 2:56624259-56624281 CTCTGGTGACTAAGTAATGGAGG - Intergenic
938421968 2:131153457-131153479 TTCTGATGACATAGCAGTGGAGG - Intronic
938735871 2:134186264-134186286 CTGTGCTGTCCTAGTGATGGGGG + Intronic
939977772 2:148738966-148738988 CTGTGCTTACCATGTAGTGGAGG + Intronic
947526229 2:230878291-230878313 CTCTGCTGACCTGGGTGTGGCGG + Exonic
1170605629 20:17873521-17873543 CTCTGCTGAGCTAGTAATAGTGG + Intergenic
1173181523 20:40809754-40809776 CCCTGCAGGCCTAGGAGTGGGGG + Intergenic
1174956779 20:55106352-55106374 CTCTGCAGCCCTAAGAGTGGAGG + Intergenic
1175290282 20:57870797-57870819 CTCTGGTGACCTGGAAGTTGGGG - Intergenic
1179192769 21:39137332-39137354 CTCTGCTGACTCAGGAGTGTGGG - Intergenic
1180818745 22:18810257-18810279 CTCTGATGATATAGTTGTGGAGG + Intergenic
1181204969 22:21244712-21244734 CTCTGATGATATAGTTGTGGAGG + Intergenic
1203221956 22_KI270731v1_random:50703-50725 CTCTGATGATATAGTTGTGGAGG - Intergenic
1203268873 22_KI270734v1_random:36110-36132 CTCTGATGATATAGTTGTGGAGG + Intergenic
951169589 3:19524900-19524922 CCCTTCTGACCTAGGAGTTGTGG - Intronic
952892837 3:38054841-38054863 TTCTGCTGACTTACTCGTGGTGG - Intronic
955922131 3:63968157-63968179 TTCTGCTGCTCAAGTAGTGGAGG + Intronic
956547690 3:70423688-70423710 CTCAGCTGACCTAATTGTGTAGG + Intergenic
960091849 3:113648075-113648097 CTCTGCTGATTTTATAGTGGAGG - Intergenic
960213544 3:115000826-115000848 CTCTGCTGACCTAGTAGTGGGGG - Intronic
961485941 3:127216560-127216582 CCCTGCTGACCTCTTAGTGATGG + Intergenic
972015302 4:34235878-34235900 CTATCCTCACCTAGTATTGGGGG - Intergenic
972645264 4:40962008-40962030 CTCTCTTGACCTAGAATTGGAGG - Intronic
973367543 4:49219788-49219810 CTCTACTGACCTAGTAAAGGAGG + Intergenic
974362499 4:60900466-60900488 ATCTGCTGACCAAGTAATAGTGG + Intergenic
978675431 4:111309289-111309311 CTGTGCTAAACCAGTAGTGGGGG + Intergenic
985696867 5:1345627-1345649 CTCTGCTGACCTCGCCGTGCTGG - Intergenic
996538620 5:124605650-124605672 CTCTGCTTACATAGTAATGCTGG + Intergenic
1001547439 5:172579327-172579349 CTCTGCAGACCCAGAATTGGAGG - Intergenic
1004454001 6:15774522-15774544 TTCTGCAGATCTAGTAATGGGGG - Intergenic
1016229895 6:141789647-141789669 CAGTGCAGTCCTAGTAGTGGTGG + Intergenic
1016267227 6:142246690-142246712 CCCTGCTGACCTCCCAGTGGTGG + Intergenic
1019294989 7:269337-269359 CACTGCTGACCTGATTGTGGAGG - Intergenic
1019345924 7:530928-530950 CTCTGCTGGCCCAGTGGCGGGGG - Intergenic
1019388466 7:772010-772032 CTCTGCTGAAGTAGAAATGGTGG + Intronic
1021620840 7:22549962-22549984 CTGTGCTGGCCTCGGAGTGGGGG + Intronic
1023115001 7:36854171-36854193 CTATGGTGACCTAGCAATGGTGG + Intergenic
1023435298 7:40135214-40135236 CTCTGCTGACCCCTTAGCGGTGG + Intronic
1029629079 7:101739315-101739337 CTCTGCTGCCCTACCCGTGGGGG - Intergenic
1030534775 7:110752588-110752610 CCCTGCTGCCGTAGTAATGGAGG - Intronic
1032017086 7:128387256-128387278 CTCCCCTGACCTCGTGGTGGGGG - Intergenic
1033330988 7:140416744-140416766 CACTGTTGATCTAGTTGTGGTGG + Intronic
1037925797 8:22843327-22843349 CTCAGTTGATCTAATAGTGGAGG + Intronic
1038104797 8:24420452-24420474 CTTTTCTGACCTAGTCATGGAGG + Intergenic
1040511700 8:48101554-48101576 TTCTTCTGACCTGGTAGTGAAGG + Intergenic
1042059495 8:64801390-64801412 CTCTGCTGTCCCAGCAGTGACGG - Intergenic
1043448987 8:80348027-80348049 CTCTGCTGCCCCAGCAGTGCAGG - Intergenic
1190742557 X:53299491-53299513 CTTTGGTGTCCTAGAAGTGGGGG + Intronic
1191197281 X:57737693-57737715 CTGTGCTGTCCTAGTGGTTGTGG + Intergenic
1192090194 X:68146616-68146638 CTCTGCTGACCTAATTATCGGGG - Intronic
1198702460 X:139413186-139413208 CAGTGCTGTCCTAGTGGTGGTGG - Intergenic
1198735729 X:139783124-139783146 CTCTGCTTACTTATTGGTGGGGG + Intronic
1199705872 X:150424515-150424537 ATATGCTGACCTAGCAGTGCTGG - Intronic