ID: 960215290

View in Genome Browser
Species Human (GRCh38)
Location 3:115026754-115026776
Sequence CAATATACACAGGTGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960215290_960215293 30 Left 960215290 3:115026754-115026776 CCTTTCATCACCTGTGTATATTG 0: 1
1: 0
2: 1
3: 13
4: 216
Right 960215293 3:115026807-115026829 TTTTATATGAAAAACATTGCGGG 0: 1
1: 0
2: 3
3: 55
4: 506
960215290_960215292 29 Left 960215290 3:115026754-115026776 CCTTTCATCACCTGTGTATATTG 0: 1
1: 0
2: 1
3: 13
4: 216
Right 960215292 3:115026806-115026828 ATTTTATATGAAAAACATTGCGG 0: 1
1: 0
2: 5
3: 79
4: 729

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960215290 Original CRISPR CAATATACACAGGTGATGAA AGG (reversed) Intronic
900271830 1:1794208-1794230 CAATATCCACACATGATGACTGG + Intronic
900877096 1:5350566-5350588 AAAGAAACACAGTTGATGAAGGG + Intergenic
902245704 1:15119063-15119085 GAACTTACACAGGTCATGAAAGG + Intergenic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
905081684 1:35328016-35328038 CAATATACACACTTGAGCAAAGG - Intronic
906569468 1:46824151-46824173 CAATAGACACGGGTCAGGAATGG - Intergenic
906909840 1:49936122-49936144 CAATATACAGAAGTGCTTAAAGG + Intronic
908748043 1:67394840-67394862 CACACTAAACAGGTGATGAAGGG - Intronic
909263479 1:73526325-73526347 AAATATACCCAGGAGAGGAACGG + Intergenic
909527370 1:76641803-76641825 CAATACACATAGGAGATGAAGGG + Intergenic
910085017 1:83390422-83390444 CAAGGTACAGAGGTGCTGAAAGG + Intergenic
911006282 1:93228099-93228121 TTAGATACACAGGTGATGAAAGG + Intronic
911144309 1:94538056-94538078 CTGTATAAACAGGTAATGAAGGG + Intronic
911183782 1:94883910-94883932 GAATATACACAGAGGAAGAAAGG - Intronic
914512833 1:148349440-148349462 CAAAATACAGATCTGATGAAGGG + Intergenic
920301896 1:204994053-204994075 CAATAGACACAGCTAATGAGTGG + Intronic
920835406 1:209506202-209506224 CAACATACAAAGGAGATGAAAGG + Intergenic
921534675 1:216331397-216331419 GAAAATAGACAGGTGATGACTGG + Intronic
923522486 1:234746462-234746484 AAATATACACATGTTGTGAAAGG - Intergenic
923975891 1:239262235-239262257 AAATATTCCCAGGTGATTAATGG + Intergenic
1063994327 10:11603870-11603892 AAATACACACAGGTGAAGAGAGG + Intronic
1066552348 10:36572888-36572910 AGATAAACTCAGGTGATGAAAGG - Intergenic
1066604881 10:37154617-37154639 AAATTTTCACAGGTGTTGAATGG + Intronic
1067659685 10:48224877-48224899 CTGTATTCACAGGTTATGAAAGG + Intronic
1069413615 10:68178336-68178358 CAAGATCCACTGGTGATGAATGG - Intronic
1070845615 10:79520596-79520618 CAATATACAAGGATGATGGACGG - Intergenic
1070928180 10:80239718-80239740 CAATATACAAGGATGATGGACGG + Intergenic
1073152013 10:101318460-101318482 CAAAATACACATGTGATGGCAGG + Intergenic
1073702141 10:105939437-105939459 CAATTTACACAGTTACTGAAAGG - Intergenic
1073989288 10:109244435-109244457 CTATAGACACAGGTGAGCAAAGG - Intergenic
1075191519 10:120313702-120313724 TAATATAAACAGATGATGGAAGG - Intergenic
1075503892 10:123004832-123004854 CCATATACACAGGGTATGACAGG + Intronic
1076459928 10:130635198-130635220 GAATATAGACAGGTGATCAGTGG - Intergenic
1077677575 11:4209945-4209967 AAATATACACAGGTTAAGTATGG + Intergenic
1078178133 11:8986070-8986092 CAATACACATAAGTGATGTAAGG - Intronic
1078651840 11:13202566-13202588 CAATAGACACTGGGGATGACTGG + Intergenic
1079332378 11:19544562-19544584 CAACATAGACAGGTGTTCAAGGG - Intronic
1081030868 11:38081226-38081248 CTATATACACAGGTTTTCAAGGG + Intergenic
1081183480 11:40013671-40013693 CAATCTACTCATCTGATGAAGGG + Intergenic
1081207361 11:40291713-40291735 CAATAAACCAAGGCGATGAAGGG - Intronic
1085940151 11:81198548-81198570 GAATGTTCACAGGTGAAGAAAGG + Intergenic
1087357957 11:97119118-97119140 CAAGATACCCAGCTTATGAATGG + Intergenic
1088499182 11:110465479-110465501 CAATATTCACAGGAGATAAGGGG - Intergenic
1092984549 12:13833386-13833408 CAATATGCAGAGGAGATGGAGGG - Intronic
1093221624 12:16427272-16427294 CTATGTAAACAGGGGATGAAGGG + Intronic
1093558929 12:20514392-20514414 TAATTTACACATGTGATGCATGG - Intronic
1095516658 12:43013650-43013672 AAATATACACAATAGATGAAAGG - Intergenic
1095719859 12:45388533-45388555 CAGTAGACACAGGAGATAAATGG + Intronic
1098592476 12:72229600-72229622 CAAAATACAAAGTGGATGAAGGG + Intronic
1103771504 12:123330204-123330226 CAATAGCCACATGTGATGAGTGG + Intronic
1106876190 13:34076603-34076625 CCATACTCACAGGAGATGAATGG - Intergenic
1109189350 13:59306863-59306885 CATTATAAAGAGGTGATGAATGG - Intergenic
1109235889 13:59819300-59819322 CAATAAGCACAGGTGAGCAAAGG - Intronic
1109626172 13:64978074-64978096 CAATCTATACATGTGATAAAGGG - Intergenic
1109855487 13:68121298-68121320 TAATATACACAAATGATGACTGG + Intergenic
1110494143 13:76146236-76146258 CTATGTACCCGGGTGATGAATGG - Intergenic
1112343236 13:98569530-98569552 GAAGATACGCAGGTGACGAAAGG + Intronic
1112883797 13:104143813-104143835 CAGAAAACACAGGTGATTAACGG + Intergenic
1115366224 14:32560115-32560137 TAAGATACACAGTAGATGAATGG + Intronic
1116137258 14:40942730-40942752 CAATATAGAAAGTTGATTAAGGG - Intergenic
1116524452 14:45888087-45888109 CAATACACAGAAGTGATTAAAGG - Intergenic
1117437182 14:55727521-55727543 CAATCTACCCATCTGATGAAGGG - Intergenic
1117756897 14:58984175-58984197 TAATATACACAACTGATAAATGG + Intergenic
1124954868 15:34353770-34353792 CAGAACACACAGCTGATGAATGG + Exonic
1125468047 15:39974421-39974443 CAATATACTCAGTTGATGGTGGG - Intronic
1127028542 15:54835130-54835152 GAATGTATTCAGGTGATGAAGGG - Intergenic
1127368130 15:58310347-58310369 CACTCCACACAGGTGGTGAATGG - Intronic
1128774052 15:70305802-70305824 GAATTTACACAGGTGATTAAAGG - Intergenic
1133459924 16:5978545-5978567 GAATAGAAACAGGTGATTAATGG - Intergenic
1134208635 16:12257943-12257965 AAATATACCCTGGAGATGAATGG + Intronic
1137279833 16:46966466-46966488 CAGTAGTCACAGGTGATTAATGG + Intronic
1139482783 16:67239904-67239926 TAATAAACACAGATGAGGAAGGG + Intronic
1140314970 16:73887660-73887682 AAAAATACACAGGTGAGAAAAGG + Intergenic
1142538211 17:635297-635319 CAATCTACTCATCTGATGAAGGG - Intronic
1143224387 17:5288158-5288180 CAATATACAGAGGTCAGTAAAGG + Intronic
1143843590 17:9754761-9754783 CATTATAAACAGGAGATGTATGG + Intergenic
1144648787 17:16993165-16993187 AAATGTGCACAGCTGATGAATGG - Intergenic
1146735484 17:35235084-35235106 CAATATACCCATCTGATAAAGGG - Intergenic
1150089161 17:62305868-62305890 CAATCTACACATCTGATAAAGGG - Intergenic
1150734749 17:67727331-67727353 CAAAGTACACAGGTGAGGATGGG - Intronic
1153157296 18:2164096-2164118 CAGCATACACAGGTGATTCAAGG + Intergenic
1154983893 18:21529343-21529365 CATTATATACAGGTCATAAAAGG + Exonic
1155807463 18:30190293-30190315 CAAGATACAGAGTGGATGAATGG - Intergenic
1155901519 18:31396713-31396735 CAATTTACCCAGGTGGTGAATGG + Intronic
1160258067 18:77264499-77264521 CAGCATACAGATGTGATGAAGGG - Intronic
1162809581 19:13155831-13155853 CAATCCACACAGGAGAGGAAAGG - Intergenic
1165914857 19:39251914-39251936 CAAGATACACAGCTAATAAATGG + Intergenic
927205711 2:20609095-20609117 CAAGAAACACAGGTGTTCAAGGG + Intronic
927425304 2:22974925-22974947 CAAAATACAATGGTGATGCATGG - Intergenic
928041133 2:27878968-27878990 GGATATACAGTGGTGATGAAAGG - Intronic
930364246 2:50419034-50419056 CAAAATACACAATTGAGGAAGGG + Intronic
933398560 2:81762861-81762883 CAATCTACTCATCTGATGAAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936227695 2:110672773-110672795 CAATGTACAGAGGGGATGACAGG + Exonic
936986100 2:118312365-118312387 CAATCTACACAGATGAAGACAGG + Intergenic
937526826 2:122781482-122781504 CAATGCACACAGGTGAGCAACGG - Intergenic
937644114 2:124246819-124246841 GAATATTCACAGGAGATGATAGG - Intronic
939625972 2:144477858-144477880 CAATAATCTCTGGTGATGAAGGG + Intronic
942913095 2:181269846-181269868 CATTCTACAGAGGTGAGGAATGG + Intergenic
944158620 2:196635843-196635865 CTATCTACACAGGTAATAAAAGG + Intergenic
946573356 2:221048567-221048589 CAATATTGAGAGGTGATAAATGG - Intergenic
948754235 2:240149938-240149960 CAAGGAACACAGGTGAGGAAGGG + Intergenic
1169271383 20:4202064-4202086 CAGTATACAAAGTTGAAGAAAGG - Intergenic
1172796500 20:37543010-37543032 TAATATATACAGATGTTGAAGGG + Intergenic
1173145600 20:40521586-40521608 AAAGATACACAGGTGATGAATGG - Intergenic
1174210092 20:48871227-48871249 CAAAATACTCAGGCTATGAAAGG + Intergenic
1174210161 20:48871833-48871855 CAAAATACTCAGGCTATGAAAGG + Intergenic
1174902856 20:54518794-54518816 CAATCTACTCATGTAATGAAGGG + Intronic
1178230279 21:30775836-30775858 CACTGTACACAAGAGATGAAGGG + Intergenic
1178448121 21:32663930-32663952 GTCTATACACAGATGATGAAGGG + Intronic
1179101505 21:38358994-38359016 CAACAGCCACAGGTGATGGATGG + Intergenic
1182152775 22:28041823-28041845 CAATCTACACATGTGACAAAGGG + Intronic
1183127228 22:35794958-35794980 CAATATTAACATGTGCTGAAAGG + Intronic
949301475 3:2589186-2589208 CAAAATACTCTGGTGATTAAAGG - Intronic
951130829 3:19042209-19042231 CAATAAACACACGTGACTAATGG + Intergenic
952056785 3:29456826-29456848 GACAATACACAGGTGAAGAAAGG + Intronic
952824556 3:37514190-37514212 CAATATACACATGGTATCAAGGG + Intronic
953835147 3:46336433-46336455 CAATATAGACAATGGATGAATGG + Intergenic
954230914 3:49216733-49216755 CAATCTACACATCTGATAAAGGG + Intronic
954954742 3:54509102-54509124 AAATATACACATGTAATTAAGGG - Intronic
955432121 3:58857076-58857098 CAAGATACACAGGTAAGGACAGG + Intronic
957663792 3:83196523-83196545 CAATATACATAGATGATATAAGG + Intergenic
957964001 3:87298480-87298502 AATTATACAGAGATGATGAAAGG + Intergenic
958950155 3:100407794-100407816 AAATATACAGAGGAGAAGAAAGG - Intronic
959666531 3:108928346-108928368 CAAAAAACATAGCTGATGAAGGG - Intronic
960215290 3:115026754-115026776 CAATATACACAGGTGATGAAAGG - Intronic
960975293 3:123167553-123167575 GAATCTACACAGGTGATAAATGG - Intronic
964804994 3:160599135-160599157 GAATCTAAACAGGTCATGAAAGG - Intergenic
966408088 3:179620099-179620121 CAATATACTCATGTGACAAAGGG - Intronic
966743092 3:183252185-183252207 CAACATACACATGTGATGGCTGG + Intronic
966952782 3:184838524-184838546 CAAAATACAAAGGGCATGAAAGG - Intronic
967451772 3:189632377-189632399 CAACAGACACAGGTGGTAAATGG - Intronic
969388702 4:6874613-6874635 CAGTACAGACAGGTGGTGAAAGG + Intronic
970743151 4:19261927-19261949 CAAATTACCCAGATGATGAAAGG - Intergenic
971070295 4:23083197-23083219 CAATAGCCACATGTGATTAATGG - Intergenic
971674521 4:29608494-29608516 CAATGCACACAGGTGCTTAATGG - Intergenic
971830402 4:31685181-31685203 CAATCTACTCATCTGATGAAGGG + Intergenic
972236478 4:37139446-37139468 CAGTATACAAGGCTGATGAAAGG + Intergenic
972357640 4:38295753-38295775 CAATCTACCCATCTGATGAAGGG + Intergenic
973836245 4:54812306-54812328 CAATCTACCCATCTGATGAAGGG + Intergenic
974511423 4:62847041-62847063 GAATATAAACAGGTAATGAAAGG + Intergenic
975265872 4:72366469-72366491 TATTATGCAAAGGTGATGAATGG + Intronic
975726453 4:77296393-77296415 CAATCTACCCATCTGATGAAGGG - Intronic
975886931 4:78977330-78977352 CAATCTACTCATCTGATGAAGGG - Intergenic
977455144 4:97249760-97249782 TAATAAACACAGTTGATGTAAGG + Intronic
977693400 4:99941237-99941259 CTATATACACAGGCAATGTAAGG + Intronic
978471747 4:109075702-109075724 AAATATACACAGGAAGTGAAAGG - Intronic
979118244 4:116856019-116856041 CCATATACACAGGTTCTGATAGG + Intergenic
980196288 4:129592961-129592983 CAATCTACCCATCTGATGAAGGG + Intergenic
981569604 4:146137448-146137470 CATTAATTACAGGTGATGAAAGG + Intergenic
982409492 4:155058489-155058511 CAACAAACAAAGATGATGAATGG + Intergenic
982879525 4:160694063-160694085 TAATATACAGAGGTAATCAATGG + Intergenic
983856695 4:172655543-172655565 AAATATACACAGCTCATAAAGGG + Intronic
983935346 4:173499143-173499165 CATTTTTCAGAGGTGATGAAAGG + Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
988167474 5:27613179-27613201 CAATATAAACAGCTCAAGAAAGG + Intergenic
988394856 5:30683719-30683741 CAATATAAACAGGTGGTCAATGG + Intergenic
989806106 5:45607671-45607693 CAATACAAACAGCTGATGGATGG + Intronic
991536492 5:67674436-67674458 CAAAATACACATTTGCTGAATGG + Intergenic
993434229 5:87871848-87871870 CTATATTCACAGTTGATGTATGG - Intergenic
993490936 5:88548132-88548154 CACTTTTCACAGATGATGAAGGG + Intergenic
994915149 5:105966545-105966567 CACTATATCCAGGTGATGGATGG + Intergenic
996106917 5:119516142-119516164 CCATATAATCAGGTGATGGAGGG + Intronic
998249372 5:140541018-140541040 CAAGATACACAGGTGATCCAAGG - Intronic
998671200 5:144356371-144356393 AAATATACAAAGGAGATTAAAGG - Intronic
1000123479 5:158220575-158220597 CCAGATATAAAGGTGATGAAGGG - Intergenic
1000450085 5:161374702-161374724 CAATATACAGTGATCATGAAAGG - Intronic
1000474618 5:161690395-161690417 CAAAATACACAAGCAATGAAAGG - Intronic
1000630861 5:163588980-163589002 CAACATATACAGGTGGTCAAAGG + Intergenic
1001717052 5:173824870-173824892 GAATATAGTCTGGTGATGAAGGG + Intergenic
1004958762 6:20760997-20761019 CAAAATACACATATGATAAAGGG + Intronic
1010047584 6:71464453-71464475 CAATTTACACAGGGCATGACAGG - Intergenic
1012763538 6:103333297-103333319 CAAAAGACACATCTGATGAAAGG + Intergenic
1012779649 6:103541456-103541478 CAATATACAAAGGAGGGGAATGG + Intergenic
1013269564 6:108533580-108533602 CAAAATAGACAGCTGATGTATGG + Intergenic
1015220143 6:130795025-130795047 CAGTTTACACATGTGATGGATGG - Intergenic
1017000896 6:149996353-149996375 CCATATATTTAGGTGATGAAGGG + Intergenic
1017169651 6:151444690-151444712 CAAGATACAAAGGTTATCAAGGG + Intronic
1019759561 7:2800407-2800429 AAACCTACACAGGTGAGGAAAGG + Intronic
1020853842 7:13391883-13391905 CTATAGACACACGTGAAGAAAGG + Intergenic
1021691340 7:23233497-23233519 CAAGTTACACGGCTGATGAATGG + Intergenic
1024481627 7:49869263-49869285 CAAAATACACAGTGAATGAATGG + Intronic
1024680739 7:51684292-51684314 TAATATACACAGGTAATCATGGG + Intergenic
1025251726 7:57355831-57355853 CAAGACACACAGATGATTAAAGG + Intergenic
1026324985 7:69301251-69301273 CACTCTACACTGCTGATGAAGGG + Intergenic
1027301834 7:76846520-76846542 CAAGGTACAGAGGTGCTGAAAGG + Intergenic
1028734619 7:94193299-94193321 CAATCTACCCATCTGATGAACGG + Intergenic
1032142683 7:129347614-129347636 CAAAAAACAGAGGTGAGGAAGGG - Intronic
1032154589 7:129457668-129457690 AAATATAAAAATGTGATGAAGGG + Intronic
1038951469 8:32419904-32419926 CAATATAAACAGGGTGTGAAGGG - Intronic
1039173903 8:34781782-34781804 TAATAGACACAGTTTATGAAAGG - Intergenic
1040557154 8:48490766-48490788 CAATCTACCCACCTGATGAAGGG + Intergenic
1041415768 8:57607210-57607232 CAAGATAAACAGATGATCAATGG - Intergenic
1042636475 8:70881359-70881381 CAATCTACCCATCTGATGAAGGG + Intergenic
1043200186 8:77359536-77359558 CATTAGACACAGTTGAAGAAAGG - Intergenic
1043513874 8:80977880-80977902 AAATAAACACAGGTAATGAAGGG - Intronic
1043700237 8:83277833-83277855 CAAAATACACAGGAAATAAAAGG - Intergenic
1043827984 8:84952326-84952348 CAATCTACCCATGTGAAGAAAGG - Intergenic
1043881118 8:85544332-85544354 GTATATTCACAGGTGCTGAAGGG + Intergenic
1044091327 8:88005878-88005900 GAATGGACACAGGTGCTGAATGG - Intergenic
1048206179 8:132417166-132417188 CTATTTACAAAGGTGAGGAAAGG + Intronic
1048563539 8:135568915-135568937 CAATATAAACTGATAATGAAAGG - Intronic
1050265199 9:3882505-3882527 CACTAGAAACAGGTGGTGAAGGG + Intronic
1051944299 9:22548421-22548443 CAATATATAAAGCTGAAGAAGGG + Intergenic
1052153526 9:25151903-25151925 CAATAAAAATAGGTGATGATAGG - Intergenic
1052775710 9:32730166-32730188 CAATATAGAGAGGTGCTTAAAGG + Intergenic
1053377563 9:37620646-37620668 CAATAAAAACAGGAGTTGAAAGG - Intronic
1054848323 9:69820639-69820661 CGGGCTACACAGGTGATGAAGGG - Intergenic
1055706217 9:79007593-79007615 CAATAGACACATGTGATCATTGG - Intergenic
1056928861 9:90858101-90858123 GAATATACAGAGGTGATGCCCGG - Intronic
1058368071 9:104234155-104234177 GAATATAGACAGGTAAAGAAAGG - Intergenic
1058962071 9:110000914-110000936 CAATCTACTCATCTGATGAAGGG - Intronic
1058989317 9:110239966-110239988 CAATATAGCCAGGAGATGATGGG - Intergenic
1059618293 9:115975233-115975255 CAATTTACACAGGAGAAGAAAGG - Intergenic
1060675521 9:125510914-125510936 CAATATAGCCAGGTGGTTAAGGG + Intronic
1062178355 9:135176713-135176735 CCATAGTCACAGATGATGAAGGG + Intergenic
1185810187 X:3101210-3101232 GAATATACAAAGGTGAGGAGAGG + Exonic
1186326085 X:8478150-8478172 AAATATACCCAGGTGAATAATGG - Intergenic
1188948147 X:36334006-36334028 AAATATACAAATGTGCTGAAAGG + Intronic
1193335398 X:80282292-80282314 AAATAGACAAAGGTGATCAAAGG - Intergenic
1193740299 X:85208798-85208820 CAATCTACACATGTGACAAAGGG - Intergenic
1193977397 X:88139395-88139417 CAATATATAGTTGTGATGAATGG + Intergenic
1194070306 X:89315971-89315993 CAATATACAAAAGTGACAAAAGG + Intergenic
1195835640 X:109112039-109112061 CAATCTACTCATCTGATGAAAGG - Intergenic
1197292566 X:124676961-124676983 CAACAGACACATGTGATGAGTGG - Intronic
1197473240 X:126889385-126889407 CATTATATACAGGTAATAAATGG - Intergenic
1198535046 X:137576810-137576832 CTATTTACACATCTGATGAATGG + Intronic
1199928021 X:152489964-152489986 CAATCTACTCAGCTGACGAAGGG + Intergenic
1200724547 Y:6651594-6651616 CAATATACAAAAGTGACAAAAGG + Intergenic
1201597394 Y:15686331-15686353 GAATCTACACATCTGATGAAGGG + Intergenic
1202020332 Y:20458182-20458204 CAATCTACACATGTGACAAAGGG - Intergenic