ID: 960221175

View in Genome Browser
Species Human (GRCh38)
Location 3:115110327-115110349
Sequence CCATAGGGATGATTCAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960221171_960221175 -7 Left 960221171 3:115110311-115110333 CCTCTGAGGCAACAGGCCATAGG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 960221175 3:115110327-115110349 CCATAGGGATGATTCAAAATAGG 0: 1
1: 0
2: 0
3: 7
4: 129
960221170_960221175 -6 Left 960221170 3:115110310-115110332 CCCTCTGAGGCAACAGGCCATAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 960221175 3:115110327-115110349 CCATAGGGATGATTCAAAATAGG 0: 1
1: 0
2: 0
3: 7
4: 129
960221168_960221175 3 Left 960221168 3:115110301-115110323 CCTGCTAAGCCCTCTGAGGCAAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 960221175 3:115110327-115110349 CCATAGGGATGATTCAAAATAGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960221175 Original CRISPR CCATAGGGATGATTCAAAAT AGG Intronic
905928220 1:41767188-41767210 CCAGAGGGAGGAGTCCAAATAGG - Intronic
906283956 1:44573766-44573788 ACATAGGGATGATTCCAGAGAGG - Intronic
909430665 1:75583914-75583936 CCATAGGAATTACTGAAAATTGG - Intronic
917270348 1:173265871-173265893 CAATAGGGAGGATACAATATCGG - Intergenic
1063100952 10:2949840-2949862 CCATAGGCATGGGTTAAAATGGG + Intergenic
1064201339 10:13287611-13287633 CCATAGGGAAGAGTCGATATAGG - Intronic
1069205865 10:65685198-65685220 CCATATGGATTATTAAAAAGAGG - Intergenic
1078063719 11:8064375-8064397 CCATAGGGATAAACCAAATTTGG + Intronic
1078595903 11:12686481-12686503 TCATAGGAATGATTCAGCATTGG + Intronic
1078653779 11:13219617-13219639 CCATATGCATGATACAAAATTGG - Intergenic
1085144224 11:74178409-74178431 CCAAGGGAATGAATCAAAATTGG - Intronic
1088812858 11:113403256-113403278 CCCTAGGGATGTTTAAAATTGGG + Intergenic
1088867136 11:113858975-113858997 TCCTATGGATGATTCAAATTAGG - Intronic
1090453243 11:126825032-126825054 CCAAAGGGAAAATTCAAACTGGG - Intronic
1090793713 11:130115487-130115509 TCACAGGGATGATTAGAAATTGG + Intronic
1095490289 12:42726340-42726362 CCATAAGGATGAATTAATATGGG + Intergenic
1097932680 12:65206845-65206867 CCAAATTAATGATTCAAAATTGG + Intronic
1100772816 12:97942096-97942118 CCCAAGGGATGAGTCATAATTGG - Intergenic
1102920493 12:116788257-116788279 ACATAGGGATGCTGCAGAATGGG - Intronic
1104112081 12:125713783-125713805 CCAGTGGGATCATTTAAAATGGG + Intergenic
1107623199 13:42254745-42254767 ACATATGTATAATTCAAAATAGG - Intronic
1109370622 13:61415769-61415791 CCACAGCAAAGATTCAAAATTGG - Exonic
1111967760 13:94878180-94878202 CCAAAGGGATCATTCAGAATTGG + Intergenic
1112185075 13:97120049-97120071 ACAGAGGGCTGATTCAAAAGTGG - Intergenic
1113249070 13:108431393-108431415 TCTTAAGGATGATTCAAAGTAGG - Intergenic
1113286635 13:108856914-108856936 CCATAGAGAAGATTCAAGACTGG - Intronic
1115004856 14:28469106-28469128 CCTTAGAGAGGAATCAAAATAGG - Intergenic
1115965733 14:38885338-38885360 CCATAAGGTTTATTCAAAAAGGG + Intergenic
1116197155 14:41742720-41742742 ACATAGGGGTGTTCCAAAATGGG + Intronic
1116266289 14:42694673-42694695 CCAAAGGAATTATTCAAAATTGG - Intergenic
1116540186 14:46093007-46093029 CCATTGGGATGAGCCAAAAATGG - Intergenic
1117118641 14:52544971-52544993 TAATAGGGATGTTTTAAAATAGG + Intronic
1118003076 14:61541442-61541464 CCAGAGCGATGATCCTAAATGGG - Intronic
1118735044 14:68695143-68695165 TCAGAGGGAAGATACAAAATAGG - Intronic
1121224353 14:92310357-92310379 CCAGATGGTTGATGCAAAATGGG - Intergenic
1122422703 14:101587492-101587514 CCATAGGGATTATCCAGATTTGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125045279 15:35238073-35238095 CAATAGGAATTTTTCAAAATAGG - Intronic
1127588965 15:60403953-60403975 CCATAGAGCCTATTCAAAATAGG + Intergenic
1127609942 15:60627059-60627081 ACAGAGGAATGAATCAAAATGGG - Intronic
1128576575 15:68780049-68780071 CAATAGGAATTTTTCAAAATAGG + Exonic
1128949362 15:71860188-71860210 CTATAGGAATGATTCTTAATAGG - Intronic
1130063561 15:80586892-80586914 CGAAAGGCATAATTCAAAATAGG + Intronic
1131815510 15:96217407-96217429 CCAGAGGGTTGATGGAAAATGGG - Intergenic
1135790916 16:25394931-25394953 TCATAGGGATGAATCAAGAGAGG - Intergenic
1136535277 16:30895949-30895971 ACATAGGGATGATCCATACTTGG - Intergenic
1137918633 16:52461870-52461892 CCAGAGGCATGGTTAAAAATTGG - Intronic
1137997781 16:53237710-53237732 CCATACTGATGATTCTTAATTGG + Intronic
1138437482 16:57012036-57012058 AAATAGGAATGATTCTAAATGGG - Intronic
1138800176 16:60017146-60017168 ACAAAGGGATGATTTGAAATTGG - Intergenic
1138827227 16:60335036-60335058 CCACAATGATGATACAAAATAGG - Intergenic
1143918653 17:10313435-10313457 GCATAGGGATAATTCAAGTTGGG - Intronic
1144679836 17:17185709-17185731 CCCCAGGAATCATTCAAAATGGG + Exonic
1145399840 17:22522510-22522532 CAATAGCGAAGATTCAAACTGGG + Intergenic
1145823739 17:27860626-27860648 CCTTAGTGATTATTCTAAATGGG + Intronic
1149573939 17:57697941-57697963 GCATGGGTATGATTCAAAGTGGG - Intergenic
1150941658 17:69699748-69699770 CCACATGTATGATTCAAAAGAGG - Intergenic
1151119965 17:71782039-71782061 CAGTAGGAATGCTTCAAAATTGG - Intergenic
1151362521 17:73597062-73597084 CCACAGGGATGATTCAGATGAGG - Intronic
1157121221 18:44913091-44913113 TCTTAGGGCTGAGTCAAAATGGG - Intronic
928037933 2:27843596-27843618 CCATAGAGATGAATATAAATAGG + Intronic
933121021 2:78538156-78538178 CCAAAAGCATGATTCAAAAAAGG + Intergenic
937308918 2:120889449-120889471 CCATAAGCATGATTCATAAAAGG + Intronic
937491455 2:122372167-122372189 ACAAAGAGATGATACAAAATGGG - Intergenic
938582936 2:132663678-132663700 CCATCTGATTGATTCAAAATGGG + Intronic
939336722 2:140838542-140838564 TCATAGTGATGATTCAATAAAGG - Intronic
939555909 2:143673105-143673127 GCATGGGGAAGATTCAATATTGG + Intronic
943716253 2:191155318-191155340 AGATAGGGTGGATTCAAAATCGG + Intergenic
944295566 2:198058034-198058056 TCAGAGGCATCATTCAAAATAGG - Intronic
947039865 2:225904820-225904842 CCATGGGTATTATTCAAAAGAGG - Intergenic
947050902 2:226042058-226042080 CAATAGGCATGATTTAACATAGG + Intergenic
947578754 2:231297883-231297905 CCAAAGGGATGATACAAGAAGGG - Intronic
947932162 2:233973143-233973165 CCATGGGGCTGATCCAAAGTTGG - Intronic
948472209 2:238190615-238190637 TCAGAGGGATGTTTGAAAATGGG + Intronic
1170004656 20:11652600-11652622 GAATAGGGATGATCAAAAATAGG - Intergenic
1174315283 20:49695151-49695173 CCATAGAGATTATGAAAAATTGG - Intronic
1178178659 21:30133443-30133465 ACAAAGAGATGATTTAAAATTGG - Intergenic
1178372270 21:32036205-32036227 CCATTGTGAAGGTTCAAAATGGG - Intronic
1179724502 21:43334283-43334305 CCCTTGGGAGGACTCAAAATTGG - Intergenic
950014818 3:9748070-9748092 CCCCAGGGATGATACATAATTGG + Intergenic
951839463 3:27018379-27018401 GCATAGTAATGACTCAAAATTGG + Intergenic
952082401 3:29775918-29775940 CCTTAGAGATCATTCAAATTAGG - Intronic
960221175 3:115110327-115110349 CCATAGGGATGATTCAAAATAGG + Intronic
969124667 4:4937837-4937859 CAAGAGGGATAATTCAAAACAGG + Intergenic
970100308 4:12514309-12514331 ACAAAGAGATGATTTAAAATTGG + Intergenic
972133635 4:35864851-35864873 TCACAGGGATGATTGAAAAAGGG - Intergenic
974615578 4:64275127-64275149 CCTTAGGGAAGACTGAAAATGGG + Intergenic
975081144 4:70281661-70281683 TCAGAGGGATAATTCAAAATAGG + Intergenic
979117830 4:116850026-116850048 CCCTAGGGATGATACAGCATGGG - Intergenic
979672526 4:123375269-123375291 CCAAAAGTATGATTCAAAAGAGG - Intergenic
980170147 4:129279675-129279697 TCATAGGGATTAATAAAAATGGG + Intergenic
980335009 4:131460834-131460856 TCAGAAGGATGAGTCAAAATCGG + Intergenic
980715919 4:136629671-136629693 TCACAAAGATGATTCAAAATTGG + Intergenic
980736161 4:136891832-136891854 CCATAGGTTTCATTCAAAGTAGG + Intergenic
982594318 4:157359571-157359593 CTATAGGAATAATTCAAATTAGG - Intronic
982729183 4:158937229-158937251 TCATGGAGATGATTCAAAACAGG + Intronic
983144498 4:164196942-164196964 CAATAGGAATTTTTCAAAATAGG + Intronic
984035862 4:174666924-174666946 TCATAGGGAGGATTCAAGCTAGG + Intronic
984804573 4:183739498-183739520 CCATAGTGAAGATACAGAATAGG + Intergenic
986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG + Intergenic
988420617 5:31001379-31001401 TTATAGGGATGATTCAAAAAAGG - Intergenic
990456929 5:55997051-55997073 CCAAAAGGATGAATCAATATTGG + Intergenic
992004224 5:72461725-72461747 CCCTAGGGCTGAATCAAATTGGG + Intronic
1000859483 5:166439137-166439159 ACAAAGGGATGATTTGAAATGGG + Intergenic
1004564650 6:16784736-16784758 CCAAAGGTATGATTAGAAATTGG + Intergenic
1004627373 6:17389659-17389681 GCAAAGGGATGATTCACAAATGG - Intergenic
1009004712 6:57769832-57769854 CCCTAGTGATGATTCTATATTGG + Intergenic
1009838678 6:69039007-69039029 TCAAAGGGATGATTCACATTTGG - Intronic
1013525357 6:110969016-110969038 TAACAGGAATGATTCAAAATGGG - Intergenic
1020425145 7:8056625-8056647 AGATAAGGATGATTCAACATTGG + Intronic
1020719335 7:11721727-11721749 CCATAGTGATATTTCAAAACTGG + Intronic
1021252918 7:18354149-18354171 CAGTAGGGCTGATTTAAAATAGG - Intronic
1024359970 7:48458234-48458256 GCACAGGAATGATTCAAAAGGGG + Intronic
1027826020 7:83117662-83117684 CCATGGGGGTGATGCAATATGGG - Intronic
1030180046 7:106697295-106697317 TCATAAGGATGGATCAAAATAGG - Intergenic
1034616826 7:152425063-152425085 CCATAGGCATGATTTACTATGGG + Intronic
1038692694 8:29777217-29777239 TCATAGGGCAAATTCAAAATAGG + Intergenic
1041681688 8:60599872-60599894 CCAAAAGGATGATTCATAAAAGG + Intronic
1044398498 8:91742540-91742562 CCAAAGGAAGGATTCAATATGGG - Intergenic
1045355277 8:101382454-101382476 CCATAGAGCTTCTTCAAAATTGG + Intergenic
1046186729 8:110731524-110731546 GCAGAGGGATGATTCATAACTGG + Intergenic
1047200161 8:122758498-122758520 CCAGCAGGATGATTCAAAAATGG + Intergenic
1047291192 8:123531837-123531859 CCAAAGAGATGATTCAACTTGGG + Intronic
1048451492 8:134537636-134537658 CCAGAGTGATATTTCAAAATGGG - Intronic
1051050938 9:12930682-12930704 CCTTAGGGAGGATTTAGAATTGG - Intergenic
1051122563 9:13767760-13767782 ACATAGTGATCATTCAAAAATGG + Intergenic
1053125551 9:35577871-35577893 CAATAGGGATGAAGCAAAAGAGG + Intergenic
1058014769 9:100018297-100018319 CTATAGGGATGTTTCAAAACCGG - Exonic
1058064645 9:100535412-100535434 TAAAAGGGATGATTCAAAAAAGG - Intronic
1058326151 9:103700437-103700459 ACAGAGGGATCATTCAAAAGTGG + Intergenic
1185956217 X:4493746-4493768 CCAAAGGGAAGATTAAAAATAGG + Intergenic
1190031706 X:46979501-46979523 CCATATGGATGACTCATGATGGG - Intronic
1193371961 X:80709363-80709385 CCAAATGGATGATACAAACTGGG + Intronic
1193666272 X:84322092-84322114 CCATAAGGATAATTCACCATGGG - Intronic
1194821670 X:98515068-98515090 CCATCGGGAAGATTAAATATGGG - Intergenic
1195637357 X:107133197-107133219 TAACAGGAATGATTCAAAATGGG - Intronic
1198304719 X:135369000-135369022 TCACAGAGATGATTTAAAATAGG - Intergenic