ID: 960221531

View in Genome Browser
Species Human (GRCh38)
Location 3:115116261-115116283
Sequence TAATATGCCCAGATAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960221531 Original CRISPR TAATATGCCCAGATAGAGCT GGG (reversed) Intronic
902586660 1:17443400-17443422 TAAAATGGCAAGATAGAGTTTGG + Intergenic
905929146 1:41774587-41774609 TAATCTGCACAGATAGCCCTAGG - Intronic
908417023 1:63923192-63923214 TAATATACCCACAGAGTGCTGGG + Intronic
910086538 1:83409977-83409999 TAAGGTGGCCGGATAGAGCTTGG - Intergenic
912816987 1:112837395-112837417 TAGTATGCCCAGAGAGAGCACGG - Intergenic
916601652 1:166298990-166299012 TCATATGCCTAGTTGGAGCTGGG - Intergenic
916722944 1:167498585-167498607 TAATGGGCCCAGATGGAGCTAGG - Intronic
917376581 1:174354110-174354132 TGATCTGCCCAGTTAGAGATGGG + Intronic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
922056485 1:222046664-222046686 TAATAGGCCTAGCTAGAGTTAGG + Intergenic
922125435 1:222716392-222716414 TAAAATGTCCCTATAGAGCTGGG - Intronic
923879176 1:238084669-238084691 ATATATGCCCAGAAAGACCTGGG - Intergenic
1066808604 10:39293215-39293237 GAATCTGCACAGATATAGCTGGG - Intergenic
1067076150 10:43184323-43184345 TAATGTTCCCAGACAGAGCTAGG - Exonic
1067985116 10:51135244-51135266 TAATATGCCAAGCAAGATCTGGG + Intronic
1071793866 10:88985131-88985153 TGATATGCCCAGATAGATTCTGG - Intronic
1072848557 10:98860560-98860582 TAATATGCCCATTTACAGATGGG + Intronic
1081601017 11:44494280-44494302 TACTGTGCCCTGATAGAGATGGG + Intergenic
1084839966 11:71838456-71838478 GATTATGCCCAGAAAAAGCTGGG - Intergenic
1085058544 11:73423598-73423620 TAATATTACCAGATGGAGTTTGG - Intronic
1085148160 11:74222782-74222804 CAAAATGCCCAAATCGAGCTGGG - Intronic
1085848922 11:80097717-80097739 AAATATTCCCATATAGAGTTAGG + Intergenic
1090872915 11:130763665-130763687 TAATGTGCCAACATAGAACTGGG + Intergenic
1090972847 11:131657685-131657707 TGATATGCTGAGATAGTGCTGGG - Intronic
1091160708 11:133417042-133417064 TAAGGTGCCCAGAGAGAGCAGGG + Intronic
1096058838 12:48679702-48679724 TCATATGCTAAGACAGAGCTGGG - Exonic
1096329508 12:50698183-50698205 AAATATGCCAAATTAGAGCTGGG - Intronic
1097611466 12:61827009-61827031 TTATATGCCCAGCTAAAGATTGG - Intronic
1099248235 12:80219734-80219756 TAATATGTCAAGATATAGCTTGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1109387440 13:61650593-61650615 TAATAGGCCCAGTGAGAGGTGGG + Intergenic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1119076838 14:71648603-71648625 TAATATTCCCAGTGAGATCTGGG + Intronic
1120228800 14:81820652-81820674 AAATATGGCCAGATAGAGGCAGG - Intergenic
1127151977 15:56085164-56085186 AAATATGCTCAGATATAGCTTGG + Intergenic
1128950062 15:71869961-71869983 TCACATGCCCAGATAGGGCTTGG - Intronic
1130707604 15:86247948-86247970 GAATCATCCCAGATAGAGCTGGG + Intronic
1131984548 15:98028948-98028970 TAATATATCCAGACAGAACTTGG + Intergenic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1136742683 16:32552462-32552484 TAATATCCCCAGATAAAGCTAGG + Intergenic
1203026915 16_KI270728v1_random:522766-522788 TAATATCCCCAGATAAAGCTAGG - Intergenic
1203044806 16_KI270728v1_random:811665-811687 TAATATCCCCAGATAAAGCTAGG + Intergenic
1147521658 17:41178988-41179010 TCATGTGCCCTGTTAGAGCTAGG - Intergenic
1147619645 17:41857033-41857055 TAAAAAGCACATATAGAGCTGGG + Intronic
1148740812 17:49891236-49891258 TAATAGCCCCAGTTACAGCTGGG - Intergenic
1149149948 17:53550040-53550062 TAATAGGTACAGATAGAGATGGG - Intergenic
1149810433 17:59664639-59664661 TAAGGTGCCCAGTTAGACCTTGG - Intronic
1151035816 17:70797838-70797860 TAATATTGCCAAATAAAGCTTGG - Intergenic
1155617334 18:27737508-27737530 TAATATGCCCACATGGGGATGGG - Intergenic
1156470300 18:37373636-37373658 TAATGTGCCCAGAGCGAGCCAGG + Intronic
929923047 2:46186686-46186708 TATTATACCCTGATAGAGATGGG + Exonic
934736809 2:96693843-96693865 TGAGAAGCCCAGACAGAGCTGGG + Intergenic
938649723 2:133370231-133370253 AAATATGACCAGAAAGAGCTTGG + Intronic
939685096 2:145189279-145189301 GAAAATGCCTAGATAGGGCTGGG + Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940549633 2:155137428-155137450 GAAAATGCCTAGATAGAGATAGG - Intergenic
942340893 2:174945231-174945253 TAATATCCCCACAAAGAACTGGG - Intronic
1170450666 20:16480147-16480169 TATAATGCCCAGATAGAGGCTGG + Intronic
1170927745 20:20741328-20741350 TGGTGTGCACAGATAGAGCTGGG - Intergenic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1175656157 20:60772836-60772858 CCTCATGCCCAGATAGAGCTGGG - Intergenic
1178268682 21:31168811-31168833 TAATACCCAGAGATAGAGCTTGG + Intronic
1180995391 22:19962929-19962951 GGATATGCCCAGATAGGGCTGGG + Intronic
1182760111 22:32715946-32715968 GAATGAGCCCAGAAAGAGCTAGG + Intronic
1183474787 22:38030214-38030236 GAAGATCCCCAGATAGGGCTGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949602755 3:5618678-5618700 TCATATTCACAGATAGACCTTGG + Intergenic
950742723 3:15063202-15063224 TAATCAGCCCAGTTAGACCTGGG - Intronic
953477518 3:43218229-43218251 CAATAACCCCAGATAGAGCATGG - Intergenic
955808204 3:62758669-62758691 GGATGTGCCCAGATAGAACTGGG - Intronic
958626701 3:96634824-96634846 TAAGCTGTCCAGATAGAGATAGG - Intergenic
959857496 3:111176110-111176132 TCATATGGCCAAATAGAGTTTGG - Intronic
960221531 3:115116261-115116283 TAATATGCCCAGATAGAGCTGGG - Intronic
964548523 3:157861060-157861082 ATATAAGCCCAGATAAAGCTGGG - Intergenic
964661123 3:159121427-159121449 TAATATGCTCAGCTTAAGCTGGG - Intronic
965154744 3:165035125-165035147 TAATCTGCCAAGATAGAACTTGG - Intronic
965665208 3:171086389-171086411 TAACATTTCCACATAGAGCTGGG + Intronic
965983569 3:174723458-174723480 AGAAATGCCCAGATAGGGCTGGG + Intronic
970142302 4:12995939-12995961 TAGTATCCTCAGAAAGAGCTAGG - Intergenic
970716293 4:18928878-18928900 GAATATGCCAAGTTACAGCTGGG - Intergenic
972707440 4:41559071-41559093 TAATTTGGCAGGATAGAGCTGGG + Intronic
980985316 4:139689468-139689490 TAATATGCTCAGAAAAGGCTTGG - Intronic
981374940 4:144004025-144004047 TAACATGCCCAGATGGGACTTGG - Intronic
988285576 5:29212214-29212236 TAATATTCACAAATAGAACTCGG + Intergenic
988438848 5:31208982-31209004 TGGCATGCTCAGATAGAGCTGGG - Intronic
990640601 5:57779621-57779643 TAAAATGCTCAGGAAGAGCTAGG + Intergenic
992017829 5:72593940-72593962 TTCTATGCCCAGATAAAGCCAGG + Intergenic
1004265876 6:14148240-14148262 TAATAGACCCAGAAAGACCTGGG - Intergenic
1006326861 6:33360793-33360815 TAATATCCTCAGATTGATCTGGG + Intergenic
1010964454 6:82187786-82187808 TAATATGACCATATGGAGATAGG - Intronic
1014607271 6:123492507-123492529 TATTAAGCCCAGATAGAAGTTGG + Intronic
1014780948 6:125563969-125563991 TTATATTCCCAGAGAGAACTGGG + Intergenic
1014956777 6:127629112-127629134 TAATATGTCCATAGAGAACTTGG - Intergenic
1024841887 7:53596245-53596267 TGATATGCCCAGATTGAATTTGG - Intergenic
1027303417 7:76866464-76866486 TAAGGTGGCCAGATAGAGCTTGG - Intergenic
1028373400 7:90119520-90119542 TCATAATCCCTGATAGAGCTGGG - Intergenic
1030187263 7:106776245-106776267 TAATAATCCCAGAAAGGGCTTGG + Intergenic
1036647335 8:10619629-10619651 TAAGATGCCGAGAGAGGGCTGGG + Intronic
1041487735 8:58397255-58397277 AAAAATGACCAGATAGAGCAGGG - Intergenic
1042997058 8:74712280-74712302 TATTATGACTAGATAGAGCATGG + Intronic
1043115244 8:76243869-76243891 TAATATGGATAGATAGAGTTGGG - Intergenic
1044185668 8:89248580-89248602 AAATATGCCAAGATTGAACTAGG - Intergenic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1047532859 8:125693160-125693182 TCTTATGCCCAGATAGGGATTGG - Intergenic
1047798956 8:128288887-128288909 TGATAAGCCCAGATAGAGACAGG - Intergenic
1048778462 8:137974228-137974250 TAAGATGCAAAGAAAGAGCTTGG - Intergenic
1049004366 8:139845465-139845487 TAATATGCCCAGCTAAATATTGG - Intronic
1053560678 9:39190765-39190787 TAAAAGGCTCAGAGAGAGCTTGG + Intronic
1054136441 9:61428190-61428212 TAAAAGGCTCAGAGAGAGCTTGG - Intergenic
1055530405 9:77177778-77177800 CCAGATGCCCAGAGAGAGCTGGG - Exonic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1059077679 9:111211344-111211366 TAATATTCCCAAATTAAGCTGGG - Intergenic
1060230705 9:121823054-121823076 TAAAATGCCCAGCTAGTGCCTGG - Intronic
1192420978 X:71030180-71030202 TAATCTACCCTGAGAGAGCTAGG - Intergenic
1194381622 X:93198923-93198945 TCATGTGCCCAGCTAAAGCTGGG + Intergenic
1195034368 X:100958318-100958340 TAATGTTCCCAGACACAGCTAGG - Intergenic
1195619619 X:106939887-106939909 TCATATGGCAAGCTAGAGCTGGG + Intronic
1200411257 Y:2864160-2864182 TAAGATGCTCAGATTGAGTTGGG + Intronic