ID: 960222946

View in Genome Browser
Species Human (GRCh38)
Location 3:115137296-115137318
Sequence TTTTAGTACCTTGTATACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960222946 Original CRISPR TTTTAGTACCTTGTATACAA AGG Intronic
901309805 1:8260594-8260616 TTTTAATATCATGTATACAGTGG + Intergenic
902675231 1:18003998-18004020 CTTGAGTACTTTGTATACACTGG - Intergenic
904957726 1:34299387-34299409 TTTTAGAACTTTATATACATGGG + Intergenic
906029633 1:42708084-42708106 TTTGAGTTCCTTGTATACTCTGG + Intergenic
906998118 1:50820055-50820077 TTTAAGTACCTCATATAAAAAGG - Intronic
909123278 1:71632376-71632398 TTTGAGTACATAGTAAACAATGG - Intronic
910030120 1:82709729-82709751 TTTTATAACACTGTATACAAAGG - Intergenic
912283246 1:108340176-108340198 GTTAGGAACCTTGTATACAAGGG + Intergenic
915986042 1:160465760-160465782 TTTGAGTACCTTGTATATTCTGG + Intergenic
917449531 1:175135639-175135661 TCTTAGTACCTGGCATACTACGG + Intronic
917679840 1:177354644-177354666 TTTTAGAGCCTTGTTTGCAACGG - Intergenic
917698260 1:177552219-177552241 TTTGCGTACCTTGTATATTATGG + Intergenic
917729474 1:177860289-177860311 TTTAAGGACCTTGTATAGATTGG - Intergenic
917982924 1:180283571-180283593 TTTTAGGACCAGGAATACAAAGG + Intronic
918175674 1:182042623-182042645 TTTAAGGACCTTGAATAAAATGG - Intergenic
919353036 1:196484393-196484415 TTTTAGTTCCTTGTAAATTATGG + Intronic
920862000 1:209717171-209717193 TTTGAGTACCTTGTATATTCTGG - Intronic
921059607 1:211573242-211573264 TTTAAGTAGCTTATATATAATGG - Exonic
921809399 1:219495360-219495382 TTCAAGTCCCTTGTATAAAATGG + Intergenic
922373221 1:224932327-224932349 TTTCAGTTCCTTGTATATTATGG + Intronic
924014515 1:239705849-239705871 TTTTATCACCTTGTACACACTGG - Intronic
924897429 1:248356911-248356933 TTTTAATAGCTTATGTACAAAGG - Intergenic
1065562463 10:26977638-26977660 ATTGATTGCCTTGTATACAATGG + Intergenic
1065667052 10:28073787-28073809 TTTTTTTACCTAGTCTACAAGGG + Intronic
1065793814 10:29287218-29287240 TTTTAGTACCATGTGTTAAATGG + Intergenic
1067707412 10:48619967-48619989 TTTGAGTTCCTTGTATATAATGG - Intronic
1068457475 10:57275787-57275809 TTTGAGTACCTTGTATATTCTGG - Intergenic
1068695953 10:59968356-59968378 TGTTGGAATCTTGTATACAAGGG + Intergenic
1068736648 10:60420760-60420782 TTTTATTCCCTTTTATAAAAGGG - Intronic
1068870508 10:61938635-61938657 TTTGAGTACTTTATAAACAATGG - Intronic
1069307457 10:66988708-66988730 TTTTAGTTCCTAGTATTCAGAGG - Intronic
1069665964 10:70158793-70158815 CTTTAGTAACTTTTATAAAATGG + Intronic
1071277896 10:84072896-84072918 TTTGAGTACCTTGTATATTCTGG - Intergenic
1071728601 10:88224606-88224628 TTTTTGTTCCTTATATCCAAAGG + Intergenic
1074181207 10:111065849-111065871 TTTGAGTTCCTTGTATATTATGG - Intergenic
1074581681 10:114725042-114725064 ATTTAATACCATGTTTACAAAGG + Intergenic
1075026260 10:118985753-118985775 TTTTAGCACCTTGAATATATTGG - Intergenic
1075529446 10:123215881-123215903 CTTAAGTCCCTTATATACAATGG + Intergenic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1080506312 11:32917508-32917530 TTTTAGTATCTTGTGTTCAATGG - Intronic
1081275301 11:41140970-41140992 TATTTTTACCTTTTATACAACGG + Intronic
1084136434 11:67186342-67186364 TTTTAGCACTTTGAATACACTGG - Intronic
1085798230 11:79563347-79563369 TTTTATTACCTTTTCTAAAAGGG + Intergenic
1086534951 11:87833296-87833318 TTGTAGTTTCTTGTATAGAACGG + Intergenic
1087457247 11:98402775-98402797 TTTTAGCACCATATACACAATGG + Intergenic
1089706097 11:120278954-120278976 TTATAGTATCTTGACTACAATGG - Intronic
1090691047 11:129182360-129182382 TTTTAGTTCTTTGTATATCAAGG + Intronic
1091164637 11:133464338-133464360 TTTTTGTCCCTAGGATACAATGG + Intronic
1091363582 11:134998544-134998566 TTTTAGTATATTGTATGAAAGGG - Intergenic
1092519414 12:9252465-9252487 TTTAAGTTCCTTGTAGACACTGG - Intergenic
1093954360 12:25199426-25199448 TTTTAGTATATAGTATACTATGG - Intronic
1094728568 12:33148051-33148073 TTTAAGTTCCTTGTAGACACTGG + Intergenic
1098478188 12:70929948-70929970 TTATAGTACTTTTTACACAATGG - Intergenic
1098650275 12:72957910-72957932 TTTTCTTATGTTGTATACAAAGG + Intergenic
1099107360 12:78513174-78513196 ATTTACTATCTTATATACAAAGG - Intergenic
1100528888 12:95446492-95446514 TGTGTGTCCCTTGTATACAAAGG - Intergenic
1100890306 12:99118292-99118314 TTCTATTACCTTGTCCACAATGG + Intronic
1101096045 12:101342061-101342083 TTTAAGTCCCTTATATAAAAAGG - Intronic
1101225418 12:102683240-102683262 TTAAAGTACCTTGTACACAATGG - Intergenic
1102521230 12:113478593-113478615 TTTTAACACCTTCTAAACAAAGG - Intergenic
1107171226 13:37344008-37344030 TTTTAGTAGCTTTTACACCATGG + Intergenic
1107319733 13:39173158-39173180 TTTGAGTTCCTTGTATAGTATGG + Intergenic
1108140999 13:47421238-47421260 TTTTAATCCATTGTATACATGGG - Intergenic
1111865901 13:93768463-93768485 TTTTAGGACCTGGAATACAGTGG - Intronic
1114379158 14:22182650-22182672 TTTTTGTACCAAATATACAATGG - Intergenic
1114679116 14:24469179-24469201 TTTTAGTTCCTTGTATATTCTGG - Intergenic
1115053723 14:29096411-29096433 ATTTTCCACCTTGTATACAATGG + Intergenic
1115305008 14:31924600-31924622 TTTTAGTACCTGGTATAGTGTGG - Intergenic
1115348787 14:32370661-32370683 TTTTACTACACTGTAAACAATGG + Intronic
1116429528 14:44829797-44829819 TTTTAGCATCTTGTCTATAATGG - Intergenic
1116500099 14:45610528-45610550 TTTTAGTACATTGTGCACACTGG + Intergenic
1116650865 14:47591122-47591144 TTTTAGTACCAGCTTTACAAAGG + Intronic
1118235531 14:64001073-64001095 TATTAGGACCTTGTATACATAGG + Intronic
1118291836 14:64533584-64533606 TTTTAGTATATAGTATAAAATGG + Intronic
1118629768 14:67692026-67692048 TTTTATTAGCTTCTATACTATGG + Intronic
1120575060 14:86171705-86171727 TTTGAGTTCCTTGTAGACTATGG - Intergenic
1120696558 14:87651404-87651426 TTTTAATATTTTGAATACAAGGG - Intergenic
1121420913 14:93813344-93813366 GTTTACTACCTTATTTACAAAGG - Intergenic
1122714477 14:103686494-103686516 TTTTAGTTATTTGTATAGAATGG + Intergenic
1202848245 14_GL000009v2_random:201026-201048 TTCAAGTGCCTTGTATAGAATGG - Intergenic
1123769362 15:23513046-23513068 TTGTTCAACCTTGTATACAAGGG - Intergenic
1126054636 15:44718552-44718574 TTTAAGTCCCTTCTATAAAATGG + Exonic
1126531735 15:49718244-49718266 TTATACTACTTTGTATCCAAAGG + Intergenic
1129012763 15:72437863-72437885 TTTTAGCACTTTGAATATAATGG + Intergenic
1131416626 15:92265436-92265458 GTTTTGTACTTTGTATAAAATGG - Intergenic
1131610513 15:93956286-93956308 TTTTAGTAGTTTGTCTATAAAGG - Intergenic
1134473242 16:14547359-14547381 TTTTAGTAGTTAGTATAAAAAGG + Intronic
1138822071 16:60272927-60272949 ATAAAGTACCTTGTACACAATGG - Intergenic
1139145214 16:64315625-64315647 ATTCAGTACTTTGTATAGAAAGG - Intergenic
1140626546 16:76801805-76801827 TTTTGGTTCCTGGTTTACAATGG + Intergenic
1141078763 16:81032674-81032696 TTTTAACATCTTGGATACAATGG - Exonic
1147350645 17:39840358-39840380 TTTTATGGCCTTTTATACAAGGG - Intronic
1150615998 17:66772085-66772107 TTTTATAACCTTTGATACAATGG - Intronic
1150934579 17:69621676-69621698 TTTGAGTTCCTTGTATACTCTGG + Intergenic
1156272000 18:35544086-35544108 CTTCATTACCTTGTAGACAAAGG - Intergenic
1156572671 18:38276684-38276706 TTCTAGTTCCTTTTATACCATGG + Intergenic
1158765152 18:60441886-60441908 TTTAAGTTCCTTGTAGACACTGG + Intergenic
1159162281 18:64658176-64658198 TTTTAGAACATTATATATAATGG - Intergenic
1164072605 19:21782235-21782257 TTTTAGTATTTTGTATATTAGGG + Intergenic
1202675290 1_KI270710v1_random:39630-39652 TTCAAGTGCCTTGTATAGAATGG - Intergenic
925135371 2:1522735-1522757 TTTGAGGACCTTGCATACAGTGG - Intronic
926004482 2:9362449-9362471 TTTTAGTATGTTGTATACATTGG + Intronic
926260216 2:11253202-11253224 ATTTAGGACCCTGTAGACAATGG - Intronic
926435881 2:12837367-12837389 GTTTTGTATATTGTATACAAAGG + Intergenic
929481726 2:42314409-42314431 TTTTAGTAACTTGTAAGCTATGG + Intronic
930341494 2:50121514-50121536 TTTAAGTCCCTTATATAAAATGG - Intronic
930364735 2:50424812-50424834 TTTTCTGACCTTGTATACACTGG + Intronic
930435700 2:51338952-51338974 TTTTAGTATCTTAAAAACAAAGG - Intergenic
930552758 2:52855959-52855981 TTTGAGTTCCTTGTATACTCTGG - Intergenic
931017142 2:57996128-57996150 TTTAAGTCCCTTGTATAAAATGG - Intronic
931017194 2:57996752-57996774 TATAAGTCCCTTGTATAAAATGG + Intronic
932308562 2:70721396-70721418 TTTTTGAACCATGTATACTAAGG + Intronic
932706182 2:74026578-74026600 TTTTAATATCTATTATACAAGGG - Intronic
932825067 2:74931669-74931691 TTTTAGGGCTTTGTATACTAGGG + Intergenic
934116431 2:88800674-88800696 CTTTAGTAAATTGTATCCAATGG - Intergenic
935964201 2:108456560-108456582 TTTGAGTTCCTTGTATACTCTGG + Intronic
937734639 2:125274884-125274906 TTTTAATGCCTTGTAAATAAGGG + Intergenic
938816057 2:134905417-134905439 TTTAAATACCTTTTATACACTGG - Intergenic
939065261 2:137476185-137476207 TTTGAGTTCCTTGTATATACTGG + Intronic
939820522 2:146951576-146951598 TATTATTACATTGTATACAATGG - Intergenic
940111997 2:150165238-150165260 TTTTATTATCTTTTATTCAAGGG + Intergenic
940498087 2:154459121-154459143 TTGCAGTACCTTTTATTCAAGGG - Intergenic
940723994 2:157314238-157314260 TCTTGTTACCTTGAATACAAGGG + Intergenic
941968670 2:171326148-171326170 TTTTAATACTTTGTTTCCAAAGG - Exonic
942267645 2:174244509-174244531 ATTGAGTCCCTTATATACAATGG + Intronic
943391706 2:187277864-187277886 TTTGAGTTCCTTGTAGACGATGG - Intergenic
943469603 2:188277119-188277141 TTTTTATACTATGTATACAATGG - Intergenic
943629834 2:190238839-190238861 TTTAAGTACCTTGTAGACTCTGG + Intronic
944165299 2:196713020-196713042 TTTTAGTTCCTTGGTTACCAGGG - Intronic
944167426 2:196737800-196737822 TTTAAGTTCCTTGTAGACTATGG + Intronic
945865996 2:215176509-215176531 TTTTAGTTCCTTGTATATTACGG + Intergenic
946473506 2:219985225-219985247 AATTATTAACTTGTATACAAGGG + Intergenic
946787506 2:223263298-223263320 TTTTACTACCTTGTCCACCAGGG + Intergenic
948967043 2:241390699-241390721 TTTTATTAATTTTTATACAAAGG + Intronic
1171478667 20:25435178-25435200 TTTTAGTACTTTGAATATATTGG + Intronic
1171805197 20:29672178-29672200 TTTAAGTACCTTGTAGACTCTGG + Intergenic
1172029674 20:31973033-31973055 TTTTGGTCCCTAGTTTACAACGG - Intronic
1172731450 20:37092234-37092256 ATTTAGTAGCCTGTATCCAAAGG - Intronic
1174372126 20:50097918-50097940 TTTGAGTACTTAGTATACATCGG + Intronic
1176874039 21:14108503-14108525 TTTTAGTCCTTTGTAAATAATGG - Intergenic
1177753199 21:25311942-25311964 TTTGAGTTCCTTATATACATTGG - Intergenic
1178526521 21:33334416-33334438 TTTTAGCACTTTGAATACACTGG - Intronic
1178811338 21:35884924-35884946 TTTAAGTTCCTTGTAGACCATGG - Intronic
1178831638 21:36061268-36061290 CTCAAGTCCCTTGTATACAATGG + Intronic
1179196525 21:39169331-39169353 GTTTAGTACCATGTTGACAAAGG + Intergenic
1180075925 21:45462066-45462088 TTTTAGTACATTGAATATATTGG + Intronic
1181942928 22:26492731-26492753 TTTTAGTACCTTGAAAACATAGG + Exonic
1184131723 22:42520431-42520453 TTTTTGTACCTAGTAGACACGGG - Intergenic
950787698 3:15449878-15449900 TTTTAGGACCTTGTTTAGGATGG - Intronic
952968989 3:38638809-38638831 TTTTAGGACCATGTACACAATGG - Intronic
953346455 3:42179798-42179820 TTTTAATACCTTATTTCCAAGGG + Intronic
954820506 3:53322617-53322639 TTTTCCTACCCTGTTTACAAAGG + Intronic
955756914 3:62234070-62234092 TTTTATCTCCTTGTACACAATGG + Intronic
956538398 3:70305998-70306020 TTTTGGCACCTTGAATACACTGG - Intergenic
957104106 3:75864727-75864749 TTCAAGTGCCTTGTATAAAATGG - Intergenic
957562426 3:81839830-81839852 TTTTAGTACCTTATGTAAGATGG + Intergenic
957666018 3:83228493-83228515 TTTTAGTAATTTCTATAAAAGGG - Intergenic
959565563 3:107829248-107829270 TTTTTCCACCTTGTCTACAATGG - Intergenic
960222946 3:115137296-115137318 TTTTAGTACCTTGTATACAAAGG + Intronic
960645538 3:119877632-119877654 ACATAGTTCCTTGTATACAAGGG - Intronic
962609301 3:137060278-137060300 TTTAAGTCCCTTATATAAAATGG - Intergenic
962890611 3:139669299-139669321 TTTTTGTACCTTGTAGAGATGGG - Intronic
963271288 3:143288463-143288485 TTTTCTTGCTTTGTATACAAAGG + Intronic
963557717 3:146814235-146814257 TTTTAGTACCATGTAATTAAGGG - Intergenic
964063151 3:152549934-152549956 TTTTAGTTCTTTATATAAAATGG + Intergenic
965188083 3:165490851-165490873 TTCTAGAACCTTGTATATCATGG - Intergenic
969117472 4:4880249-4880271 TTTTCGTTCCTTGTAAAAAATGG - Intergenic
972060141 4:34859466-34859488 TTTTTTTACATTGTATAAAAAGG - Intergenic
972544132 4:40064187-40064209 TTTTCGTACCTGGAATACACAGG - Intronic
972976213 4:44640027-44640049 ATTTAGTAGGTTTTATACAAGGG - Intronic
973656830 4:53056747-53056769 TTTTAGATCCTTGTATAAATTGG + Intronic
974310568 4:60203980-60204002 TTTTACTACTTTGGATATAAAGG + Intergenic
974436959 4:61869112-61869134 TTTTTGTACTTTTTATACAAAGG + Intronic
974639830 4:64614049-64614071 TTTTTATACCTGGTATACTATGG - Intergenic
975929109 4:79496446-79496468 CTTAAGTACCTTATATAAAATGG - Intergenic
977999721 4:103542581-103542603 TTTAAGTTCCTTGTAGACACTGG - Intergenic
978791702 4:112669688-112669710 TTTTAGTATTTTGTAGAGAAGGG + Intergenic
979506587 4:121503981-121504003 TTTGAGTACCTTGTAGACTCTGG + Intergenic
979909026 4:126336521-126336543 TTTGAGTTCCTTGTATATATTGG - Intergenic
980423978 4:132600816-132600838 TTTTGGTACCGTGTATTCTATGG - Intergenic
981189857 4:141849825-141849847 TTTCATTACCTTGAATACAATGG + Intergenic
982850601 4:160310578-160310600 CTCAAGTCCCTTGTATACAATGG - Intergenic
983740481 4:171125361-171125383 TTTTAGTTCCTTGTATATTTTGG + Intergenic
984894305 4:184523320-184523342 TTTAAGTACCTTGTATATGTTGG + Intergenic
986948889 5:13058119-13058141 TTTTAATTTCTTGTAGACAAAGG + Intergenic
987879151 5:23719366-23719388 TTTTAATATCTTGTATATATTGG + Intergenic
988357301 5:30194974-30194996 ATTTATTATCTTTTATACAAAGG + Intergenic
989260073 5:39408975-39408997 TTTTCGTTTTTTGTATACAAGGG + Intronic
989518290 5:42370099-42370121 TTTTATTACCATGTACACAATGG - Intergenic
990103363 5:52221324-52221346 TTTGAGTTCCTTGTAGACACTGG + Intergenic
991392694 5:66165350-66165372 TTTCAGTACCACGTATCCAAAGG + Intronic
992251708 5:74882744-74882766 TTTGTTTAACTTGTATACAAAGG - Intergenic
992306552 5:75445831-75445853 TTTTAGCACTTTGAATACATTGG + Intronic
992534406 5:77684279-77684301 TTTTAGGACTTTGTAAACCAAGG - Intergenic
992974287 5:82097592-82097614 TTTTAATACCTATAATACAATGG - Intronic
994767294 5:103934983-103935005 TTTCAGTTCCTTGTATAAAATGG + Intergenic
994980458 5:106868543-106868565 TTTTAGTAACTTGTACAAAACGG + Intergenic
995975036 5:118024673-118024695 TTTTACTGTCTTATATACAAGGG - Intergenic
996157910 5:120126306-120126328 TTTTATTACTTTGAATAGAATGG + Intergenic
996537165 5:124590384-124590406 TTTTAGTACATCCAATACAATGG - Intergenic
996957915 5:129207611-129207633 TTTTAGTTTCTTGTATATATTGG + Intergenic
1000809265 5:165840385-165840407 TTTAAGTACCTTGTAGACTGTGG + Intergenic
1001609027 5:172984877-172984899 TCATAGTACCTTGTATGCACAGG + Intronic
1001716457 5:173820241-173820263 TTTTAGTTACTTGCATCCAAAGG + Intergenic
1005147252 6:22705768-22705790 TTTTAGTGCTTTGATTACAAGGG - Intergenic
1008182087 6:48343430-48343452 TTTTTGTATTTTGTATAGAAGGG + Intergenic
1008963077 6:57286878-57286900 TTTAAGTACCTTGTAGACTCTGG - Intergenic
1009284795 6:61803345-61803367 TTTTAATACCTTTTCTTCAAAGG - Intronic
1010795011 6:80108209-80108231 TCTTAGTACATTGTTTAGAATGG - Intronic
1011027855 6:82888638-82888660 TTATTGTACCTTGTAACCAAAGG + Intergenic
1011552621 6:88543882-88543904 TATTATTACCTTGTGTCCAAAGG - Intergenic
1012084128 6:94801730-94801752 TTTTTGTATTTTGTATACAGTGG + Intergenic
1012684564 6:102229426-102229448 TTTTATTAGCTTGTGCACAAGGG + Intergenic
1013384129 6:109607555-109607577 TTCAAGTTCCTTGTATAAAATGG - Intronic
1014059643 6:117056193-117056215 TTTGAGTTCCTTGTATACTCTGG + Intergenic
1016351124 6:143169257-143169279 ATTAAGTAGCTGGTATACAAAGG - Intronic
1016658411 6:146545876-146545898 TTTTAAAACCTTGCTTACAAGGG + Intronic
1016811608 6:148266502-148266524 TCTTAGCACAATGTATACAAAGG + Intergenic
1017053596 6:150417915-150417937 TCTTAGCACCTTGTAAACAGAGG + Intergenic
1017287934 6:152699440-152699462 TTCTAGTACATTGTAAAGAAAGG + Intronic
1020902058 7:14016472-14016494 TTTTGGTACATTGAATACACAGG - Intergenic
1021865484 7:24952572-24952594 TTTGAGTACCTAGTCTCCAAAGG - Intronic
1022883365 7:34614349-34614371 TTTTAGTACTTTGAATATATTGG - Intergenic
1024199610 7:47092308-47092330 TTTGAGTTCCTTGTATACCTTGG - Intergenic
1024711275 7:52017813-52017835 TTTTAGTCATATGTATACAAAGG - Intergenic
1027591339 7:80122830-80122852 TTTTGGTCCCTTATATCCAAGGG - Intergenic
1028019060 7:85748705-85748727 TTTTACTACCTTGAATGGAAGGG - Intergenic
1029793443 7:102869346-102869368 TTTGAGTTCCTTGTATACTCTGG + Intronic
1030020012 7:105264310-105264332 TTTTGGTGCCTCGTATGCAAAGG - Intronic
1030542011 7:110842726-110842748 CTAAATTACCTTGTATACAAAGG + Intronic
1031043107 7:116859601-116859623 TATTAGTATTTTGTATACAGTGG - Intronic
1033455215 7:141496861-141496883 TATCAGTACATTGAATACAATGG - Intergenic
1037113384 8:15194124-15194146 TTTTAGTACTTCTTATCCAATGG + Intronic
1038179917 8:25217912-25217934 CTTTATTACCTTTTATTCAAAGG + Intronic
1039937661 8:42061129-42061151 TTTTAGTACATTGTCTTCCAAGG - Intergenic
1040675746 8:49747582-49747604 CTTTAGTACTTTGAATACATTGG - Intergenic
1040722675 8:50345195-50345217 CTTCTGTACCTTTTATACAATGG + Intronic
1041366931 8:57116340-57116362 TTTAAATACCTGGAATACAAGGG + Intergenic
1041473000 8:58231878-58231900 TTTTTGTACTTTGTATAGAGAGG + Intergenic
1041880053 8:62738697-62738719 TTTAAGTTCCTTGTAGATAATGG + Intronic
1041928108 8:63258302-63258324 ATTTAATACATTGTATCCAATGG + Intergenic
1042292140 8:67180005-67180027 TTTTACTACCTTGTACAACAAGG - Intronic
1042658464 8:71127451-71127473 CTGAAGTACCTTGTATACCATGG + Intergenic
1043156576 8:76788767-76788789 TTTTAGTTCTTTGTATACAAAGG + Intronic
1043380787 8:79699958-79699980 TTCTATTAACTTGTAGACAAAGG - Intergenic
1043887355 8:85616948-85616970 TTTTAGTACAATATATAAAATGG - Intergenic
1044185559 8:89246741-89246763 TTTTAGTTCCTTGAATATTATGG + Intergenic
1044736205 8:95281313-95281335 TTTTAGTACTTTGAATATATTGG + Intergenic
1045575221 8:103413349-103413371 TATAAGTACCTGTTATACAATGG - Intronic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1047179380 8:122572619-122572641 TTTTCTTACTTTGTATATAAAGG + Intergenic
1047756236 8:127920719-127920741 GTTTAGTACTTTGGATAGAATGG + Intergenic
1047973874 8:130110570-130110592 TTTTAGTACAATGTATGGAATGG + Intronic
1048820158 8:138372995-138373017 TCTTAGAACCTTGTGGACAAGGG - Intronic
1050439291 9:5643581-5643603 TTTAAGCACCTTGCATAAAAAGG - Intronic
1051199921 9:14606048-14606070 TTTTATTACCTTGTTTAGAAAGG - Intergenic
1051244791 9:15098960-15098982 TTTGAGTACCTACTATACATGGG - Intergenic
1051303761 9:15684873-15684895 TTTTAGTCCCCTGTTTACACTGG + Intronic
1051527969 9:18068462-18068484 TTTAAGTTCCTTATATAAAATGG - Intergenic
1053517844 9:38746579-38746601 TTTTATTAAATTGGATACAAGGG + Intergenic
1054738976 9:68785524-68785546 TTTTATTACTTTTTATACAAAGG - Intronic
1054959068 9:70946802-70946824 TTTTTGTACTTTGCATAAAAAGG + Intronic
1058199427 9:102020307-102020329 TTTCAGGTCCTTGTGTACAAGGG + Intergenic
1203653110 Un_KI270751v1:148254-148276 TTCAAGTGCCTTGTATAGAATGG - Intergenic
1185915211 X:4027346-4027368 TTTTATTAACATGTATACAGAGG + Intergenic
1185953164 X:4458736-4458758 TTGCACTACCTTCTATACAATGG + Intergenic
1188563497 X:31497530-31497552 TCTTAGTACTTTTTACACAAAGG - Intronic
1189951136 X:46232305-46232327 TTTGAGTTCCTTGTATACTCTGG - Intergenic
1190423317 X:50308225-50308247 CTTCATTACCTTATATACAAAGG - Intronic
1193587345 X:83341606-83341628 TTTTAGCACCATGTAGACATAGG + Intergenic
1194136965 X:90157031-90157053 TTTTAGTACCTTGCATATTCTGG - Intergenic
1197107696 X:122735321-122735343 TTTAAGTTCCTTGTAGACTATGG - Intergenic
1197516151 X:127432137-127432159 TTTAAGTACCTTGTAGACTCTGG + Intergenic
1199432810 X:147779848-147779870 TTGCAGTACCTCTTATACAAGGG + Intergenic
1199434743 X:147800929-147800951 TTTGAGTTCCTTGTATACTCTGG - Intergenic
1200482704 Y:3726973-3726995 TTTTAGTACCTTGCATATTCTGG - Intergenic
1200857401 Y:7954049-7954071 TTTTAATAACATGTATAGAAGGG + Intergenic
1200869913 Y:8086668-8086690 TTTTTCCACCTTGTATACAGTGG - Intergenic
1200870244 Y:8090001-8090023 TTTTTCAACCTTGTATACAGTGG - Intergenic
1200890358 Y:8317076-8317098 TTTTTCAACCTTGTATACAGTGG + Intergenic
1201173037 Y:11289412-11289434 TTCAAGTGCCTTGTATAGAATGG - Intergenic
1201316399 Y:12651192-12651214 TTTTAGTATATTGTATTCATGGG + Intergenic
1201352258 Y:13056726-13056748 TTTCAGTTCCTTGTATACTCTGG + Intergenic
1202259505 Y:22955576-22955598 TTTTTCAACCCTGTATACAATGG + Intergenic
1202412491 Y:24589320-24589342 TTTTTCAACCCTGTATACAATGG + Intergenic
1202458289 Y:25080750-25080772 TTTTTCAACCCTGTATACAATGG - Intergenic