ID: 960223020

View in Genome Browser
Species Human (GRCh38)
Location 3:115138273-115138295
Sequence CTATTTGCAACAGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960223020 Original CRISPR CTATTTGCAACAGTGGAGCT GGG (reversed) Intronic
901019046 1:6246747-6246769 TTAGGTGCGACAGTGGAGCTGGG - Intergenic
902649048 1:17824847-17824869 CTATTTGAAAAAGAGGACCTTGG + Intronic
903029866 1:20456174-20456196 CTATTTAGAAATGTGGAGCTGGG - Intergenic
906152082 1:43593310-43593332 GTATGTGCATCAGTGGATCTTGG + Intronic
910160894 1:84271115-84271137 TTCATTGCAACAGTGGAGGTGGG + Intergenic
910882323 1:91933040-91933062 CTATTTAAAACAGTGAAGCCAGG + Intergenic
911244032 1:95497031-95497053 GTACTTGCAAAAATGGAGCTGGG + Intergenic
914522367 1:148429089-148429111 CAATTTGCAATAGTGGAGTGTGG - Intergenic
916763053 1:167834207-167834229 CCATTTTAATCAGTGGAGCTGGG - Intronic
917654274 1:177110808-177110830 CTTTTTTCTACAGTGGACCTTGG - Intronic
919902135 1:202051953-202051975 ATATTTGTAACAGTAGAACTTGG - Intergenic
921004022 1:211075285-211075307 CTTTTGTCAACAGTGGAGATGGG - Intronic
923071633 1:230570707-230570729 GTCTTTTCAACAGTGGTGCTAGG - Intergenic
923148315 1:231213193-231213215 CCATTTGAAACTGTGGAGCATGG - Intronic
924639081 1:245816359-245816381 CTGTTTGCTAGAATGGAGCTTGG + Intronic
1063716823 10:8535788-8535810 CCCTTTGCAGCAATGGAGCTAGG - Intergenic
1068777607 10:60885049-60885071 CTATATGCAACTGTGGTCCTAGG - Intronic
1069030920 10:63595311-63595333 CTATTTGGAACAGAGCAGCCAGG - Intronic
1073262280 10:102199684-102199706 CTATTTGTAACAGTAGACCAGGG - Intergenic
1076210251 10:128634993-128635015 TGATTTTCAGCAGTGGAGCTGGG - Intergenic
1077826672 11:5817589-5817611 GTATTTGCACTAGTGAAGCTTGG + Intronic
1078063958 11:8065872-8065894 CTATGTGCAGGAGTGGTGCTAGG - Intronic
1081170393 11:39862127-39862149 GTCTTTTCAACAGTGGTGCTGGG - Intergenic
1085012961 11:73154068-73154090 CCATTTGCAAAAATGGAGTTTGG - Intergenic
1085849180 11:80099737-80099759 TTATTTACAAAAGTGGTGCTTGG + Intergenic
1089967912 11:122668880-122668902 CTCTCTGAAACAGTGGTGCTTGG - Intronic
1094058762 12:26291671-26291693 CTATTTGAAACAGTGGAGGTAGG - Intronic
1095465133 12:42482481-42482503 CTATTTTCAACAGTGGCCCGAGG + Intronic
1095587070 12:43861148-43861170 GTATTTTCAGCAGTGGAGGTGGG + Intronic
1097719097 12:63001093-63001115 CTATTTCCAACAATAGACCTGGG - Intergenic
1099003225 12:77205846-77205868 CAATATACAACAGTGGAACTGGG - Intergenic
1099028581 12:77496245-77496267 TTATTTTCAACAGTGCAGCTGGG + Intergenic
1099136558 12:78911097-78911119 CTATTTACAACACTGAAGCTTGG - Intronic
1099346047 12:81500986-81501008 CTATTTTCAACAGAGTAGCCAGG + Intronic
1100106249 12:91176963-91176985 GTATTTGCCACAGGGGAGATTGG - Intronic
1101436182 12:104666753-104666775 CTGTGTGGAACAGTAGAGCTGGG + Intronic
1101996256 12:109527317-109527339 CTAATTAAAACAGTGGAGCCTGG + Intronic
1103261103 12:119589775-119589797 CTTAGTGCAACAGTGGTGCTCGG + Intergenic
1105238503 13:18586220-18586242 CTATTTGCAATAGTCAAGATAGG - Intergenic
1113058971 13:106300529-106300551 CTATTGGGAACTGTGGATCTAGG + Intergenic
1114868219 14:26624015-26624037 ATATTAGCACCAGTGGTGCTGGG + Intergenic
1116958776 14:50949101-50949123 ATATTTGAAACAGCGGAGCCTGG - Intergenic
1118896834 14:69952367-69952389 GCATTTGCAACAGGGAAGCTTGG + Intronic
1119378676 14:74214914-74214936 CTAGTGGCAACAGTGGACATGGG + Intergenic
1126223484 15:46242340-46242362 TAATTTGCAAAAGTGGAGCTTGG + Intergenic
1129580680 15:76806271-76806293 GTATTTTCAACAGTGGTGTTAGG - Intronic
1133656966 16:7874747-7874769 GTCTTTGTAACAGTGGTGCTGGG - Intergenic
1137596369 16:49726717-49726739 CTTTTTGCCACAGTGTAGATAGG - Intronic
1140608063 16:76564586-76564608 CCATTTTGGACAGTGGAGCTGGG + Intronic
1140734731 16:77888136-77888158 CTACTTTCAAGAGTGGGGCTGGG - Intronic
1144276897 17:13678931-13678953 GTATTTGTAGCAATGGAGCTGGG - Intergenic
1144684091 17:17214906-17214928 CTGTTTCCAAAAGAGGAGCTGGG - Intronic
1145105056 17:20108259-20108281 GTATTTGCAGGAGTGGAACTAGG + Intronic
1147374532 17:40015947-40015969 ATATTAGGAGCAGTGGAGCTGGG + Intronic
1149791248 17:59479348-59479370 TTACTTGCAACAGTGGTGCATGG - Intergenic
1153744062 18:8158946-8158968 TGATTTCCAACAGTGGAGGTGGG - Intronic
1156740344 18:40318991-40319013 ATATAGGCAACAGTGGAGCTGGG + Intergenic
1157328780 18:46688287-46688309 TTATTTGTAACACTGGGGCTTGG - Intronic
1164451905 19:28373500-28373522 GTAATAGCAACATTGGAGCTCGG + Intergenic
926585525 2:14681442-14681464 CCATTTGCAACAAAGGAGCCAGG - Intergenic
930330808 2:49980717-49980739 CTAATTGCAGCAGTGGAGGTAGG - Intronic
930843444 2:55874292-55874314 CTACATGCAACATTGGAGGTAGG + Intronic
931384054 2:61780827-61780849 CTATTTGCAAGACTGGAGTGTGG - Intergenic
935493169 2:103745938-103745960 CTCTTTCCAAGAGTGAAGCTGGG + Intergenic
937908912 2:127065944-127065966 CTGTTAGCTTCAGTGGAGCTGGG - Intronic
938947556 2:136226821-136226843 CTATTTCCCAAAGAGGAGCTAGG - Intergenic
939116907 2:138071194-138071216 CTATCTGGGACAGTCGAGCTTGG - Intergenic
940682716 2:156806582-156806604 CTTTTTGCAATAGTTGAGGTGGG - Intergenic
947501958 2:230677392-230677414 CTCTTGGCAGCAGGGGAGCTTGG - Intergenic
948443535 2:238013786-238013808 CTAATTGTAACAGTGGGGCAGGG + Intronic
948515540 2:238501160-238501182 CTATTTGCAAGTGCCGAGCTCGG + Intergenic
1171467095 20:25337309-25337331 CTGTTTGCCACACTGGAGTTAGG - Intronic
1173606026 20:44332342-44332364 GTATTTGAGACAGTGCAGCTTGG - Intergenic
1174709983 20:52694431-52694453 TTATTTGCAAGAGAGAAGCTTGG - Intergenic
1176864512 21:14037868-14037890 TAATTTGCAAAAGTGGAGCTTGG + Intergenic
1178417977 21:32419353-32419375 TTATTAGCAGCTGTGGAGCTGGG - Intronic
1179629662 21:42668596-42668618 TTATTTATAACAGTGGAGATTGG + Intronic
1180052156 21:45336125-45336147 CCATTGGCAACGGTGGAGCAGGG + Intergenic
949780368 3:7680088-7680110 CTAAGTGCATCAGTGGCGCTGGG + Exonic
951061313 3:18210194-18210216 CTAGTTGCAGCAGTGGACCCTGG + Intronic
953735085 3:45487061-45487083 CTATTTCTAACAGTGCAGGTGGG - Intronic
956606150 3:71074915-71074937 CTCTTTCCAGCAGTGGAGATGGG - Intronic
956891194 3:73615929-73615951 CTAATTCCAACATTGGAGGTGGG + Intronic
958071195 3:88614734-88614756 CGATTTGTATCAGTGAAGCTTGG - Intergenic
960223020 3:115138273-115138295 CTATTTGCAACAGTGGAGCTGGG - Intronic
964449470 3:156797557-156797579 CTGTTTGCAACAGTGCACCCTGG - Intergenic
966427214 3:179792379-179792401 CTATTTGAAACAATGGGACTGGG + Intergenic
967946840 3:194810822-194810844 CTATTTGTAATAGTGGGGCTTGG + Intergenic
968218512 3:196915278-196915300 CAACTTGAAGCAGTGGAGCTTGG + Intronic
975756557 4:77577583-77577605 CTATTGACAGCAGTGGAGGTAGG + Intronic
978519368 4:109600115-109600137 ATATTTCCAACAGTGGAAATGGG - Intronic
979485082 4:121262002-121262024 CTGTTTGCAACAGAAGACCTGGG - Intergenic
982386255 4:154806824-154806846 CTTTTTGTAACAGAGGATCTAGG + Intronic
985564683 5:609513-609535 ATATTTTCTACAGTGAAGCTGGG + Intergenic
989354051 5:40521262-40521284 ATCTTTGCATCAGTTGAGCTTGG - Intergenic
990731198 5:58811215-58811237 CAAATGGCAACTGTGGAGCTTGG + Intronic
996654930 5:125924574-125924596 CTATTTGTAACAGTAGACCAGGG + Intergenic
998552017 5:143086918-143086940 ATATTTGAGACAGTGGAGGTAGG - Intronic
999301985 5:150496844-150496866 ATATTTGGAACAATGGAGGTGGG + Intronic
1001372121 5:171215327-171215349 CTATTTGCAATAGCGAAGATTGG - Intronic
1003549742 6:7092653-7092675 TTATTTTCAAAAGTTGAGCTAGG + Intergenic
1004163883 6:13238709-13238731 CTATTTGGCACTTTGGAGCTAGG - Intronic
1005111314 6:22285027-22285049 CTATTTCCAACAGTGAGGATGGG - Intergenic
1007422535 6:41728387-41728409 CTAATTGGAACCGTAGAGCTGGG - Intronic
1009488764 6:64260171-64260193 CTATTTGCTGCAATGCAGCTAGG + Intronic
1011562421 6:88634240-88634262 TTATTTTAAACAGTGGACCTAGG + Intronic
1011846290 6:91567192-91567214 CTCTTTGCAGCAGTGTATCTTGG + Intergenic
1012558668 6:100550023-100550045 CTATTAGTAGCAGTGGAGTTGGG + Intronic
1015447598 6:133325774-133325796 TTCATTGCAACAGTAGAGCTGGG - Intronic
1015859129 6:137656917-137656939 CTGTTTGCAAGAGGGGAGCCTGG + Intergenic
1016839452 6:148511659-148511681 CTTTTTGCCACAGTGAATCTGGG + Intronic
1021438519 7:20650228-20650250 TCATTTTCAACAGTAGAGCTGGG + Intronic
1023304618 7:38812302-38812324 GTCTTTGCAACAGTGATGCTGGG + Intronic
1023964954 7:44958809-44958831 CTATTATGAACAGTGGTGCTAGG - Intergenic
1028912450 7:96223828-96223850 CTCTCTGCTACTGTGGAGCTAGG + Intronic
1029231226 7:99070525-99070547 GTACTTGCTTCAGTGGAGCTAGG - Intronic
1031564430 7:123277772-123277794 CTCTCTGCATCACTGGAGCTGGG + Intergenic
1032835114 7:135665457-135665479 CTATTTTTAATAGTGGAGATAGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1041921969 8:63192369-63192391 CTCTTTGCAAATGTGGAGATGGG + Intronic
1043300300 8:78721555-78721577 GAATTTGCAACAGTGAGGCTGGG + Intronic
1050146596 9:2574651-2574673 CTATTTTCAACCTTGGTGCTAGG + Intergenic
1050701108 9:8339852-8339874 CTTTTTTCAAAAGTGGATCTGGG + Intronic
1055012413 9:71581225-71581247 TTATTCCCAGCAGTGGAGCTGGG + Intergenic
1062560185 9:137138172-137138194 CTATGTGCAGCAGTGCAGCAAGG - Intergenic
1189106317 X:38239330-38239352 CTGTTTGCATCAGTTGAGTTAGG + Intronic
1189556779 X:42153275-42153297 CCTTTTGGAACAGTGTAGCTAGG - Intergenic
1195389934 X:104351125-104351147 AGATTTGCAACAGCAGAGCTAGG + Intergenic
1196733917 X:118968175-118968197 CTAATTCCAACAGTGACGCTGGG + Intergenic
1198609218 X:138379070-138379092 CTATTTACAAAAGTGTGGCTAGG - Intergenic
1199877240 X:151943545-151943567 CTAATTTTAACAGTGTAGCTTGG + Intergenic