ID: 960225574

View in Genome Browser
Species Human (GRCh38)
Location 3:115164413-115164435
Sequence TCTGATTAGCACTAATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960225572_960225574 5 Left 960225572 3:115164385-115164407 CCCAAAAACGCTCATAGCATTTA No data
Right 960225574 3:115164413-115164435 TCTGATTAGCACTAATTTTCTGG No data
960225573_960225574 4 Left 960225573 3:115164386-115164408 CCAAAAACGCTCATAGCATTTAA No data
Right 960225574 3:115164413-115164435 TCTGATTAGCACTAATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960225574 Original CRISPR TCTGATTAGCACTAATTTTC TGG Intergenic
No off target data available for this crispr